Single-cell methods for characterizing cell-cycle dynamics in unperturbed cells

We used 2 complementary single-cell methods to chronicle the dynamics of key cell-cycle regulators. The first method uses 4-color IF snapshot images to categorize individual cells as G1, S, G2, M, or G0/quiescent. This approach has the advantage of being readily applicable to any cell line without the need to insert fluorescent sensors or perform time-lapse microscopy but does not explicitly carry time-dependent information. By co-staining cells with Hoechst (to measure DNA content) and EdU (a marker for DNA synthesis) [34], we could subdivide the cell cycle into 5 categories (Fig 1B–1D and S1B Fig): cells with 2N DNA content and no EdU incorporation were classified as G0 or G1; cells with near 2N DNA content and intermediate EdU signal were classified as early S phase; cells with high EdU signal were classified as S phase; cells with near 4N DNA content and intermediate EdU signal were classified as late S phase; and cells with 4N DNA content and no EdU incorporation were classified as G2 or M (Fig 1B).

To further distinguish cells in G0 from cells in G1, we co-stained cells with an antibody against phospho-Rb at either Serine 780 or Serine 807/811. These sites are phosphorylated by CDK2 and thus can serve as a fixed-cell readout of CDK2 activity. The phospho-Rb signal is bimodally distributed, representing hypo- and hyper-phosphorylated Rb (Fig 1C). Newly born cells with hypo-phosphorylated Rb were previously shown to be in the CDK2^low state, whereas newly born cells with hyper-phosphorylated Rb are in the CDK2^inc state [11]. Therefore, EdU-negative cells with 2N DNA content and hypo-phosphorylated Rb are classified here as G0/quiescent, and EdU-negative cells with 2N DNA content and hyper-phosphorylated Rb are classified here as G1 (Fig 1C). To distinguish cells in G2 from cells in M, we used an antibody against phospho-Histone H3 (pHH3), a well-established marker for mitosis. EdU-negative cells with 4N DNA content that were pHH3-negative were classified as G2, and cells that were pHH3-positive were classified as mitotic (Fig 1D). We used 3 fluorescent channels to stain cells with Hoechst, EdU, and either phospho-Rb or pHH3 (S1C Fig), and used the fourth channel to measure 1 of 14 proteins of interest in MCF10A human mammary epithelial cells. We also validated our results in Hs68 human foreskin fibroblasts. We avoided use of cancer cell lines, which often have mutations in the core cell-cycle regulatory network.

The second method involves time-lapse microscopy over 24 hours of MCF10A cells expressing Histone 2B (H2B) fused to mTurquoise and the CDK2 sensor fused to mVenus. Immediately after the last frame was taken, cells were fixed with para-formaldehyde, processed for IF, and reimaged. Custom MATLAB-based cell-tracking scripts were used to extract single-cell traces of CDK2 activity, with a custom “jitter correction” to re-register the images before and after IF (see Materials and methods). In this way, we can match each cell’s IF staining to its history. The H2B signal is used to automatically identify the frame of anaphase for each cell, which enables automated alignment of all CDK2 activity traces (and consequently each cell’s IF signal) to each cell’s final anaphase of the movie.

The resulting plot demonstrates the bifurcation in CDK2 activity that is evident as cells complete mitosis and assume either a CDK2^inc, CDK2^low, or CDK2^emerge state (Fig 1E) [11]. Another subset of cells has no mitoses during the course of the 24-hour movie, of which a further subset has low CDK2 activity for the entire 24-hour imaging period. Although these cells are not cycling, they are also not senescent (S2A–S2C Fig) and thus appear to be in a prolonged quiescence (Fig 1F). Indeed, we confirmed that these cells can emerge from this prolonged quiescence (S2D Fig). In our unperturbed MCF10A cells, 95.6% ± 5.4% of the total population divided at least once during the 24-hour imaging. Of the total population,79.0% ± 6.2% entered the CDK2^inc state after mitosis, 8.8% ± 2.6% remained CDK2^low after mitosis, and 7.8% ± 1.7% entered the CDK2^low state after mitosis but built up their CDK2 activity before the end of the imaging period (CDK2^emerge) (Fig 1E). Among the 4.4% that did not divide during the course of the movie, 52.3% ± 17.7% stayed in a prolonged quiescence (representing 2.3% ± 0.8% of the total population, Fig 1F) and 47.7% ± 17.7% (or 2.1% ± 0.8% of the total population) were observed to build up CDK2 activity before the end of the imaging period (S1 Movie and S2D Fig). For CDK2^emerge cells, automated identification of the time point when cells begin building up CDK2 activity after being in a CDK2^low state allows automated alignment of CDK2^emerge traces to this event (Fig 1G), which we have previously argued represents the R-point [11,35]. Alignment of the CDK2 activity traces in these various ways allows for the staging of IF-based protein levels or modification states as a function of time-since-anaphase, or time-since-R-point.

