Foxp1 is differentially expressed in rTreg and aTreg cells

Previously, we have shown that Foxp1 has no effect on the generation of Treg cells in the thymus of Foxp1^f/fCD4^Cre mice [30], in which Foxp1 is deleted at the double-positive (DP) thymocyte stage. Nevertheless, in Foxp1^f/fCD4^Cre mice, Foxp1 deletion affects the activation and homeostasis of conventional CD4⁺ T cells [30], and it is not clear how this may obscure the impact of Foxp1 on Treg cells. To better define the role of Foxp1 in Treg cells, we crossed mice bearing loxP-flanked Foxp1 alleles (Foxp1^f/f) [30,31] with Foxp3-YFP-Cre knock-in mice (Foxp3^Cre) [34] to deplete Foxp1 specifically in Treg cells (Foxp1^f/fFoxp3^Cre).

To understand Foxp1 functions in Treg cells, we first examined the Foxp1 expression in wild-type (WT) and Foxp1^f/fFoxp3^Cre Treg cells. Given that Foxp1 is differentially expressed in conventional naive CD4⁺ T cells and activated CD4⁺ T cells [32], we reason that Foxp1 may also have different expression patterns in CD44^lowCD62L^high rTreg and CD44^highCD62L^low aTreg (S1 Fig). We found that rTreg cells expressed high levels of the full-length Foxp1 isoform, Foxp1A, and low levels of the short isoform Foxp1D (Fig 1A), which resembles the Foxp1 expression in conventional naive CD4⁺ T cells, suggesting that Foxp1 may also play an important role in maintaining the quiescent state of rTreg cells, like its role in naive CD4⁺ T cells [31]. Surprisingly, however, we found that compared with rTreg cells, aTreg cells had lower Foxp1A expression at both the mRNA level and the protein level (Fig 1A–1C). This is quite different from the Foxp1 expression pattern in activated conventional CD4⁺ T cells, in which Foxp1A is expressed at a high level constitutively, and Foxp1D is greatly induced [32]. And as expected, Foxp1 was completely deleted in Treg cells from Foxp1^f/fFoxp3^Cre mice (Fig 1A–1C). We further examined Foxp1 expression in Treg cells across various tissues, including lung, liver, and small intestine, in WT mice. Studies have shown a high proportion of aTreg cells in the small intestine [3], and, consistently, we found that among all the tissues examined, the Foxp1 expression levels were the lowest in Treg cells in the small intestine (S2 Fig). These results together suggest that the amount of Foxp1 protein may be important for Treg cell differentiation or function.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Foxp1 is differentially expressed in rTreg and aTreg cells.

(A) Immunoblot analysis of Foxp1 expression in sorted YFP⁻CD4⁺CD44^lowCD62L^high naive CD4⁺ T cells (WT naive), YFP⁺CD4⁺CD44^lowCD62L^high rTreg cells (WT rTreg), YFP⁺CD4⁺CD44^highCD62L^low aTreg cells (WT aTreg) from Foxp3^Cre mice, and YFP⁺ Treg cells from Foxp1^f/fFoxp3^Cre mice. (B) Relative Foxp1 mRNA expression in sorted WT naive CD4⁺ T cells, rTreg cells, aTreg cells from Foxp3^Cre mice, and YFP⁺ Treg cells from Foxp1^f/fFoxp3^Cre mice, n = 3–4. (C) Intracellular staining of Foxp1 in splenic WT naive CD4⁺ T cells, rTreg cells, aTreg cells in Foxp3^Cre mice and splenic Treg cells in Foxp1^f/fFoxp3^Cre mice (left panel), and the corresponding mean fluorescence intensity (MFI) of Foxp1 (right panel) (n = 2). Data in (A, C) represent at least two independent experiments. Data in (B) represent four independent experiments. Data in (B, C: right panel) are mean ± SEM. *P < 0.05 (two-tailed Student t test). Data associated with this figure can be found in the supplemental data file (S1 Data). aTreg, activated Treg; CD, cluster of differentiation; Foxp1, forkhead box P1; Foxp1A, Foxp1 isoform A; Foxp1D, Foxp1 isoform D; MFI, mean fluorescence intensity; rTreg, resting Treg; WT, wild-type; YFP, yellow fluorescent protein.

https://doi.org/10.1371/journal.pbio.3000270.g001

Foxp1 enforces the quiescent state of Treg cells and inhibits aTreg cell differentiation

To address whether Foxp1 is important for Treg cell homeostasis, we first analyzed the frequencies and cell numbers of Treg cells in the thymuses and the peripheral lymphoid and nonlymphoid organs in Foxp1^f/fFoxp3^Cre mice and control Foxp3^Cre mice. We found that the frequencies of Treg cells in CD4⁺ T cells in a majority of the organs examined were very similar between Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice, except those in the spleen, the liver, and the lung, which were higher in Foxp1^f/fFoxp3^Cre mice (Fig 2A and 2B). We found that the numbers of Treg cells in the spleens and the lymph nodes, but not the thymuses, of the Foxp1^f/fFoxp3^Cre mice were significantly increased (Fig 2C), suggesting that Foxp1 deficiency has no effect on the generation or maintenance of Treg cells in the thymus, but it impairs the Treg cell homeostasis in the periphery.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Foxp1 enforces the quiescent state of Treg cells and inhibits aTreg cell differentiation.

(A) Flow cytometry analysis of YFP⁺ Treg cells in CD4⁺ T cells in indicated organs from 6–8-week-old sex- and age-matched Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice. Numbers adjacent to the outlined areas indicate the percentages of YFP⁺ Treg cells. (B) The frequencies of YFP⁺ Treg cells in CD4⁺ T cells in indicated organs from mice as in (A) (n = 3–7). (C) Quantification of total Treg cells in the thymuses, the spleens, and the lymph nodes from the mice as in (A) (n = 3–6). (D) Flow cytometry analysis of CD44 and CD62L expression in Treg cells from 6–8-week-old sex- and age-matched Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice; numbers adjacent to the outlined areas indicate the percentages of rTreg cells (CD44^lowCD62L^high) or aTreg cells (CD44^highCD62L^low). (E) Kinetics of frequencies and numbers of rTreg and aTreg cells in Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice at different ages (n = 3–6). (F) Flow cytometry analysis of Ki-67 expression in rTreg and aTreg cells in the spleens from 8-week-old Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice; numbers above bracketed lines indicate percentages of Ki-67⁺ Treg cells. (G) Proliferation of rTreg cells stimulated by different concentrations of plate-bound anti-CD3/CD28 antibodies in the presence of 200 U/mL IL-2 for 3 days, as shown by the dilution of CellTrace; numbers above bracketed lines indicate percentages of Treg cells with two or more divisions. Data in (A-E) are representative of at least three independent experiments. Data in (F-G) are representative of two independent experiments. Data in (B, C, E) are mean ± SEM, *P < 0.05, ** P < 0.01, *** P < 0.001 (two-tailed Student t test). Data associated with this figure can be found in the supplemental data file (S1 Data). aTreg, activated Treg; CD, cluster of differentiation; Foxp1, forkhead box P1; FSC-H, forward scatter-height; IL, interleukin; Ki-67, antigen identified by monoclonal antibody Ki 67; rTreg, resting Treg; SI, small intestine; Treg, regulatory T; YFP, yellow fluorescent protein.

