Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Drosophila Distal-less and Rotund Bind a Single Enhancer Ensuring Reliable and Robust bric-a-brac2 Expression in Distinct Limb Morphogenetic Fields

Abstract

Most identified Drosophila appendage-patterning genes encode DNA-binding proteins, whose cross-regulatory interactions remain to be better characterized at the molecular level, notably by studying their direct binding to tissue-specific transcriptional enhancers. A fine-tuned spatio-temporal expression of bric-a-brac2 (bab2) along concentric rings is essential for proper proximo-distal (P-D) differentiation of legs and antennae. However, within the genetic interaction landscape governing limb development, no transcription factor directly controlling bab2 expression has been identified to date. Using site-targeted GFP reporter assay and BAC recombineering, we show here that restricted bab2 expression in leg and antennal imaginal discs relies on a single 567-bp-long cis-regulatory module (CRM), termed LAE (for leg and antennal enhancer). We show that this CRM (i) is necessary and sufficient to ensure normal bab2 activity in developing leg and antenna, and (ii) is structurally and functionally conserved among Drosophilidae. Through deletion and site-directed mutagenesis approaches, we identified within the LAE essential sequence motifs required in both leg and antennal tissues. Using genetic and biochemical tests, we establish that in the LAE (i) a key TAAT-rich activator motif interacts with the homeodomain P-D protein Distal-less (Dll) and (ii) a single T-rich activator motif binds the C2H2 zinc-finger P-D protein Rotund (Rn), leading to bab2 up-regulation respectively in all or specifically in the proximal-most ring(s), both in leg and antenna. Joint ectopic expression of Dll and Rn is sufficient to cell-autonomously activate endogenous bab2 and LAE-driven reporter expression in wing and haltere cells. Our findings indicate that accuracy, reliability and robustness of developmental gene expression do not necessarily require cis-regulatory information redundancy.

Author Summary

In insects, leg and antenna are homologous limbs, though derive from a single ancestral appendage. In Drosophila, leg and antennal development along the proximo-distal (P-D) axis relies on relatively-well known genetic cascades, in which most appendage-patterning genes encode transcription factors (TF). However, their cross-regulatory interactions remain to be better characterized at the molecular level. A fine-tuned expression of the bric-a-brac2 (bab2) gene is essential for normal leg and antennal segmentation. However, within the genetic cascades governing P-D limb development, no TF directly controlling bab2 expression has been identified to date. We show here that restricted bab2 expression in developing leg and antenna is governed by a single enhancer, termed LAE, which is necessary and sufficient in-vivo to ensure bab2 functions there. We show that leg and antennal cis-regulatory elements are closely associated and that essential LAE sites interact with Distal-less (Dll) and Rotund (Rn) TFs, leading to bab2 activation in all or specifically in the proximal-most expressing cells, respectively. Finally, joint ectopic expression of Dll and Rn is sufficient to instruct wing and haltere cells to up-regulate bab2. Taken together, our work indicates that a single enhancer is necessary and sufficient to reliably govern bab2 expression in distinct morphogenetic fields.

Citation: Baanannou A, Mojica-Vazquez LH, Darras G, Couderc J-L, Cribbs DL, Boube M, et al. (2013) Drosophila Distal-less and Rotund Bind a Single Enhancer Ensuring Reliable and Robust bric-a-brac2 Expression in Distinct Limb Morphogenetic Fields. PLoS Genet 9(6): e1003581. https://doi.org/10.1371/journal.pgen.1003581