Cells treated with EdU for 15 minutes at the end of a 24-hour time-lapse sequence illustrate the power of this approach—CDK2^inc cells display the classic “rainbow” pattern of EdU as a function of time-since-anaphase, allowing us to identify and label G1, S, and G2 phases of the cell cycle in our time-lapse + IF experiments (Fig 1H, blue). CDK2^low cells (Fig 1H, red) and prolonged quiescent cells (Fig 1H, purple) display no EdU signal. A moving average through the CDK2^inc and CDK2^low subpopulations further illustrates the effect (Fig 1I). CDK2^emerge cells aligned to the time at which CDK2 activity begins to increase show a pattern similar to the CDK2^inc cells but with less clarity due to the difficulty of automating the identification of the first frame of CDK2 activity rise (relative to the easy automatic identification of the first frame of anaphase; Fig 1J). This plot shows that CDK2^emerge cells begin S phase at a similar time after the initial CDK2 activity buildup as CDK2^inc cells.

These 2 methods were used to chronicle the dynamics of 14 proteins during cell-cycle progression and spontaneous quiescence. The proteins were chosen because of the availability of selective antibodies, their role as core cell-cycle regulators (Cyclin A2, Cyclin B1, Cyclin E, Cyclin D1, p21, p27, Cdt1, Geminin, total Rb, and phospho-Rb), or as important signaling inputs to the cell cycle (cMyc, Fra1, phospho-cJun, and p53). Nine proteins were highly dynamic over the course of the cell cycle (Cyclin A, Cyclin B, Cyclin E, Cyclin D, p21, Cdt1, Geminin, cMyc, and phospho-Rb; Figs 2–5 and S3 Fig), whereas others tested were relatively invariant over the cell cycle in the cell types examined here (p27, total Rb, p53, Fra1, and phospho-cJun; S4 and S5 Figs).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Protein levels for asynchronous MCF10A cells in G0, G1, S, G2, and M phases of the cell cycle.

(A–H) Column 1: Density scatter of the indicated protein versus DNA content; data are pooled from 9 IF images from 1 representative well. Column 2: Contour plot of the indicated protein versus DNA content; contours are color-coded by cell-cycle phase according to the legend. Data are pooled from 9 IF images from 1 representative well. Column 3: Histogram (probability density) of the indicated protein for G0 cells (purple, defined as 2N DNA content, EdU-negative, and hypo-phosphorylated Rb) versus G1 cells (blue, defined as 2N DNA content, EdU-negative, and hyper-phosphorylated Rb). Two biological replicates are shown; each replicate represents 9 pooled IF images. Note that the y-axes for Column 1 and Column 2, and the x-axis for Column 3, are in log base 10; units are arbitrary fluorescence units. All signals are nuclear except where indicated. Also note that because of cell rounding during mitosis, IF signal intensities are artificially high in mitotic cells. Abbreviation: Cyto-CycB1, Cytoplasmic Cyclin B1 signal; IF, immunofluorescence; Rb, retinoblastoma protein.

https://doi.org/10.1371/journal.pbio.2003268.g002

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Protein dynamics for proliferating and spontaneously quiescent MCF10A cells.

(A–I) Column 1: Time-lapse imaging of CDK2 activity in asynchronous cells was followed by fixation and IF staining for the indicated protein. Protein signals were then reconstructed as a function of time-since-anaphase for CDK2^inc cells (blue dots) and CDK2^low cells (red dots), as in Fig 1H. The protein signal in prolonged quiescent cells is plotted at the 24-hour mark (purple dots). The approximate time spent in G1, S, or G2 is marked above the plots, based on EdU incorporation data from Fig 1H. Column 2: Moving average through the blue, red, or purple points from Column 1, as in Fig 1I. Error bars represent standard deviation. Column 3: Protein signal as a function of time since CDK2 activity buildup (R-point), as in Fig 1J. The y-axis units are arbitrary fluorescence units. Total number of cells plotted: (A) 1,949; (B) 433; (C) 1,549; (D) 1,729; (E) 2,596; (F) 1,043; (G) 1,885; (H) 2,117; (I) 1,300. The data for each antibody are pooled from 8 replicate wells (1 image per well). Abbreviations: CDK2, Cyclin-Dependent Kinase 2; IF, immunofluorescence; R-point, Restriction Point.

https://doi.org/10.1371/journal.pbio.2003268.g003

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Validation of antibody staining in serum-starved cells and validation of Cyclin D1 results by time-lapse imaging of mCitrine-Cyclin D1.