https://doi.org/10.1371/journal.pbio.3000270.g002

Because Foxp1 is a key transcription factor that actively maintains conventional naive T-cell quiescence [31], we reasoned that Foxp1 might play important roles in maintaining rTreg cell quiescence and restricting aTreg cell differentiation. To address this question, we examined the frequencies and cell numbers of CD44^lowCD62L^high rTreg and CD44^high CD62L^low aTreg cells in Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice at different ages. We found that loss of Foxp1 led to significantly decreased percentages and numbers of rTreg cells, but with elevated percentages and numbers of aTreg cells in both the spleens and the lymph nodes of Foxp1^f/fFoxp3^Cre mice (Fig 2D and 2E). Such changes were observed in Foxp1^f/fFoxp3^Cre mice as early as when they were 3 weeks old (Fig 2E). When the mice were older than 16 weeks, Foxp1^f/fFoxp3^Cre mice almost lost the rTreg cell population and compensatorily had many more aTreg cells (Fig 2E).

One of the pronounced characteristics of nonquiescent T cells is their enhanced proliferation capacity. To further determine whether Foxp1-deficient Treg cells lose quiescence, we examined the cell proliferation of these cells. The antigen identified by monoclonal antibody Ki 67 (Ki-67) protein is a cellular marker strictly associated with cell proliferation [35]. We found that in 3-week-old (S3A Fig) and 8-week-old mice (Fig 2F), the percentages of Ki-67⁺ cells in both rTreg and aTreg cells from Foxp1^f/fFoxp3^Cre mice were increased compared with their WT counterparts, suggesting that Foxp1-deficient rTreg and aTreg cells proliferated more in vivo. We also sorted out CD44^lowCD62L^high rTreg cells and CD44^highCD62L^low aTreg cells from Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice and labeled them with CellTrace, which tracks cell proliferation. We found that upon stimulation by different concentrations of anti-CD3/CD28 antibodies in vitro, Foxp1-deficient rTreg cells proliferated more than WT rTreg cells did (Fig 2G), although we did not observe obvious differences in cell proliferation between WT and Foxp1-deficient aTreg cells (S3B Fig). Of note, the apoptosis of rTreg and aTreg cells in Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice showed no difference (S3C Fig), suggesting that the higher numbers of Treg cells in Foxp1^f/fFoxp3^Cre mice result from the increased Treg cell proliferation. Taken together, our results suggest that Foxp1 plays a critical role in maintaining the rTreg cell pool and negatively regulates aTreg cell differentiation.

Foxp1 regulates rTreg cell quiescence in a cell-intrinsic manner

To address whether Foxp1 regulates rTreg cell quiescence in an intrinsic manner, we took advantage of Foxp1^f/fFoxp3^Cre/+ female mice, theoretically, in which around half of the Treg cells are Foxp1 sufficient, while the other half of the Treg cells are Foxp1 deficient due to the random X chromosome inactivation. Consistent with the results in Foxp1^f/fFoxp3^Cre male mice, we found that the percentage of Ki-67⁺ Treg cells in Foxp1^f/fFoxp3^Cre/+ female mice was also higher than that in control Foxp3^Cre/+ female mice (Fig 3A), indicating that Foxp1 intrinsically regulates Treg cell proliferation. However, in Foxp1^f/fFoxp3^Cre/+ females, we found that Foxp1-deficient Treg cells had compromised competitive fitness in the spleens or the lymph nodes (Fig 3B), with aTreg cells being almost outcompeted by WT Treg cells (Fig 3C). Therefore, Foxp1^f/fFoxp3^Cre/+ female mice are not suitable to address whether Foxp1 intrinsically controls the balance between rTreg and aTreg. To resolve this issue, we used Foxp1^f/fCre-ERT2⁺ mice, in which Treg cells have normal development and function before tamoxifen treatment. We treated mice with tamoxifen and analyzed the phenotype at day (d)8. At this time point, the conventional T cells in Foxp1^f/fCre-ERT2⁺ mice had no obvious phenotypic alteration based on the expression of CD44 and CD62L (Fig 3D). However, there were more aTreg cells within the Treg cell population in Foxp1^f/fCre-ERT2⁺ mice (Fig 3E). And consistently, acute deletion of Foxp1 led to increased Ki-67⁺ Treg cells in Foxp1^f/fCre-ERT2⁺ mice (Fig 3F). Taken together, our data suggest that Foxp1 enforces the quiescent state of Treg cells in a cell-intrinsic manner.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Foxp1 regulates rTreg cell quiescence in a cell-intrinsic manner.

(A) Flow cytometry analysis of Ki-67 expression in Foxp3⁺YFP⁺ rTreg and aTreg cells in the spleens from Foxp3^Cre/+ and Foxp1^f/fFoxp3^Cre/+ female mice; numbers above bracketed lines indicate the percentages of Ki-67⁺ Treg cells. (B) Flow cytometry analysis of Foxp3⁺YFP⁺ Treg cells from spleens and lymph nodes of Foxp3^Cre/+ and Foxp1^f/fFoxp3^Cre/+ female mice (left panel), and frequencies of Foxp3⁺YFP⁺ Treg cells (right panel) (n = 5). (C) Frequencies of Foxp3⁺YFP⁺ aTreg cells in CD4⁺ T cells, n = 5. (D-F) Foxp1^f/f and Foxp1^f/fCre-ERT2⁺ mice were treated with tamoxifen, and phenotypes were analyzed at d8 after treatment. (D) Flow cytometry analysis of CD44 and CD62L expression in CD4⁺Foxp3⁻ conventional T cells from Foxp1^f/f and Foxp1^f/fCre-ERT2⁺ mice; numbers adjacent to the outlined areas indicate the percentages of naive cells (CD44^lowCD62L^high) or activated cells (CD44^highCD62L^low). (E) Flow cytometry analysis of CD44 and CD62L expression in Treg cells from Foxp1^f/f and Foxp1^f/fCre-ERT2⁺ mice; numbers adjacent to the outlined areas indicate the percentages of rTreg cells (CD44^lowCD62L^high) or aTreg cells (CD44^highCD62L^low). (F) Flow cytometry analysis of Ki-67 expression in rTreg and aTreg cells from Foxp1^f/f and Foxp1^f/fCre-ERT2⁺ mice. Numbers above bracketed lines indicate percentages of Ki-67⁺ Treg cells. Data in (A-F) are representative of at least two independent experiments. Data in (B: right panel, C) are mean ± SEM, *P < 0.05 (two-tailed Student t test). Data associated with this figure can be found in the supplemental data file (S1 Data). aTreg, activated Treg; CD, cluster of differentiation; d, day; Foxp1, forkhead box P1; Ki-67, antigen identified by monoclonal antibody Ki 67; ns, no significance; rTreg, resting Treg; Treg, regulatory T; YFP, yellow fluorescent protein.