Editor: Thomas M. Williams, University of Dayton, United States of America

Received: February 12, 2013; Accepted: May 5, 2013; Published: June 27, 2013

Copyright: © 2013 Baanannou et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by grants from the French governmental agency for Research (CNRS), the Paul Sabatier University (UPS) and the “Association pour la Recherche sur le Cancer” (ARC). AB was supported by the CNRS and the Midi Pyrenees Region. LHM-V was supported by the Mexican CONACYT. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Fine-tuned spatial and temporal transcriptional regulation is essential to ensure proper development [1], [2]. Reliability of developmental gene regulation is governed by tissue-specific cis-regulatory modules (CRM) or “enhancers”, often situated far away from gene promoters, whereas robustness and accuracy of gene expression could be ascribed to partially-redundant “shadow” enhancers [3]. Morphogenesis of the Drosophila adult leg along the proximo-distal (P-D) axis offers a good model to decipher how patterning genes are tightly controlled at the transcriptional level and integrated within the well characterized limb-specific genetic cascades [4]–[9]. Nevertheless, owing to the large number of leg patterning genes encoding DNA-binding proteins and the complexity of their cross interactions, it is a challenge to determine which transcription factors (TF) are directly implicated in the regulation of a given P-D gene and how they functionally interact upon binding to discrete DNA sites. Toward a full understanding at the molecular level of the genetic interaction landscape governing limb development, it is thus crucial to gain better knowledge of the CRM(s) controlling the fine-tuned expression of each member of the underlying gene regulatory network.

The Drosophila leg is composed of ten segments which are articulated to each other by characteristic joints [8]. The distal portion of the adult leg, the tarsus, is divided into five segments (ts1–5), and P-D tarsal patterning occurs by successive intercalations of new positional fates within the growing leg imaginal disc [5], [9]. Early on during this process, wingless and decapentaplegic signalling pathways regulate the expression of transcription factors encoded by Distal-less (Dll), dachshund (dac) and homothorax (hth) P-D genes [10]–[13]. Dll, dac and hth are activated in concentric domains that define the distal, medial and proximal parts of the adult appendages, respectively [14], [15]. Together with EGFR signalling emanating from the distal-most cells, these so-called leg “gap” genes in turn regulate downstream TF-encoding genes, that include spineless, rotund, bric-a-brac1/2, BarH1/2 and apterous, all expressed dynamically in the tarsal domain [5], [9]. Unlike the leg, in the antennal imaginal disc Dll and hth expression domains overlap, leading to the specific activation of spalt and cut [16]. Except for the regulation of the early-acting Dll and dac gap genes [14], [15], few direct interactions have been established within the leg and antennal P-D regulatory cascades. Here, we choose the bric-a-brac (bab) locus as a model to study the integrated regulation of P-D patterning genes implicated in distal leg and antennal segmentation.

The bab locus consists of two paralogous genes, bab1 and bab2, encoding BTB transcription factors [17], [18]. Although both genes are partially redundant in other developmental processes, only bab2 is indispensible for distal leg and antennal segmentation [17], [18]. However, both bab1 and bab2 display dynamic expression in similar restricted P-D sub-domains with distinct expression patterns between leg and antenna [17], [18]. Initially expressed homogeneously within the Dll-expressing distal domain in early-mid third-instar larvae (L3), the bab1/bab2 expression pattern in late L3 resolves to four concentric rings in the leg or two concentric rings in the antennal imaginal discs [17]. Later on at pupal and adult stages a P-D expression gradient within each ring is observed which is essential for ts2–4 and antennal a3–5 segment joint formation [17]–[19].

In both developing leg and antenna, all aspects of the bab2 expression pattern require the activity of the homeodomain Dll protein [19]–[21]. In addition to Dll, bab2 expression is dependent on spineless (ss), at the exclusion of the distal-most ring [19]. Indeed, spineless encodes a bHLH-PAS family TF that is transiently expressed in ts1–3 from early to mid L3 stage [19], [21], [22]. Of note, unlike leg, ss expression is maintained in developing antenna [22], notably under the direct control of Dll [23]. In addition to positive inputs from Dll and ss, bab2 expression is restricted proximally by dac activity [19] and distally by a gradient of EGFR signalling [21], [24]. Lastly, graded bab2 expression, both distally and proximally, has been linked to Notch signalling via a repressive effect of bowl activity [25], [26].