(A–B) Cells were serum starved for the indicated time and analyzed by western blotting (A) or IF (B). (B) Column 1: Quantification of western blots in (A). Column 2: Average IF signal of the indicated antibody signal across 3 replicate wells upon serum starvation for the amounts of time indicated in (A). Error bars represent standard deviation from 3 replicate wells. Column 3: Probability density of the indicated antibody signal at 0, 16, 48, 96, and 168 hours after serum withdrawal. (C) Time-lapse imaging of asynchronous mCitrine-Cyclin D1 knock-in MCF10A cells expressing H2B-mTurquoise and mCherry-tagged CDK2 sensor. Single cell traces of CDK2^inc and CDK2^low cells are colored blue and red, respectively, and computationally synchronized to anaphase onset. Upper panel: traces of CDK2 activity in control treatment. Middle panel: corresponding traces of mCitrine-Cyclin D1 level in control treatment. Lower panel: traces of mCitrine-Cyclin D1 level in cells that received 1.4 μM MLN4924 at 1-2 hours after anaphase onset. (D) Examples of single-cell traces of CDK2 activity and mCitrine-Cyclin D1 in 1 CDK2^inc cell (top) and 1 CDK2^low cell (bottom). In CDK2^inc cells, mCitrine-Cyclin D1 levels are moderate in G1, fall in S phase, and increase again in G2, whereas mCitrine-Cyclin D1 levels begin to increase steadily shortly after mitosis in CDK2^low cells. Orange arrows mark mitoses. Abbreviations: CDK2, Cyclin-Dependent Kinase 2; IF, immunofluorescence; R-point, Restriction Point.

https://doi.org/10.1371/journal.pbio.2003268.g004

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Data synthesis to generate maps of protein dynamics during cell-cycle progression and cell-cycle exit.

(A) Moving average traces from Fig 3 Column 2 were normalized such that the minimum signal experienced across CDK2^inc and CDK2^low data for a given protein was set to 0, and the maximum signal experienced across CDK2^inc and CDK2^low data for this protein was set to 1. The approximate time spent in G1, S, or G2 phases is marked above the plots, based on EdU incorporation data from Fig 1H. Group 1 (top row): protein signals that are “off” in quiescent cells. Group 2 (bottom row): protein signals that change dynamically over time in quiescent cells. (B) Schematized representation of the data from (A).

https://doi.org/10.1371/journal.pbio.2003268.g005

Characterization of the dynamics of a core cell-cycle network

Using multi-color IF in MCF10A cells, we began by inferring the dynamics of various cell-cycle proteins using (1) a density scatter plot of signal intensity versus DNA content (Fig 2, Column 1); (2) a contour plot of signal intensity versus DNA content, in which cells are grouped into 7 cell-cycle phases, as described in Fig 1B–1D and S1B Fig (Fig 2, Column 2); and (3) a histogram of signal intensity in G0/quiescent cells (2N, EdU-negative, hypo-phosphorylated Rb) versus G1 cells (2N, EdU-negative, hyper-phosphorylated Rb), as defined in Fig 1C (Fig 2, Column 3). We also repeated these experiments in a second cell type, non-immortalized Hs68 human foreskin fibroblasts (S3 and S4 Figs).

Cyclin A2 and Cyclin B1, two of the best-understood cell-cycle proteins, behaved in textbook fashion and serve as a proof-of-principle. In cycling cells, Cyclin A2 rose linearly during S and G2, consistent with previous reports (Fig 2A, scatter and contour plots; and Fig 3A) [31,32,33,36,37]. Cyclin B1 levels did not begin to rise until late S but then rose supra-linearly, as previously reported (Fig 2B, scatter and contour plots; and Fig 3B) [16,31,32]. Cyclins A2 and B1 were both degraded in mitosis [38,39], and both were undetectable in G0 and G1 cells (Fig 2A and 2B, histograms; and Fig 3A and 3B).

When Cyclin E levels were plotted against DNA content, we detected a subtle “N”-shaped pattern in which Cyclin E rose in G1 and fell in S phase, as expected (Fig 2C, scatter plot; [31,36,40,41]). The rise in G1, and fall in early S phase, of Cyclin E is also detected in the time-lapse + IF data for CDK2^inc cells (Fig 3C). In contrast with Cyclins A2 and B1, which remained “off” in CDK2^low cells, Cyclin E levels rose steadily in CDK2^low cells (Fig 3C). This is surprising because Cyclin E is overexpressed in several cancers and Cyclin E/CDK2 activity is a major driver of cell-cycle progression [42]. Therefore, we expected Cyclin E levels to be lower in spontaneously quiescent cells compared with proliferating cells. We note, however, that these high levels of Cyclin E in G0/quiescent cells are not accompanied by high CDK2 activity and thus are not able to stimulate cell-cycle progression; by definition, we identify these quiescent cells because of their lack of CDK2 activity (CDK2^low). This lack of CDK2 activity despite high levels of Cyclin E is likely due to the accompanying high levels of p21 in these cells (see below). Thus, a likely explanation for the high levels of Cyclin E in G0/quiescent cells may be that Cyclin E in these cells has not been subjected to S phase–mediated degradation, which depends on CDK2 activity [40,41]. We also observed that the Cyclin E antibody utilized here, the widely used clone HE12, detects a strong nonspecific signal in MCF10A cells, in addition to detecting Cyclin E (S6A and S6B Fig). Thus the difference in Cyclin E signal between CDK2^low and CDK2^inc cells may be partly obscured by the nonspecific signal.