https://doi.org/10.1371/journal.pbio.3000270.g003

Foxp1 controls Treg suppressive function

We next asked whether Foxp1 plays any role in Treg suppressive function. We first performed phenotype analysis in both 6–8-week-old and >6-month-old mice. Compared with control Foxp3^Cre mice, we found that Foxp1^f/fFoxp3^Cre mice had splenomegaly and lymphadenopathy at 8 weeks of age (S4A Fig). Flow cytometry analysis showed that the conventional T cells in 8-week-old Foxp1^f/fFoxp3^Cre mice exhibited the memory/effector phenotype (CD44^highCD62L^high and CD44^highCD62L^low) (S4B Fig), with increased percentages of interferon gamma (IFNγ)-producing T cells in the spleens and nonlymphoid organs (S4C Fig). Foxp1^f/fFoxp3^Cre mice older than 6 months had even higher percentages of CD44^highCD62L^low activated T cells, and more IFNγ or IL-4–producing T cells (Fig 4A and 4B and S4D Fig). And strikingly, those older Foxp1^f/fFoxp3^Cre mice developed a multi-organ inflammatory disease (Fig 4C), strongly suggesting that Foxp1 plays an important role in maintaining the suppressive function of Treg cells under the homeostatic condition.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Foxp1 regulates Treg suppressive function.

(A) Flow cytometry analysis of CD44 and CD62L expression in conventional CD4⁺ T cells (YFP⁻CD4⁺) and CD8⁺ T cells in the spleens of 28-week-old Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice; numbers adjacent to the outlined areas represent the percentages of gated cells. (B) Intracellular staining of cytokines in conventional CD4⁺ and CD8⁺ T cells in the spleens of 28-week-old Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice; numbers adjacent to the outlined areas represent the percentages of gated cells. (C) Hematoxylin and eosin staining of salivary gland, pancreas, lung, small intestine, and colon sections. The magnification is ×100. Black arrows indicate the areas of immune cell infiltration. Scale bars, 100 μm. (D-G) Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice (n = 6) were treated with 2.5% DSS, and the severity of colitis in mice was evaluated by loss of body weight (D), survival curve at indicated time points (E), the representative hematoxylin and eosin staining of colon sections (×40 and ×200, respectively; scale bars, 200 μm and 50 μm, respectively) (F), and the intracellular staining of cytokines in CD4⁺ T cells in the spleens and the colons (G). (H-K) Sex- and age-matched Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice (n = 9–10) were induced with EAE by immunization with MOG peptide and pertussis toxin, and the severity of EAE was evaluated by the clinical score (H), loss of body weight (I), Luxol fast blue-hematoxylin and eosin staining of spinal cord sections (×40, scale bars, 200 μm) (J), and the intracellular staining of cytokines in T cells from the spinal cords and the brains (K). Data in (A-C, H-K) represent at least three independent experiments. Data in (D-G) represent two independent experiments. Data in (D, H, I) are mean ± SEM, *P < 0.05 (two-tailed Student t test). Data associated with this figure can be found in the supplemental data file (S1 Data). CD, cluster of differentiation; DSS, dextran sulfate sodium; EAE, experimental autoimmune encephalomyelitis; Foxp1, forkhead box P1; IFNγ, interferon gamma; IL, interleukin; MOG, myelin oligodendrocyte glycoprotein; Treg, regulatory T; YFP, yellow fluorescent protein.

https://doi.org/10.1371/journal.pbio.3000270.g004

Treg cells exert an important function in suppressing various inflammatory responses [9]. Thus, we further addressed whether Foxp1 is indispensable for the restriction of inflammatory responses by Treg cells. In the DSS-induced colitis model, we found that with DSS treatment, WT mice survived well and had no weight loss; but in stark contrast, Foxp1^f/fFoxp3^Cre mice began to lose weight at d5 post DSS treatment and started to die at d8, with the mortality rate up to 80% at d11 (Fig 4D and 4E). Consistent with the severe weight loss and low survival rate, we found that the colons of Foxp1^f/fFoxp3^Cre mice treated with DSS exhibited more immune cell infiltration than those from WT mice (Fig 4F). We also found that, compared with those from WT mice, the conventional T cells in the spleens and the colons from Foxp1^f/fFoxp3^Cre mice had higher percentages of inflammatory cytokines IFNγ- and IL-17A–producing cells (Fig 4G). To further confirm these results, we took advantage of the EAE disease model, in which MOG peptide immunization with pertussis toxin (PT) elicits strong T_H1 and T_H17 inflammatory responses in vivo [36]. We found that Foxp1^f/fFoxp3^Cre mice had obviously higher clinical scores and more body weight loss than did WT mice during the development of EAE disease (Fig 4H and 4I). In line with more severe EAE symptoms in Foxp1^f/fFoxp3^Cre mice, we observed more demyelination, indicated by the loss of Luxol fast blue staining in spinal cords (Fig 4J), more lymphocytes infiltration (S4E and S4F Fig), and more IFNγ- or IL-17A–producing T cells in the brains and the spinal cords of Foxp1^f/fFoxp3^Cre mice (Fig 4K), suggesting that Foxp1-deficient Treg cells have impaired functions in suppressing inflammation in the EAE model. Thus, by using two different inflammatory models, we have demonstrated that Foxp1 is crucial for Treg suppressive function during anti-inflammatory responses.

Foxp1 regulates iTreg cell differentiation and maintenance

Studies have shown that Foxp3⁺ Treg cells can also be induced from CD4⁺CD25⁻ naive T cells in the periphery or in vitro, which are named pTreg and iTreg cells, respectively [37]. As we have demonstrated that Foxp1 is important for the homeostasis and the suppressive function of tTreg cells (Fig 2 and Fig 4), we went further to ask whether Foxp1 plays any role in the differentiation and function of pTreg and iTreg cells. To circumvent the abnormal development of naive CD4⁺ T cells caused by Foxp1 deletion before T cell maturation, we used the inducible Foxp1 conditional knockout mouse line, the Foxp1^f/fCre-ERT2⁺Rosa26^YFP mouse [31]. We treated the Foxp1^f/fCre-ERT2⁺Rosa26^YFP mice with tamoxifen, isolated naive CD4⁺ T cells, and cultured the CD4⁺ T cells under iTreg condition with different concentrations of IL-2. We found that the loss of Foxp1 led to dramatically reduced generation of CD25^highFoxp3⁺ iTreg cells under all the IL-2 culture conditions (Fig 5A), suggesting impaired iTreg differentiation in the absence of Foxp1.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Foxp1 regulates iTreg cell differentiation and maintenance.