Although several bab2 regulators have been identified, to date none has been shown to be direct and no limb-specific CRM has been identified. Starting from a previous systematic identification of tissue-specific enhancers within the 150-kilobase (kb)-long bab locus performed by Williams et al. [27], we characterized here an evolutionarily-conserved 567 base pair (bp) CRM, which reproduces expression of the bab2 endogenous gene, both in leg and antennal tissues. This CRM (termed LAE, for leg and antennal enhancer) is physically and functionally conserved between D. melanogaster and D. virilis. We find that the LAE is both necessary and sufficient in-vivo to ensure proper bab2 expression in leg and antennal imaginal discs, and for normal segmentation of the mature appendices. Using targeted deletions and site-directed mutagenesis, we show that leg and antennal cis-regulatory elements are closely associated. Furthermore, activation of bab2 expression in proximal- and distal-most rings is dependent on separate DNA elements. Moreover, we show that discrete essential LAE sites interact with Distal-less and Rotund transcription factors leading to bab2 activation in all or specifically in the proximal-most expressing cells, respectively. Finally, ectopic co-expression of Dll and Rn is sufficient to instruct wing and haltere cells to up-regulate bab2. Taken together, our work indicates that a single enhancer, under the direct control of the P-D proteins Dll and Rn, is necessary and sufficient to reliably govern Drosophila bab2 expression in distinct limb morphogenetic fields.

Results

A conserved cis-regulatory module recapitulates limb-specific bab2 expression

A systematic study of the 150-kb bab locus identified leg-specific cis-regulatory elements within a 11 kb region encompassing two overlapping genomic fragments (termed BP42 and BP47) localized between the bab1 and bab2 transcription units (Figure 1A) [27]. Both BP42 and BP47 fragments also reproduce the antennal bab2 expression (Supplementary Figure S1). To identify limb-specific bab CRMs, we further dissected the relevant 11-kb region, using a sequence-directed GFP reporter assay (see Materials and methods) [28]. Six overlapping genomic fragments (#1 to 6) (Figure 1A) were examined for GFP expression in both developing leg and antenna. Only fragments #3 and #4 drove strong GFP expression in leg as well as antennal tissues (Figure S1) indicating that the relevant cis-regulatory information is located within the 1.5 kb sequence shared by BP42 and BP47. In confirmation of this, a fragment (#7) containing only this 1.5 kb region was sufficient to reliably reproduce bab2 expression in leg and antennal tissues (Figure S1).

thumbnail
Download:
Figure 1. Identification of an evolutionarily-conserved CRM that recapitulates leg and antennal bab2-expression.

(A) A GFP-reporter assay identified a leg/antennal enhancer (LAE) element situated in the middle of the 150-kb bric-a-brac locus, between the bab1 and bab2 transcription units. The position of the 26B15 BAC used for phenotypic rescue experiments is shown, as well as the two overlapping genomic fragments (BP42 and BP47) driving GFP-reporter expression in developing legs [27]. Beneath, an enlarged view of the 11-kb BP42-47 region shows the positions of the eight genomic sub-fragments (#1–8) tested in our site-directed GFP reporter assay (see Materials and methods). The four fragments (#3, 4, 7 and 8) that faithfully reproduce wild-type leg and antennal (ant) bab2 expression (Figure S1) are indicated in green. (B) Conservation of the LAE sequence among Drosophilidae. Identical, highly- or non-conserved LAE sequences among a set of 10 Drosophila species, with respect to the D. melanogaster sequence, are depicted, respectively, by thick vertical black, grey or white lines, whereas thin horizontal grey lines indicate gaps. As determined from the UCSC genome browser (http://genome.ucsc.edu/), sequence conservation (from 0 to 100% identity) over a 10-bp sliding window is represented above by the height of the conservation plot, with the three >20-pb-long highly-conserved CR1-3 regions indicated within (A full alignment from LAE sequences of 22 Drosophilidae species is provided in Supplementary Figure S2). (C) The 567 bp LAE recapitulates spatial and temporal bab2-expression pattern in developing leg and antenna. The expression of the LAE-GFP reporter construct is shown for early, mid and late third-instar larval as well as pharate adult stages. Expression sites in mature appendages are indicated by arrows. (D) Functional conservation of the D. virilis LAE regulatory activity in developing D. melanogaster appendages. GFP expression (green) alone and in combination with Bab2 immunostaining (red) of leg (E–E′ and G–G′, respectively) and antennal (F–F′ and H–H′, respectively) imaginal discs from late third-instar larvae expressing either the D. melanogaster (D. mel) or D. virilis (D. vir.) LAE-GFP construct (E–F and G–H, respectively), are shown.