The patterns displayed by Cyclin D1 were also unexpected. MCF10A cells express Cyclin D1, D2, and D3, with Cyclin D1 at the highest level of the three [43]. Thus Cyclin D1 is the prevalent D-type cyclin in our cells, and the antibody used in this study is selective for Cyclin D1 (S6A and S6B Fig). When Cyclin D1 levels were plotted against DNA content, we detected a “U”-shaped pattern in which Cyclin D1 is high in cells with 2N DNA content, low in S phase, and elevated again in cells with 4N DNA content (Fig 2D, scatter and contour plots). This pattern has been reported previously [44,45] but is not widely appreciated. Upon closer inspection, the EdU-negative cells with 2N DNA content reveal highly heterogeneous expression of Cyclin D1—cells with hypo-phosphorylated Rb (G0 cells) have much higher levels of Cyclin D1 than cells with hyper-phosphorylated Rb (G1 cells) (Fig 2D, histogram). Like Cyclin E, this is surprising because Cyclin D is considered a driver of the cell cycle and is overexpressed in several cancers [46]; therefore, its levels are expected to be higher in proliferating cells than in quiescent cells. When we examined our time-lapse + IF data, we observed the same phenomenon—cells born into the quiescent CDK2^low state had high Cyclin D1 levels, whereas CDK2^inc cells that were actively progressing through the cell cycle again displayed a “U”-shaped pattern, with Cyclin D1 levels being moderate in G1, low in S phase, and moderate again in G2 (Fig 3D). In addition, prolonged quiescent cells also have high Cyclin D1 levels (Fig 3D, purple).

By way of explanation, we considered the possibility that Cyclin D1 levels appear higher in G0 cells simply because Cyclin D1 in these cells has not been subjected to S phase-mediated degradation [47,48]. However, the moving average of Cyclin D1 levels indicated that CDK2^low cells have higher levels of Cyclin D1 than CDK2^inc cells, even in cells 2 hours after birth, before S phase-mediated degradation could play a role. We also note that CDK2^low cells have more Cyclin D1 than CDK2^inc cells ever have, at least on average. However, high levels of Cyclin D do not necessarily correspond to high CDK4/6 activity [49,50], and there is as yet no single-cell assay to measure CDK4/6 activity in these cells. An alternative explanation for the high Cyclin D1 levels in CDK2^low cells is that Cyclin D1 protein levels are stabilized by high levels of p21 in these cells [51,52,53].

Indeed, p21 displays the same “U”-shaped pattern as Cyclin D1 does when plotted against DNA content (Fig 2E, scatter and contour plots). As with Cyclin D1, cells with hypo-phosphorylated Rb (G0/quiescent cells) have high levels of p21, whereas EdU-negative, 2N DNA content with hyper-phosphorylated Rb (G1/proliferating cells) have very low levels of p21 (Fig 2E, histogram). Moreover, time-lapse + IF data revealed that p21 levels are high in newly born G0/CDK2^low cells and very low in newly born G1/CDK2^inc cells, as reported previously (Fig 3E) [11]. CDK2^emerge cells show initially high levels of p21 that then decay around the time that CDK2 activity turns back on (Fig 3E, green), consistent with the notion that a decay in p21 enables a rise in CDK2 activity.

CDK2^inc cells maintain very low levels of p21 throughout all of G1 and S phase (Fig 2E, contour plot; and Fig 3E, blue). While these data are consistent with our previous studies [11,29], these results differ from the common notion that p21 levels are generally high in G1 cells [54]. A likely explanation for this discrepancy is that many previous studies used various treatments (e.g., nocodazole or serum starvation) for cell synchronization, which exert stress on cells and can increase p21 levels [55,56]. Furthermore, immunoblotting does not allow fine-grained analysis of p21 heterogeneity or temporal behavior. More recent single-cell experiments tracking exogenous YFP-p21 in U2OS osteosarcoma cells detected newly born cells with and without YFP-p21 [57]. However, without a live-cell marker to distinguish G0 from G1, it is not possible to know if the newly born cells with elevated p21 are actually passing through a G0/CDK2^low state rather than going straight to G1. Similarly, the cells born without detectable p21 could represent a G1/CDK2^inc subpopulation.