(A) Foxp1^f/fRosa26^YFP and Foxp1^f/fCre-ERT2⁺Rosa26^YFP mice were treated with tamoxifen for 6 days, and CD4⁺ T cells were isolated and cultured in the plate coated with 1 μg/mL anti-CD3/CD28 antibodies in the presence of 0.3 μM 4-hydroxytamoxifen, 5 ng/mL TGF-β, and various concentrations of recombinant human IL-2 for 2 days. Cells were detached and cultured for an additional day. Foxp3 and CD25 expression were analyzed by flow cytometry; numbers adjacent to the outlined areas represent the percentages of gated cells. (B-D) Sorted YFP⁺ Foxp1^f/fFoxp3^Cre or Foxp3^Cre iTreg cells differentiated in vitro were cotransferred with sorted CD44^lowCD62L^highCD25⁻ WT naive CD4⁺ T cells into Rag1^−/− mice (n = 3). Mice were analyzed at 6 weeks post T-cell transfer. (B) Flow cytometry analysis of Foxp3⁺YFP⁺ Treg cells in the spleens and the colons of the recipient mice (left panel) and quantification of YFP⁺ Treg cell frequencies (right panel); the numbers adjacent to the outlined area indicate percentage of YFP⁺ Treg cells. (C) The severity of colitis was evaluated by loss of body weight of the recipient mice and (D) intracellular staining of cytokines in T cells from the colons; the numbers adjacent to the outlined area indicates percentage of gated cells. Data represent at least two independent experiments. Data in (B: right panel, C) are mean ± SEM, *P < 0.05 (two-tailed Student t test). Data associated with this figure can be found in the supplemental data file (S1 Data). CD, cluster of differentiation; Foxp1, forkhead box P1; Foxp3, forkhead box P3; IFNγ, interferon gamma; IL, interleukin; iTreg, induced Treg cells; Rag1, recombination activating 1; TGF-β, transforming growth factor, beta; Treg, regulatory T; WT, wild-type; YFP, yellow fluorescent protein.

https://doi.org/10.1371/journal.pbio.3000270.g005

To elucidate the function and maintenance of iTreg cells in vivo, we cotransferred the iTreg cells differentiated in vitro with naive CD4⁺ T cells from the WT mice into the Rag1^−/− recipient mice. Six weeks after cells transfer, we found that the frequency of Foxp1-deficient iTreg cells was significantly lower than that of WT iTreg cells in the spleens and the colons in the recipient mice (Fig 5B), suggesting that the maintenance of Foxp1-deficient iTreg cells in vivo is impaired. Consistently, we found that the recipient mice transferred with Foxp1-deficient iTreg cells developed more severe colitis, indicated by the greater body weight loss (Fig 5C) and more IFNγ- or IL-17A–producing T cells in the colons (Fig 5D). Taken together, our data demonstrated that Foxp1 is important for both iTreg generation and maintenance.

Foxp1 helps maintain Treg suppressive function through controlling stable Foxp3 expression

To understand the mechanism by which Foxp1 regulates Treg suppressive function, we first examined the expression levels of Foxp3 in Treg cells. We found that the expression of Foxp3 was reduced in Foxp1-deficient rTreg cells at both the mRNA level (Fig 6A) and the protein level (Fig 6B and 6C), consistent with an earlier observation that the Foxp1-deficient rTreg cells expressed lower levels of YFP, the indicator of Foxp3 expression in mice with a Foxp3^YFP-Cre allele (S5A Fig). These results suggest that Foxp1 likely regulates Foxp3 expression in Treg cells at the transcriptional level. Unexpectedly, we found that there was no obvious difference in Foxp3 mRNA and protein levels between WT and Foxp1-deficient aTreg cells (Fig 6A–6C), suggesting that somehow the defective Foxp3 expression in the absence of Foxp1 is compensated in the steady-state aTreg cells with a yet unknown mechanism.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Foxp1 helps maintain Treg cell suppressive function through controlling stable Foxp3 expression.

(A) Relative Foxp3 mRNA levels in highly purified rTreg (n = 4) and aTreg cells (n = 6) from Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice. (B) Immunoblot analysis of Foxp3 in rTreg and aTreg cells from Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice. (C) Flow cytometry analysis of the expression of Foxp3 in rTreg and aTreg cells from the spleens of Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice (left panel), and the corresponding mean fluorescence intensity (MFI) of Foxp3 (right panel) (n = 4). (D) Foxp1 ChIP was performed in Foxp3^Cre and Foxp1^f/fFoxp3^Cre iTreg cells to detect the Foxp1 binding to Foxp3 CNS0, CNS2, and promoter regions; a region in the Gmpr locus was used as a negative control, n = 3–4. (E, F) Sorted rTreg and aTreg cells from Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice were labeled with CellTrace and cultured in the plate coated with 1 μg/mL anti-CD3 and -CD28 antibodies in the presence of 200 U/mL IL-2 for 3 days. (E) Foxp3 expression during Treg cell division in rTreg and aTreg cells. The numbers below the red line represent the percentages of Foxp3^low Treg cells. (F) Foxp3 expression in rTreg and aTreg cells during Treg cell division; numbers adjacent to the histograms represent Foxp3⁺ Treg frequencies. (G) Foxp3 expression in Foxp3^Cre and Foxp1^f/fFoxp3^Cre rTreg and aTreg cells cultured with plate-bound anti-CD3/CD28 antibodies in the presence or absence of IL-4 for 3 days. (H-I) EAE was induced in Foxp1^f/fFoxp3^Cre mice by immunization with MOG peptide and pertussis toxin (n = 3–8), followed by transfer of sorted Foxp3^Cre and Foxp1^f/fFoxp3^Cre Treg cells infected with control retroviruses (RV-ctrl) or retroviruses expressing Foxp3 (RV-Foxp3) at d4. The severity of EAE was evaluated by the clinical score (H) and intracellular staining of cytokines in the T cells from the spinal cords and the brains (I); the Foxp1^f/fFoxp3^Cre mice without Treg cell transfer were controls. The numbers adjacent to the outlined area indicate the percentage of gated cells. Data in (A-I) represent at least three independent experiments. Data in (A, C: right panel, D, H) are mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001 (two-tailed Student t test). Data associated with this figure can be found in the supplemental data file (S1 Data). aTreg, activated Treg; CD, cluster of differentiation; ChIP, chromatin immunoprecipitation; CNS0, conserved noncoding sequence 0; CNS2, conserved noncoding sequence 2; d, day; EAE, experimental autoimmune encephalomyelitis; Foxp1, forkhead box P1; Foxp3, forkhead box P3; Gmpr, guanosine monophosphate reductase; IL, interleukin; iTreg, induced Treg cells; max, maximum; MFI, mean fluorescence intensity; MOG, myelin oligodendrocyte glycoprotein; rTreg, resting Treg; RV-ctrl, control retrovirus; RV-Foxp3, retrovirus expressing Foxp3; TCR, T-cell receptor; Treg, regulatory T.

https://doi.org/10.1371/journal.pbio.3000270.g006

To determine whether Foxp1 may directly regulate Foxp3 expression in rTreg cells, we analyzed the CNSs of the Foxp3 locus by bioinformatics. And the conserved forkhead-binding sites were found in the promoter, CNS2, and CNS0 regions of the Foxp3 locus, respectively (S5B Fig). Using the chromatin immunoprecipitation (ChIP) approach, we found that Foxp1 bound to these three regions of the Foxp3 locus (Fig 6D), suggesting that Foxp3 is a direct target of Foxp1.