https://doi.org/10.1371/journal.pgen.1003581.g001

Before dissecting further the 1.5 kb fragment, we examined its evolutionary conservation among 12 Drosophila species whose genome sequences were available [29]. LAE sequences were identified and aligned. Only three >20 bp motifs (termed CR1-3) are highly conserved among Drosophilidae (Figures 1B and S2). We therefore tested the activity of a 567-bp fragment (#8) encompassing the CR1-3 motifs, and found that its activity faithfully recapitulated spatial and temporal bab2 expression in both developing leg and antenna (Figure 1C–D). From two Drosophilidae species having diverged 40–60 millions years ago, we then tested the equivalent 0.7-kb D. virilis region and found that its regulatory activity was similar to that of the D. melanogaster LAE (Figure 1D, compare G–G′ and H–H′ to E–E′ and F–F′, respectively), supporting the functional importance of the conserved CR1-3 motifs. Taken together these data indicate that the evolutionarily-conserved 567-bp region contains regulatory information sufficient to recapitulate limb-specific bab2 expression, both in developing leg and antenna. We therefore termed this region LAE, for leg and antennal enhancer.

LAE is necessary and sufficient for bab2 expression and function in-vivo

To define whether the LAE is also necessary to ensure normal bab expression in-vivo, we used a P[acman] BAC construct (26B15) [30], including the bab2 transcription unit and the LAE-containing intergenic region (see Figure 1A). Adults homozygous for the babAR07 null allele display shortened tarsi with segmental joint fusions, particularly the fully penetrant fusion of ts4–5 (Figure 2A–B) [18]. A single copy of the intact 26B15 BAC construct was sufficient to restore normal Bab2 protein expression in both developing leg and antenna (Figure 2A, J and O, respectively), as well as to rescue bab mutant phenotypes (Figure 2A–B, arrowheads in E), suggesting the lack of a remote shadow enhancer located within bab1 or elsewhere in the vicinity of the bab locus. In contrast, no appendage-specific Bab2 expression could be detected for a LAE-deleted version of the 26B15 BAC construct (Figure 2A–B, K and P). Further, phenotypic rescue could neither be observed (Figure 2A–B, see arrows in F). We conclude that in our experimental conditions the LAE cis-regulatory module appears to be strictly required for bab2 expression and function in developing limbs. Of note, the wild-type 26B15 BAC and its LAE-minus version were both capable of partially restoring dominant abdominal pigmentation defects of babAR07 heterozygous females (Figure S3) (see discussion).

thumbnail
Download:
Figure 2. LAE is necessary and sufficient for wild-type bab2 expression and function in-vivo.

(A) LAE-containing bab2-expressing constructs restore normal leg and expression defects in a loss-of-function context. (C–G) Scanning electron microscope views of distal adult T1 legs from wild-type (C), babAR07 (D), w1118 26B15-LAE+; babAR07 (E), w1118; 26B15 ΔLAE; babAR07 (F) and w1118 LAE-bab2cDNA, babAR07 (G) males, are shown. Wild-type tarsal junctions between ts1–5 are indicated by arrowheads. (H–Q) Bab2 immunostaining (red) of leg (H–L) and antennal (ant) (M–Q) imaginal discs, dissected from wild-type (H and M), babAR07 (I and N), w1118 26B15-LAE+; babAR07 (J and O), w111826B15ΔLAE;babAR07 (K and P) or w1118 LAE-bab2cDNA; babAR07 (L and Q) third-instar larvae, are shown. The null babAR07 allele [17] corresponds to a large deletion removing the entire bab1/2 intergenic region that contains the LAE, and most of the bab2 transcription unit (unpublished). Both the 26B15LAE+ PacMan and LAE-bab2cDNA constructs rescued the tarsal fusion phenotypes (particularly between ts4–5) and restored the wild-type leg and antennal Bab2-expression patterns. (B) Quantification of mutant phenotypes. A diagram is shown for each genotype with mean and standard error of mean.

https://doi.org/10.1371/journal.pgen.1003581.g002

To ask whether the LAE is also sufficient to ensure normal Bab2 expression in developing limbs, we then tested the ability of an LAE-driven bab2 cDNA construct (LAE-bab2cDNA) to rescue babAR07 phenotypes. Normal leg segmentation and limb-specific Bab2 expression were restored by a single copy of the LAE-bab2cDNA construct (Figure 2A–B, G, L and Q), demonstrating that the LAE is both essential and sufficient for limb-specific bab2 expression and function.