The dynamics of Cdt1 are expected to have some similarities to p21 because both proteins are substrates of the E3 ubiquitin ligase CRL4^Cdt2 [13], a feature reflected in our IF data (Fig 2F, scatter and contour plots). However, in direct contrast to p21, Cdt1 levels are high in G1 cells and lower in G0/quiescent cells (Fig 2F, histogram). Time-lapse + IF data show a similar trend, revealing that any residual Cdt1 present in CDK2^low cells is quickly degraded to the basal level seen in S phase cells (Fig 3F). The levels of Geminin, an inhibitor of Cdt1, are out of phase with Cdt1, as expected [13,58,59]. Geminin levels are undetectable in quiescent CDK2^low cells and begin to rise in early S phase, consistent with Geminin’s role as a substrate of the APC/C (Figs 2G and 3G) [35,58]. However, unlike Cyclin A2, which rises steadily and linearly, Geminin levels plateau by mid-to-late S phase, a feature seen in both IF and time-lapse + IF data, suggesting an additional layer of transcriptional regulation.

We also examined the cell-cycle dynamics of c-Myc, a key protein that links MAPK signaling to cell-cycle entry [60]. More recently, c-Myc has been shown to act as a “transcription amplifier” as opposed to a classic transcription factor [61,62]. Here we show that c-Myc is strongly cell-cycle regulated. Immunofluorescence reveals that c-Myc levels are higher in G1 cells than in G0/quiescent cells (Fig 2H, histogram), consistent with a pro-proliferation role for c-Myc. CDK2^low cells maintain low c-Myc levels as long as they remain in the CDK2^low state but then up-regulate c-Myc upon emerging from the CDK2^low state (Fig 3H). c-Myc levels rise steadily in S and G2 phases (Fig 2H, scatter and contour plots; and Fig 3H).

Phospho-Rb is bimodally distributed among EdU-negative cells with 2N DNA content (Fig 1C) [11]. The switch from hypo- to hyper-phosphorylated Rb marks passage through the R-point [9,63,64], and while this event is often cited as occurring in mid- to late G1 [9,63], we have shown previously that MCF10A cells are born into a state of either hypo- or hyper-phosphorylated Rb immediately upon completion of mitosis [11]. Here we extend this result by confirming that the same is true using an antibody against Rb phosphorylation at another site, Serine 780 (Fig 3I)—cells born into the quiescent CDK2^low state have hypo-phosphorylated Rb, whereas cells born into the cell cycle-committed CDK2^inc state have hyper-phosphorylated Rb. This phospho-Rb-S780 signal continues to rise as CDK2^inc cells progress through the cell cycle. Examination of the CDK2^emerge cells provides additional information by revealing that cells present with hyper-phosphorylated Rb as soon as the rise in CDK2 activity can be detected, indicating that hyper-phosphorylation of Rb occurs prior to or concurrently with activation of CDK2 (Fig 3I, green).

Comparison of spontaneous quiescence with quiescence induced by serum starvation or contact inhibition

Given the surprising behavior of several proteins in spontaneous quiescence (e.g., rising Cyclin D1, Cyclin E, and p21 levels), we compared our results in spontaneously quiescent cells with quiescence induced by well-established methods, namely serum starvation (Fig 4A and 4B) and contact inhibition (S6C Fig). By both quantitative western blotting and IF, we were able to reproduce the canonical protein dynamics upon serum starvation or contact inhibition in which the levels of Cyclin D1, Cyclin E, p21, and all other proteins examined, fell as a function of time in quiescence. We also validated the selectivity of the antibodies used for IF via siRNA knockdown (S6A and S6B Fig) and provide sample images for each IF stain (S7 Fig).

Validation of Cyclin D1 behavior

We next sought to further validate the unexpected dynamics of Cyclin D1 using an antibody-independent method. We used CRISPR-mediated genome editing of MCF10A cells to tag Cyclin D1 at its endogenous locus with mCitrine, a yellow fluorescent protein, and subsequently transduced the cells with H2B-mTurquoise and mCherry-tagged CDK2 sensor. Western blotting and PCR revealed that both alleles of Cyclin D1 were tagged with mCitrine (S8A and S8B Fig) and IF revealed a linear correlation at the single-cell level between the mCitrine-Cyclin D1 signal and an antibody stain against Cyclin D1 (S8C Fig). In agreement with our time-lapse + IF results for Cyclin D1, single-cell tracking of the mCitrine-Cyclin D1 cell line showed that CDK2^low cells have elevated Cyclin D1 levels compared with CDK2^inc cells (Fig 4C red traces, and Fig 4D bottom panel), and that the levels of Cyclin D1 for CDK2^inc cells are moderate in G1, low in S phase, and moderate again in G2 (Fig 4C blue traces, and Fig 4D top panel). These results explain why Cyclin D1 expression was recently reported to be a poor predictor of the time spent between mitosis and S phase [45].