It has been reported that CNS2 is required for the maintenance of heritable Foxp3 expression, and it protects Treg lineage identity in inflammatory cytokine environments [15,16]. Because Foxp1 bound to the promoter region and the CNS2 region of Foxp3, we reasoned that Foxp1 might be critical for stable Foxp3 expression, and thereby for Treg stability. Indeed, we found that during cell division upon T-cell receptor (TCR) stimulation, Foxp3 expression was greatly compromised in the Foxp1-deficient rTreg (Fig 6E and 6F). Surprisingly, although the Foxp3 levels were normal in Foxp1-deficient aTreg cells in the steady state (Fig 6B and 6C), upon TCR stimulation, the heritable Foxp3 expression was not sustained in Foxp1-deficient aTreg cells (Fig 6E and 6F). CNS2 has been shown to help maintain Foxp3 expression under a T_H2 and T_H17 cytokine environment [15,16]. We found that the addition of IL-4 to TCR-stimulated Treg cells greatly down-regulated Foxp3 in both Foxp1-deficient rTreg cells and aTreg cells, but not in WT Treg cells (Fig 6G). Similarly, we observed the unstable Foxp3 expression in Foxp1-deficient iTreg cells upon TCR stimulation (S5C Fig). Taken together, these results suggest that Foxp1, through its binding to the CNS2 and the promoter regions of the Foxp3 locus, plays a vital role in stabilizing the Foxp3 expression.

Studies have shown that unstable Foxp3 expression affects Treg cell functions [15,16]. We reasoned that the unstable Foxp3 expression in the absence of Foxp1 would contribute to the defective suppressive function of Foxp1-deficient Treg cells. To test this, we constructed a Foxp3 retroviral expression vector (RV-Foxp3) that restored the Foxp3 expression levels in Foxp1-deficient Treg cells to the levels of WT Treg cells (S5D Fig). In the EAE model, we found that Foxp1^f/fFoxp3^Cre mice, which were transferred with Foxp1-deficient Treg cells overexpressing Foxp3, had significantly remitted symptoms from d15 post EAE induction (Fig 6H). Consistently, these mice had fewer IL-17A– and IFNγ-producing T cells in the spinal cords and the brains than Foxp1^f/fFoxp3^Cre mice transferred with control Foxp1-deficient Treg cells (Fig 6I). All these results suggest that Foxp1-mediated regulation of Foxp3 expression is important for Treg suppressive function.

Foxp1-dependent transcriptional programs in Treg cells

To further gain insight into the mechanism by which Foxp1 regulates Treg cell homeostasis and function, we analyzed the global gene expression profiles of rTreg and aTreg cells from Foxp1^f/fFoxp3^Cre and control Foxp3^Cre (WT) mice by RNA sequencing (RNA-Seq). We identified 444 and 400 genes up-regulated or down-regulated, respectively, by more than 1.5-fold in Foxp1-deficient rTreg cells compared with WT rTreg cells, and 218 and 134 genes up-regulated or down-regulated, respectively, by more than 1.5-fold in Foxp1-deficient aTreg cells compared with WT aTreg cells (S1 and S2 Tables, Fig 7A and S6A Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Foxp1-dependent transcriptional programs in Treg cells.

(A) Heatmap of the representative genes differentially expressed between highly purified Foxp3^Cre and Foxp1^f/fFoxp3^Cre rTreg cells (fold change ≥1.5). (B) Enriched GO categories of the genes differentially expressed between Foxp3^Cre and Foxp1^f/fFoxp3^Cre rTreg cells (Benjamin <0.05). (C) Enrichment of gene signatures related to cell cycle and oxidative phosphorylation in Foxp3^Cre versus Foxp1^f/fFoxp3^Cre rTreg cells through gene set enrichment analysis (GSEA). Representative enriched gene sets are shown (FDR q value <0.05). (D) Enrichment of gene signatures related to Treg signature gene cluster 6, TGF-β signaling pathway, and Foxo signaling pathway in Foxp3^Cre versus Foxp1^f/fFoxp3^Cre rTreg cells through GSEA. Representative enriched gene sets are shown (FDR q value <0.05). Two rounds of RNA sequencing were performed. Data associated with this figure can be found in the supplemental data file (S1 Data). FDR, false discovery rate; Foxo, forkhead box O; Foxp1, forkhead box P1; Foxp3, forkhead box P3; GO, Gene Ontology; GSEA, gene set enrichment analysis; rTreg, resting Treg; TGF-β, transforming growth factor, beta; Treg, regulatory T.

https://doi.org/10.1371/journal.pbio.3000270.g007

In WT aTreg cells, there was a set of up-regulated genes compared with WT rTreg cells (2-fold as threshold). We defined these genes as the putative aTreg cell signature genes. Strikingly, we found that 137 up-regulated genes (31% of total up-regulated genes) in Foxp1-deficient rTreg cells were the aTreg cell signature genes, accounting for approximately 11% of the aTreg signature genes (S6B and S3 Table), suggesting that Foxp1 is a key transcription factor that normally restrains the differentiation of aTreg cells from rTreg cells.

The differentially expressed genes between WT and Foxp1-deficient rTreg cells were analyzed and found to be clustered into different groups that include cell cycle–regulating genes, transcription factors, genes involved in signaling transduction, and metabolism-related genes (Fig 7A), suggesting that Foxp1 regulates many cellular programs in Treg cells. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis showed that the up-regulated genes in Foxp1-deficient rTreg cells were greatly enriched in the cell cycle–related pathway (Fig 7B). The gene set enrichment analysis (GSEA) showed similar results, that the up-regulated genes in Foxp1-deficient rTreg cells were significantly enriched in cell cycle and oxidative phosphorylation pathways (Fig 7C), suggesting that Foxp1 enforces Treg cell quiescence through regulating cell cycle–and metabolism-related pathways in Treg cells, which is quite similar to our observation in Foxp1-deficient CD8⁺ T cells [38]. To gain more insights into the mechanism by which Foxp1 regulates Treg cell quiescence, we checked the expression of E2 promoter binding factor (E2f) family genes and phosphoinositide-3-kinase interacting protein 1 (Pik3ip1), which have been shown to regulate CD8⁺ T-cell quiescence [38]. We found that Foxp1 deletion in rTreg cells led to significantly increased expression levels of E2f1 and its target, cyclin-dependent kinase 1 (Cdk1), but decreased expression levels of Pik3ip1. However, we did not observe obvious changes in the expression levels of E2f2 and E2f3 (S6C Fig). These results suggest that Foxp1 enforces Treg cell quiescence by a similar mechanism involved in regulating CD8⁺ T-cell quiescence.