LAE includes shared leg and antennal regulatory information

To functionally dissect the LAE, we tested serially truncated constructs removing either 3′ or 5′ sequences (Figure 3). Deletion of 89 bp at the 3′-end (F3 construct), that removed the CR3 motif, led to a modest decrease in GFP expression (72 and 77% of signal strength, compared to the entire LAE, in leg and antennal tissues, respectively) without affecting expression in the right cells (Figure 3, B–B′ and I–I′). Deletion of 248 additional bp (S5 construct) further reduced the level of expression (35 and 32% in leg vs. antenna) (Figure 3, C–C′ and J–J′, respectively). Deletion of 93 additional bp at the 3′-end (S1 construct), removing the CR2 sequence, led to a drastic reduction of the signal strength (10 and 3%), with a nearly-complete loss of GFP expression in the distal-most bab2-expressing cells, in either leg or antennal tissues (Figure 3, arrows in D–D′ and K–K′, respectively). Of note, a deletion of 37 additional bp, non-strictly-conserved across all Drosophilidae, led to nearly-complete loss of all rings (not shown), indicating their critical role. These 3′-deletion data support the following conclusions: (i) 327 bp from the 3′ half, including CR3, are required for signal intensity; (ii) whereas the remaining 230 bp from the 5′-half, including CR1-2, are sufficient for limb-specific expression, among which (iii) 93 bp encompassing CR2 are required for making the distal bab2-expressing ring.

thumbnail
Download:
Figure 3. LAE contains separate signal specificity and intensity regions, with shared leg and antennal regulatory elements.

The names and relative positions (with respect to the entire LAE) of each genomic fragment tested in our site-directed GFP reporter assay are shown on the left side. The conserved CR1-3 regions are indicated by grey boxes. The relative levels of GFP expression (Materials and methods), in leg and antennal (ant) tissues, are indicated in % relative to the entire LAE. For each examined construct, GFP expression (green) alone and in combination with Bab2 immunostaining (red) of leg (A–G and A′–G′, respectively) and antennal (H–N and H′–N′, respectively) imaginal discs from late third-instar transgenic larvae, are shown on the right side. Both in the leg and antennal tissues, the S1 (D–D′ and K–K′, respectively) and S3 (E–E′ and L–L′, respectively) reporter constructs, displayed decreased GFP expression in the distal- or proximal-most bab2-expressing rings, respectively, as visualized by the red-orange signals (see arrows and brackets, respectively) instead of yellow colour normally seen in the merged images. Neither the isolated CR1 sequence (B1 construct) nor the CR2-3 region (F1) drove GFP expression in any limb tissue.

https://doi.org/10.1371/journal.pgen.1003581.g003

Conversely, a 100-bp 5′ deletion removing the CR1 sequence (F1 construct) led to complete loss of limb-specific GFP expression (Figure 3, F–F′ and M–M′). This indicates a key regulatory function for CR1 in all bab2-expressing leg and antennal cells. Nevertheless, the 68-bp CR1 sequence alone (B1 construct) did not drive either leg- or antennal expression (Figure 3, G–G′ and N–N′, respectively). These data indicate that CR1 is critical but not sufficient for GFP-reporter activity in both developing appendages. As the CR2-containing F1 construct deleted for CR1 did not allow GFP expression (above), we conclude that CR2 is also not sufficient for LAE activity in the distal-most bab2-expressing ring.

Given that the CR1 sequence is not sufficient for LAE activity, we then examined the functional significance of the poorly-conserved 32-bp-long 5′-flanking region (see Figure S2). Its deletion (S3 construct) led to reduced expression levels in the two proximal-most leg rings (spanning tarsi ts1–2 and ts2–3) and the proximal antennal ring (spanning a3–4 segments) (Figure 3, brackets in E–E′ and L–L′, respectively), but specificity retained (i.e., expression in the right cells at the late L3 stage).

Taken together these data indicate that (i) the entire LAE is required to recapitulate normal spatial, temporal and quantitative bab2 expression patterns; (ii) leg and antennal expression employ shared regulatory information; (iii) the 337 bp 3′-part is only required for signal strength; and finally (iv) the 230 bp 5′-part is critical for signal specificity, with a key role of the CR1 sequence, while the 32 bp 5′-end and CR2 sequences are required quantitatively for normal expression levels in the proximal- and distal-most rings, respectively.