Given that c-Myc levels are low and Rb is hypo-phosphorylated (and thus that E2F transcription is inhibited) in the spontaneously quiescent CDK2^low cells, what factors could be driving the high levels of Cyclin D1? Since these 2 major cell-cycle transcription factors are likely off in CDK2^low cells, we hypothesized that the high Cyclin D1 levels in these cells could be due to a lack of degradation. Indeed, Cyclin D1 levels are strongly regulated not only by transcription but also by protein degradation via cullin-RING ligases (SCF with various F-box proteins) [65]. Because the majority of cullin-RING ligases require covalent modification by NEDD8 for holoenzyme ubiquitin ligase activity, their activity can be inhibited by blocking their neddylation with the small molecule MLN4924 [66]. We therefore filmed mCitrine-Cyclin D1 cells before and after an acute treatment with 1.4 μM of MLN4924 and selected for analysis only those cells that received drug 1–2 hours after mitosis (during G0/G1). Consistent with our hypothesis, inhibition of cullin-RING ligases caused an increase in Cyclin D1 in CDK2^inc cells to a level that was comparable with that in CDK2^low cells. Thus, lack of Cyclin D1 degradation in CDK2^low cells is a major contributor to the high levels of Cyclin D1 seen in these cells.

Cyclin D1 is well known for its short half-life. These results suggest that the stability of Cyclin D1 varies with cell-cycle phase—the half-life of Cyclin D1 is short in CDK2^inc cells but much longer in CDK2^low cells. Together, these validation experiments lend confidence in our overall approach and in the unexpected findings in this work.

Synthesis of data to generate maps of cell-cycle dynamics

To compare the relative protein dynamics in proliferating versus quiescence cells, we normalized and overlaid the moving average data from Fig 3 for CDK2^inc and CDK2^low cells (Fig 5A; note that normalizing the signals masks differences in dynamic range among proteins). Proteins were grouped into 2 plots according to their behavior in quiescent CDK2^low cells—Group 1 contains signals that are “off” in quiescent cells (Fig 5A, top), and Group 2 contains signals that change dynamically over time in quiescent cells (Fig 5A, bottom). The identification of 4 proteins in Group 2 that either steadily increase (Cyclin D1, Cyclin E, p21) or steadily decrease (Cdt1) the longer a cell has been quiescent suggests that quiescence is not just a single static state but rather that certain aspects of a cell’s proteome evolve as a function of time spent in quiescence (at least over the 24-hour period that we measured).

We then schematized these results to create diagrams that depict the chronology and dynamics of cell-cycle events (Fig 5B). The 5 proteins in Group 1 all increase their levels as cells progress through the proliferation cycle, albeit with different dynamics. Cyclin A2 starts to accumulate in S phase and continues to increase until M phase. Geminin begins to accumulate at the same time but plateaus in G2. Cyclin B1 and c-Myc remain low until late S phase. Rb phosphorylation on Serine 780 steadily increases throughout the whole proliferative cycle. All of these proteins reset at mitosis and maintain low levels in quiescent cells. The dynamics of Group 2 proteins are more variable. Cyclin D1 and Cdt1 turn on in G2 after being low or off in S phase. Cyclin D1 increases further if cells go into G0, and degrades when CDK2^inc cells re-enter the cell cycle. Cdt1 decreases slowly when cells enter the CDK2^low state and decreases rapidly when CDK2^inc cells enter S phase. Cyclin E starts to increase at the completion of mitosis and continues to increase throughout G0 and G1; Cyclin E levels drop because of degradation at the G1/S transition but remain elevated in G0/quiescent cells. p21 levels are low in proliferating cells but increase steadily once cells enter quiescence. Such diagrams provide a quantitative resource for understanding the dynamics of cell-cycle proteins relative to one another.

Cell culture and reagents

MCF10A human mammary epithelial cells were maintained in DMEM/F12 (ThermoFisher) supplemented with 5% horse serum (Invitrogen), 20 ng/ml epidermal growth factor (EGF, Sigma-Aldrich), 0.5 mg/ml hydrocortisone (Sigma-Aldrich, St. Louis, MO), 100 ng/ml cholera toxin (Sigma-Aldrich), 10 μg/ml insulin (Invitrogen), and penicillin/streptomycin. For serum starvation media, the horse serum, EGF, and insulin were removed, and 0.3% BSA was added. For live-cell time-lapse imaging, phenol-red free DMEM/F12 was used. Hs68 primary human foreskin fibroblasts were cultured in DMEM with 10% FBS and penicillin/streptomycin. Both cell lines were purchased from ATCC. Hs68 cells can be propagated for 42 passages according to ATCC and are not immortalized; cells were received at passage 12 and were used within 13 passages of receipt. MCF10A cells expressing the CDK2 sensor (DHB-mVenus) and tagged histone H2B (H2B-mTurquoise) are as described [11].