In contrast to the up-regulated genes associated with Treg cell activation, the down-regulated genes in Foxp1-deficient rTreg cells were greatly enriched in the Treg signature gene cluster 6 [39], the transforming growth factor, beta (TGF-β) signaling pathway, and the Foxo signaling pathway (Fig 7D), which are important for Treg identity and function. The Treg signature gene cluster 6 has been shown to contain the signature genes not affected by Foxp3, TGF-β signaling, or TCR activation [39]. Interestingly, our data showed that many genes in this cluster may be regulated by Foxp1 (Fig 7D). As TGF-β signaling is important for iTreg differentiation, one of the reasons for the impaired iTreg development of Foxp1-deficient T cells could be the down-regulation of those genes related to the TGF-β signaling pathway in the absence of Foxp1. Collectively, our results suggest that Foxp1 negatively regulates the expression of genes involved in Treg cell activation, and at the same time promotes the expression of a set of genes important for Treg cell identity and function.

Foxp1 and Foxp3 coordinate the regulation of CTLA-4 expression in Treg cells

It has been reported that Foxp subfamily proteins can form homodimers and heterodimers [33,40]. We confirmed the interaction between Foxp1 and Foxp3 in iTreg cells by immunoprecipitation (S7A Fig). We reasoned that Foxp1 and Foxp3 might co-regulate some important genes in Treg cells. Studies of Foxp3 ChIP have revealed many Foxp3 target genes in murine Treg cells [41]. By cross-examining the Foxp3 ChIP data set with our RNA-seq data set, we found that about 5% of up- or down-regulated genes in Foxp1-deficient rTreg cells (41 of 844 differential genes) were Foxp3-bound genes, accounting for about 8% of Foxp3 targets (Fig 8A and S4 Table). These results suggest that Foxp3 and Foxp1 function largely independently in Treg cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. Foxp1 and Foxp3 coordinate the regulation of CTLA-4 expression in Treg cells.

(A) Heatmap of the representative common target genes of Foxp1 and Foxp3 in rTreg cells. (B) The relative mRNA levels of CTLA-4 in purified rTreg and aTreg cells from Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice, n = 4. (C) Flow cytometry analysis of CTLA-4 expression in splenic rTreg and aTreg cells from Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice. (D) Predicted conserved forkhead-binding site in the Ctla4 promoter (left panel); Foxp1 ChIP analysis was performed in Foxp3^Cre and Foxp1^f/fFoxp3^Cre iTreg cells (right panel) (n = 3); −2.4 kb upstream of TSS at the Ctla4 locus was used as a negative control. (E) Foxp3 ChIP was performed in Foxp3^Cre and Foxp1^f/fFoxp3^Cre iTreg cells to detect Foxp3 binding to the Ctla4 promoter region in the presence or absence of Foxp1, n = 2. A region in the Gmpr locus was used as a negative control. (F) The relative mRNA levels of CTLA-4 in Foxp1^f/fFoxp3^Cre iTreg cells infected with control retroviruses (RV-ctrl), retroviruses expressing Foxp1A (RV-Foxp1A), retroviruses expressing Foxp3 (RV-Foxp3), or retroviruses expressing both RV-Foxp1A and RV-Foxp3 (RV-Foxp1A+Foxp3), n = 3. WT iTreg cells infected with control retroviruses were used as a control. Data in (A, D-F) are representative of at least two independent experiments. Data in (B, C) are representative of at least three independent experiments. Data in (B, D, E, F) are mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001 (two-tailed Student t test). Data associated with this figure can be found in the supplemental data file (S1 Data). aTreg, activated Treg; ChIP, chromatin immunoprecipitation; CTLA-4, cytotoxic T-lymphocyte-associated protein 4; Foxp1, forkhead box P1; Foxp3, forkhead box P3; Gmpr, guanosine monophosphate reductase; iTreg, induced Treg cells; rTreg, resting Treg; Treg, regulatory T; TSS, transcription start site; WT, wild-type.

https://doi.org/10.1371/journal.pbio.3000270.g008

Nevertheless, CTLA-4, which is critical for Treg suppressive function, was one of the down-regulated genes in Foxp1-deficient Treg cells and among the potential genes co-regulated by Foxp1 and Foxp3 (Fig 8A and S1 Table). We recently have shown that Foxp1 directly regulates the expression of CTLA-4 in activated conventional CD4⁺ T cells [42]. Whether CTLA-4 is also a direct target of Foxp1 in Treg cells is not clear. To examine this, we examined the mRNA and protein levels of CTLA-4 in Treg cells. We found that the expression levels of CTLA-4 were decreased in both rTreg and aTreg cells in the absence of Foxp1 (Fig 8B and 8C). Furthermore, Foxp1 ChIP assay in Treg cells showed that Foxp1 bound to the promoter of Ctla4 (Fig 8D), suggesting that CTLA-4 is a direct target of Foxp1 in Treg cells, as well.

It has been reported that Foxp3 can bind to the Ctla4 promoter. Thus, it is intriguing to ask whether Foxp1 works together with Foxp3 to regulate the expression levels of CTLA-4 in Treg cells. We performed Foxp3 ChIP assay in Foxp1-sufficient and -deficient iTreg cells, and found that the loss of Foxp1 significantly reduced the binding of Foxp3 to the Ctla4 promoter region (Fig 8E). Of note, the protein levels of Foxp3 had only a very minor decrease in Foxp1-deficient iTreg cells compared with those of WT iTreg cells (S7A Fig), suggesting that the decreased binding of Foxp3 to Ctla4 promoter was mainly attributed to the absence of Foxp1. Consistently, although retroviral overexpression of Foxp1 or Foxp3 alone partially rescued the CTLA-4 expression in Foxp1-deficient iTreg cells, overexpression of Foxp1 together with Foxp3 completely rescued the expression of CTLA-4 in Foxp1-deficient iTreg cells. (Fig 8F and S7B Fig). Thus, our results demonstrate that Foxp1 and Foxp3 coordinate to regulate the expression levels of CTLA-4.

Ethics statement

All procedures were carried out in accordance with guidelines of the Animal Facility of IPS. The experimental procedures were approved by the Institutional Animal Care and Use Committee of Institut Pasteur of Shanghai, China (A2019014). All efforts were made to minimize suffering.

Mice

Foxp1^f/f, Cre-ERT2⁺, and Rosa^YFP transgenic mice have been previously described [30,31]. Foxp1^f/f were bred with Foxp3-YFP-Cre knock-in mice from Jackson Laboratories to generate Foxp1^f/fFoxp3^Cre mice. Control animals were age-/sex-matched control Foxp3^Cre mice (WT) or Foxp1^f/f mice. Unless otherwise stated, all experiments were performed with mice at 6–8 weeks of age. All mice were maintained under specific pathogen-free conditions at Institute Pasteur of Shanghai, China.