Integration of the mCitrine-encoding gene into the CCND1 locus was carried out using CRISPR technology [68]. A CRISPR-Cas9 ribonucleoprotein (RNP) complex was generated using the CRISPR-Cas9 System from IDT. The RNP contains crRNA (GGAGCUGGUGUUCCAUGGCUGUUUUAGAGCUAUGCU) annealed to tracrRNA and Cas9 nuclease. The RNP was electroporated into MCF10A cells using the Neon system from Life Technologies following the manufacturer’s protocol with 2 pulses, 30 ms at 1150 V. Single cells were sorted by flow cytometry into 96-well plates and grown into clones. Western blot and IF against Cyclin D1 protein, as well as PCR of the CCND1 gene, were carried out as validation. Data from clone 2A7 is shown in this work (S8 Fig). For functional validation, cells were treated with Mek inhibitor (PD0325901, S1036 from Selleckchem) at 100 nM for 32 hours, or treated for 32 hours followed by a Mek inhibitor washout for 6 hours. To confirm a similar response to inhibition of degradation for both mCitrine-Cyclin D1 and endogenous Cyclin D1, the mCitrine-Cyclin D1 line and parental wild type MCF10A line were treated with MLN4924 (Active Biochem, A-1139) at 1.4 μM or Bortezomib (Cayman Chemical,10008822) at 1 μM for 2 hours (S8A Fig).

siRNA

siRNA oligos were synthesized by Dharmacon: CCNA2 (MU-003205-02-002), CCNE1 (MU-003213-02-0002), CCNE2 (MU-003214-02-0002), CDKN1A (MU-003471-00-0002), CCND1 (MU-003210-05-0002), RB1 (MU-003296-03-0002) or IDT: CCNB1 (hs.Ri.CCNB1.13.1), GMNN (hs.Ri.GMNN.13.1), CDT1 (hs.Ri.CDT1.13.2), MYC (hs.Ri.MYC.13.2), and Negative Control DsiRNA (51-01-14-04). The oligos were electroporated into MCF10A cells following manufacturer’s instruction (Neon system, Life Technologies). Cells were fixed for IF or lysed for western blotting 20 hours (for short-live proteins: Cyclin A2, Cyclin B1, Cyclin E, Cyclin D1, c-Myc, p21, Geminin, and Cdt1) or 48 hours (for longer-live proteins: Rb) after the electroporation.

Immunofluorescence

Antibodies used in this study are p21 Waf1/Cip1 (CST #2947) at 1:250, phospho-Rb (Ser807/811) (CST #8516) at 1:250, phospho-Rb 780 (BD Biosciences #668385) at 1:250, p21 (BD Biosciences #556430) at 1:250, total Rb (a gift from Julien Sage) at 1:200, p53 (DO-1) (Santa Cruz sc-126) at 1:100 and p53 (Ab-1) (Calbiochem OP03) at 1:100, Fra-1 (Santa Cruz #28310) at 1:200, Cyclin E clone HE12 (Zymed #32–1600) at 1:400, Cyclin D1 clone SP4 (Thermo Scientific RM-9140-S0) at 1:250, Cyclin A2 (Santa Cruz #751) at 1:500, phospho-Histone H3 (Ser10) (CST #9706 and #9701) at 1:200, p27 (BD Bioscience #610241) at 1:100, Geminin (CST #5165) at 1:250, Cyclin B1 (CST #4138) at 1:100, c-Myc (CST #5605) at 1:250, CDT1 (CST #8064) at 1:200, phospho-c-Jun (Ser73) (CST #3270) at 1:800, and Alexa Fluor-488, -546, -647 secondary antibodies (ThermoFisher) at 1:500.

For Cyclin E IF, cells were fixed in −20°C methanol for 5 minutes and then washed twice with PBS. For all other antibodies, cells were fixed with 4% paraformaldehyde and then washed twice with PBS. Cells were then incubated with a blocking/permeabilization buffer (10% FBS, 1% BSA, 0.1% TX-100 and 0.01% NaN₃ for antibodies against Cyclin E, p21, Cdt1, Geminin, Fra1, p53, and phospho-c-Jun) for an hour at room temperature, or sequentially permeabilized with 0.2% TX-100 for 15 minutes at 4°C and blocked with 3% BSA for an hour at room temperature (for antibodies against Cyclin A2, Cyclin B1, Cyclin D1, c-Myc, p27, and total Rb). Primary antibody staining was carried out overnight at 4°C in the corresponding blocking buffer and visualized using secondary antibodies conjugated to Alexa Fluor-488, -546, or -647. Where phospho-Rb and phospho-Histone H3 antibodies were used in conjunction with an antibody for a protein of interest in Fig 2, cells were processed using the method appropriate for the protein of interest. Where indicated, cells were incubated in media containing 10 μM EdU for 15 minutes, and then fixed and processed according to manufacturer’s instructions (ThermoFisher #C10340).

Images were acquired on an ImageXpress Micro XLS widefield microscope (Molecular Devices) with a 10X 0.45NA objective and processed using custom scripts in MATLAB.

Time-lapse microscopy

Cells were plated at least 24 hours prior to imaging in phenol red-free full-growth media in a 96-well plate (Greiner bio-one #655090) such that the density would remain subconfluent until the end of the imaging period. Images were acquired every 12 minutes on an ImageXpress Micro XLS widefield microscope (Molecular Devices) with a 10X 0.45NA objective; CFP exposure = 75 ms; YFP exposure = 200 ms. Cells were imaged in a humidified, 37°C chamber at 5% CO₂.

Image processing and cell tracking

Images were processed as described in Cappell et al., 2016 ([35]), with a general description reproduced here: Mean nuclear intensities were measured by averaging the background-subtracted pixel intensities in each nucleus as defined by a nuclear mask. The nuclear mask was established by performing segmentation on H2B-mTurquoise- or Hoechst-stained images as follows. Log-transformed images were convolved with a rotationally symmetric Laplacian of Gaussian filter and objects were defined as contiguous pixels exceeding a threshold filter score. In order to segment cells in contact with their nearest neighbor, a custom segmentation algorithm was implemented to detect and bridge concave inflections in the perimeter of each object (hereafter referred to as the “deflection bridging algorithm”). The deflection bridging algorithm was implemented on every identified object in the first imaging frame and then only adaptively in subsequent frames. This was accomplished by iteratively tracking cells in each frame, detecting probable merge events (as discussed below) and selectively implementing the deflection bridging algorithm on putative merged objects. Local background subtraction was performed on images of sensors or antibodies that were nuclear in subcellular distribution. For local background subtraction, the nuclear mask was expanded by 25 μm and the background for each cell was calculated as the median pixel intensity of local nonmasked pixels. For cytoplasmically localized sensors or antibodies, the nuclear mask was dilated by 50 μm, and the global background was calculated as the mode intensity of all nonmasked pixels. As before, CDK2 activity was calculated as the ratio of cytoplasmic to nuclear mean DHB fluorescence, with the cytoplasmic component calculated as the mean of the top 50th percentile of a ring of pixels outside of the nuclear mask. Tracking of cells between frames was implemented by screening the nearest future neighbor for consistency in total H2B-mTurquoise fluorescence (“conservation of mass”).

Because the stage jittered slightly after fixation and IF in the time-lapse + IF dataset, we implemented the following jitter correction procedure to ensure precise matching of the CDK2 activity trace of each cell to its IF intensity: We first subtracted the image at a specific time from the image in the next frame to get a “difference score” between 2 images. We then repeated the process, with 1 image moving in a 2-dimensional manner, to get multiple “difference scores” when the stage jittered. The position with the lowest score indicated the amount of jittering and the images were aligned accordingly.

“Conservation of mass” was further exploited to detect merges or splits, which allowed recovery of overlapping traces. Mitosis events (called at anaphase) were called when the total H2B fluorescence of the 2 nearest future neighbors of a given cell were both between 45% and 55% of the total H2B fluorescence of the past cell. The R-point was defined as the time CDK2 activity first began to rise. Computationally, this involves calculating slopes of CDK2 activity using windows of 6–10 time points and then maximizing a linear function for time-since-mitosis, CDK2 activity, and CDK2 slope (long times-since-mitosis, low CDK2 activity, and high CDK2 slope).

The tracking code is available for download here: https://github.com/scappell/Cell_tracking.

Definition of populations

Traces were computationally classified, and manually verified, as CDK2^inc (blue), CDK2^low (red), or CDK2^emerge (green) based on CDK2 activity at 2 hours after mitosis: CDK2^inc traces must remain ≥ 0.5 for all frames post-anaphase; CDK2^low traces must remain < 0.5 for all frames post-anaphase; CDK2^emerge traces initially enter the CDK2^low state and then emerge—these traces must remain < 0.5 for at least 3 hours post-anaphase before rising.