Flow cytometry, cell sorting, and intracellular staining

These procedures were done as described previously [31]. The sorted cell populations were >98% pure. Antibodies used in FACS analysis and cell sorting were as follows: APC-Cy7-anti-CD4 (GK1.5, Thermo Fisher Scientific, Waltham, MA), PE-Cy7-anti-CD4 (GK1.5, Thermo Fisher Scientific), PE-Cy7-anti-CD8 (53–6.7, Thermo Fisher Scientific), PerCP-Cy5.5-anti-CD8 (53–6.7, BioLegend, San Diego, CA), PE-anti-CD44 (IM7, Thermo Fisher Scientific), APC-anti-CD62L (MEL-14, Thermo Fisher Scientific), PE-Cy7-anti-CD25 (PC61.5, Thermo Fisher Scientific), Pacific Blue-anti-Foxp3 (FJK-16s, Thermo Fisher Scientific), APC-anti-Foxp3 (FJK-16s, Thermo Fisher Scientific), PerCP-Cy5.5-anti-interferon-γ (XMG1.2, Thermo Fisher Scientific), Alexa Fluor 700-anti-IL-17A (TC11-18H10, BD Pharmingen), Pacific Blue-anti-Granzyme B (NGZB, Thermo Fisher Scientific), PE-anti-CTLA-4 (UC10-4B9, BioLegend), BV605-anti-CD44 (IM7, BioLegend), and Alexa Fluor 647-goat-anti-rabbit IgG (A-21244, Thermo Fisher Scientific). Dead cells were excluded through live/dead staining by using Live/Dead Fixable Aqua Dead Cell staining kit (Thermo Fisher Scientific).

For intracellular staining of Foxp1, the staining procedures were performed as described previously [32]. For intracellular staining of Foxp3 and CTLA-4, cells were fixed with 3.7% formaldehyde following cell surface staining (antibodies mentioned above) and were permeabilized with 0.2% Triton X-100. Then, cells were stained with Pacific Blue-anti-Foxp3 or PE-anti-CTLA-4 at 4°C for 90 minutes. For APC-anti-Foxp3 staining, we used the Foxp3 staining kit (Thermo Fisher Scientific) and performed it as per the manufacturer’s instructions.

For intracellular staining of cytokines, cells were stimulated for 6 hours with 10 ng/mL PMA (phorbol 12-myristate 13-acetate, Sigma, St. Louis, MO) and 1 μg/mL ionomycin (Sigma). Before staining, cells were treated for 2 hours with 10 μg/mL Brefeldin A (BFA; Sigma). The intracellular staining was done as described [31].

iTreg cell differentiation and transfer

Foxp1^f/fRosa26^YFP and Foxp1^f/f Cre-ERT2⁺Rosa26^YFP mice were treated daily with tamoxifen (Sigma) (2 mg per mouse) for 5 days and rested for 1 day. CD4⁺ T cells were isolated and cultured with 1 μg/mL plate-bound anti-CD3 (BioXcell) and anti-CD28 (BioXcell), 5 ng/mL TGF-β, and indicated recombinant human IL-2 in the presence of 0.3 μM 4-hydroxytamoxifen (Sigma) for 2 days, followed by detaching and culturing in T-cell medium (Dulbecco’s Modified Eagle Medium [DMEM] containing 10% heat-inactivated FCS, 2 mM L-glutamine, penicillin-streptomycin, nonessential amino acids, sodium pyruvate, vitamins, 10 mM HEPES and 50 μM 2-mercaptoethanol) in the presence of 5 ng/mL TGF-β and the indicated recombinant human IL-2.

For iTreg cell transfer, naive (YFP^–CD4⁺CD44^lowCD62L^high) T cells from the spleens and the lymph nodes of Foxp3^Cre and Foxp1^f/fFoxp3^Cre mice were sorted by FACS Aria II device (BD Bioscience, San Jose, CA). Naive T cells were stimulated for 48 hours with plate-bound anti-CD3 (5 μg/mL, 145-2C11, BioXcell) and anti-CD28 (5 μg/mL, 37.51, BioXcell) in complete T-cell medium supplemented with TGF-β (5 ng/mL, R&D Systems, Minneapolis, MN) and IL-2 (200 U/mL, Beijing Four Rings Biopharmaceutical Co., Beijing, China). Then, the cells were detached and cultured in T-cell medium containing 5 ng/mL TGF-β and 200 U/mL recombinant human IL-2 for an additional 3 days. Afterwards, 4 × 10⁵ sorted YFP⁺ iTreg cells were cotransferred with 1 × 10⁶ purified WT naive CD4⁺ T cells (CD4⁺CD44^lowCD62L^highCD25^–) into Rag1^−/− mice to perform the colitis assay.

Quantitative RT-PCR

rTreg and aTreg cells from Foxp3^Cre or Foxp1^f/fFoxp3^Cre mice were sorted out by a FACS Aria II device (BD Bioscience). Then, total RNA was isolated from whole cells using the TRIZOL reagent (Life technologies, Carlsbad, CA) according to the manufacturer’s instructions. Complementary DNA was reverse transcribed using the PrimeScript RT reagent kit (Takara, Tokyo, Japan). Quantitative PCR was performed with SYBR Green mix (Takara) on ABI Prism 7500 sequence detection system (Applied Biosystems). Relative mRNA expression of genes was normalized to GAPDH. The primers are listed as follows: Foxp1, forward: CTGAATCTGGTATCAAGTGTCACCCTCT, reverse: GATTCGAGAATGGCCTGCCTGA; Foxp3, forward: CAGAGTTCTTCCACAACATGGAC, reverse: CAGGGATTGGAGCACTTGTTG; Ctla4, forward: AGAACCATGCCCGGATTCTG, reverse: GCTCTGTTGGGGGCATTTTC; GAPDH, forward: TTCACCACCATGGAGAAGGC, reverse: GGCATGGACTGTGGTCATGA; E2f1, forward: GCATCCAGCTCATTGCCAAGAAGT, reverse: GAAAGCAGTTGCAGCTGTGTGGTA; E2f2, forward: TCAGAGTTGCTCCCTGAGCTTCAA, reverse: TTGAAGTTGCCTACGGCACGGATA; E2f3, forward: AGGGCCCATTGAGGTTTACTT, reverse: GTAGAAACCGAGCAGTCACTA; Cdk1, forward: CATGGACCTCAAGAAGTACCTGG, reverse: CAAGTCTCTGTGAAGAACTCGCC; Mcm5, forward: GGAGGCATTGAGACTGTTCCAG, reverse: AGACACCTGAGAGCCAATGGCA; and Pik3ip1, forward: ATCCTCGCTATTGGAGCTGGCATT, reverse: TCTGGTTGCTGTGCACAATGATGG.

Immunoblot and immunoprecipitation

Cells were washed with ice-cold PBS twice and lysed in RIPA buffer (20 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1% NP-40; 0.1% SDS; 0.5% sodium deoxycholate) containing 1× Protease Inhibitor Cocktail (Roche, Mannheim, Germany). Cell extracts were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA). The membrane was analyzed by immunoblot with rabbit anti-Foxp1 [31], mouse anti-Foxp3 (eBio7979, Thermo Fisher Scientific), or mouse anti-β-actin (AC74, Sigma). For co-immunoprecipitation, cell lysates were immunoprecipitated with appropriate antibodies (1 μg/mL) using protein A sepharose beads (GE Healthcare, Uppsala, Sweden) at 4 °C. Samples were used for immunoblot analysis with the indicated antibodies.

Treg cell proliferation

YFP⁺ CD44^lowCD62L^highCD4⁺ T cells (rTregs) and YFP⁺ CD44^highCD62L^lowCD4⁺ T cells (aTregs) sorted from Foxp3^Cre or Foxp1^f/fFoxp3^Cre mice were labeled with CellTrace following the manufacturer’s instruction (CellTrace Violet Cell Proliferation Kit, Thermo Fisher Scientific). To assess the proliferation of purified Treg cells to TCR stimulation, labeled Treg cells were stimulated with the indicated concentration of anti-CD3 and anti-CD28 in the presence of 200 U/mL IL-2 for 3 days.

Retroviral transduction

The open reading frames of Foxp3 and Foxp1A were subcloned into the retroviral vector MSCV-IRES-VEX and MSCV-IRES-Tomato. Retroviruses were packaged in the HEK293T cell line as described previously [32]. Briefly, retroviral expression plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Thermo Fisher Scientific). For transduction of retrovirus, purified Treg cells were stimulated with 10 μg/mL anti-CD3 and 10 μg/mL anti-CD28 in the presence of 500 U/mL IL-2 for 24 hours. Activated cells were spin transduced with 1 mL virus-containing medium with polybrene (6 μg/mL) at 650g, 30°C for 2 hours; transduced cells were cultured with complete T-cell medium supplemented with recombinant human IL-2 (500 U/mL). The cells were harvested on d4 for staining or adoptive transfer.

Colitis induction and lamina propria mononuclear cell isolation

For the induction of acute colitis, age-matched female Foxp3^Cre/Cre or Foxp1^f/fFoxp3^Cre/Cre mice were treated with 2.5% DSS (molecular weight 36,000–50,000 kDa; MP Biomedicals, Aurora, OH) dissolved in drinking water for 14 days. Mice were weighed every day and killed at d14. Cytokine production of CD4⁺ T cells from spleens and colons were analyzed by flow cytometry. The colons were also processed for tissue sectioning and HE staining.

For isolation of lamina propria (LP) mononuclear cells, dissected colons were washed with PBS followed by removing fat tissues and Peyer’s patches. Colon tissues were pretreated in 5% FBS DMEM containing 1 mM DTT (Sigma) and 30 mM EDTA (AMResco) at 37°C for 30 minutes in a shaker. Then, pretreated tissues were digested in 5% FBS DMEM containing Liberase (25 μg/mL, Roche) and DNase I (20 μg/mL, Sigma) at 37°C for 30 minutes in a shaker. Digested tissues were meshed in a 70-μm cell strainer, followed by percoll gradient (80%/40%) centrifugation. Mononuclear cells present in the interphase were collected, washed with PBS, and resuspended in T-cell medium.

EAE induction, Treg administration, and CNS mononuclear cell isolation

For EAE induction, 2-month-old Foxp3^Cre or Foxp1^f/fFoxp3^Cre mice were immunized subcutaneously with 200 μg of MOG35–55 peptide (GL Biochem, Shanghai, China) emulsified in Complete Freund’s Adjuvant (CFA; Sigma). Additionally, mice were injected intravenously with 200 ng of PT (List biological laboratories, Campbell, CA) on d0 and d2 following immunization. For Treg cell transfer, experimental mice were intravenously injected with 2 × 10⁶ Foxp3-transduced Foxp1^f/fFoxp3^Cre Treg cells in 200 μL PBS at d4 post EAE induction. Control groups were either injected with the same number of Foxp3^Cre or Foxp1^f/fFoxp3^Cre Treg cells infected with control retroviruses (RV-ctrl) or retroviruses expressing Foxp3 (RV-Foxp3) at d4 post EAE induction. The clinical scores and body weight of mice was evaluated daily after 6 days following immunization. Severity of EAE was assessed daily with a 0–5 scoring system [52]: 0, no clinical signs; 0.5, partially limp tail; 1, paralyzed tail; 2, loss in coordinated movement, hind limb paresis; 2.5, one hind limb paralyzed; 3, bilateral hind limb paralysis; 3.5 hind limbs paralyzed, weakness in forelimbs; 4, forelimb paralysis; 5, moribund.

For isolation of CNS mononuclear cells, mice were perfused with PBS to remove blood cells within tissues. CNS tissues (brains and spinal cords) were cut into small pieces and digested with Liberase (25 μg/mL, Roche) and DNaseI (20 μg/mL, Sigma) at 37°C for 30 minutes. Digested tissues were meshed in a 70-μm cell strainer, followed by percoll gradient (80%/40%) centrifugation. Mononuclear cells present in the interphase were collected, washed by PBS, and resuspended in culture medium.

Histopathology

For histological analysis, mouse tissues were fixed in 3.7% (vol/vol) formaldehyde, and sections were stained with hematoxylin and eosin, or Luxol fast blue-hematoxylin and eosin according to standard procedures.

ChIP

Naive CD4⁺ T cells from Foxp3^Cre or Foxp1^f/fFoxp3^Cre mice were cultured under iTreg-polarizing conditions (5 ng/mL TGF-β, 200 U/mL IL-2). ChIP of Foxp1, Foxp3 was performed as described [32]. Immunoprecipitated DNA and input DNA were analyzed by quantitative PCR (Applied Biosystems). The primers were as follows: Foxp3 CNS2, forward: ATCTGGCCAAGTTCAGGTTG, reverse: GGCGTTCCTGTTTGACTGTT; Foxp3 promoter, forward: CCCTGCAATTATCAGCACAC, reverse: TGTGGGAAACTGCCACATTA; Ctla4 promoter region, forward: GACTCCACGTCTCCAGGTCCTCAG, reverse: GGAAGCCGTGGGTTTAGCTGTTAC; Gmpr, forward: CAGCTGGAACAGCCTTGGAA, reverse: AAATGTCAAGGCCCCTGTGA. Control for CTLA4 promoter region in Foxp1 ChIP assay: forward: GTCAGAGTATTTTATCACAGCCAC, reverse: AGTCTACTGCAAAACCCCAAG.

RNA-Seq analysis

Statistics

Statistical analyses were performed with Prism 6.0 (GraphPad). Two-tailed Student t tests and paired t tests were used for the calculation of P values, except for those in RNA-Seq analysis. *P < 0.05, **P < 0.01, and ***P < 0.001.