CR1 includes separate activating and repressive regulatory elements

Its central role in limb-specific expression led us to dissect the 68-bp-long CR1 sequence by substituting each 8 bp by a linker sequence (see Materials and methods) (Figure 4A). Though all eight CR1-mutated LAE constructs (LS1-8) detectably affected GFP expression qualitatively and/or quantitatively (Figures 4B and S4), four (LS1, 2, 5 and 8) displayed strong defects. LS2 showed almost complete loss of GFP expression in both leg and antennal tissues (Figure 4B, E–E′ and J–J′, respectively), indicating it affects a crucial positive input. LS1 led to strong up-regulation in inter-ring cells in the developing leg (Figure 4B, arrows in D–D′), suggesting a distinct role in inter-ring suppression. LS5 showed globally decreased GFP expression (30%), but more pronounced in the proximal-most leg and antennal ring (Figure 4B, brackets in F–F′ and K–K′, respectively). Finally, LS8 displayed decreased GFP expression specifically in the proximal-most bab2-expressing ring, again in both leg and antennal tissues (Figure 4B, brackets in G–G′ and L–L′, respectively). As to milder effects of other mutants, (i) the LS4 and LS6 constructs displayed a partial GFP intensity decrease in the proximal-most ring, particularly marked in leg tissues; (ii) LS7 showed a partial inter-ring de-repression in leg tissues; (ii) whereas LS3 and LS6 exhibited a slight GFP intensity decrease specifically in antennal tissues (50% each) (Figure S4).

thumbnail
Download:
Figure 4. The key CR1 sequence includes separate activating and repressive regulatory information.

(A) Linker scanning (LS) mutagenesis of the 68-bp CR1 conserved region. The sequences of the wild-type and of each of the eight mutated (LS1–8) CR1 sub-regions (tested within the entire LAE) are shown, with the names of the examined LS constructs indicated on the right side. The inserted linker sequence (AGCTAGCA) is italicized with nucleotide substitutions depicted in red. Note that an additional consensus HD-binding site (underlined) has been created in the LS3 construct. The most striking positive and negative regulatory elements are framed in green and red, respectively. (B) Critical DNA elements within CR1. GFP expression (green) alone and in combination with Bab2 immunostaining (red) of leg (C–G and C′–G′, respectively) and antennal (ant) (H–L and H′–L′, respectively) imaginal discs from late third-instar larvae, expressing either the LAE-GFP construct or any of the four LS-mutated derivatives displaying the strongest abnormal expression patterns, are shown (for the remaining four constructs, see Figure S4). LS2-driven GFP reporter expression was drastically reduced, in both leg (E–E′) and antennal (J–J′) imaginal discs. Conversely, the LS1-GFP construct displayed inter-ring de-repression in leg tissues (D–D′), as determined by the green (arrows) instead of yellow colour normally seen in the merged images. Finally, the LS8 and to a lesser extent LS5 constructs exhibited strongly decreased GFP expression in the proximal-most bab2-expressing tarsal (F–G) and antennal (K–L) as determined by the red staining (brackets) instead of the yellow colour normally seen on the merge.

https://doi.org/10.1371/journal.pgen.1003581.g004

Taken together these site-directed mutagenesis data indicate (i) tightly-associated leg and antennal CR1 regulatory information, and (ii) that the LS2 sub-sequence is indispensible for LAE activity.

Distal-less is the central direct bab2 activator in developing appendages

Having identified key cis-regulatory DNA elements, we next sought positively acting factors that directly bind there. We noticed that the critical LS2 motif is embedded within an A/T-rich sequence (AAAATTAATGGTAATAA), including three potential homeodomain (HD)-binding sites (TAAT or ATTA motifs) of which two were disrupted in the LS2 mutant. Given that HD-containing Dll protein is cell-autonomously required for bab2 expression [21], we therefore examined whether the LAE-GFP reporter also requires Dll activity, using clonal analysis. As for endogenous bab2, GFP expression was abolished in mutant leg and antennal clones for DllSA1, a protein-null allele (Figure 5A, D–D″′ and E–E″′, respectively). This indicates that Dll is cell-autonomously required for LAE regulatory activity, and therefore suggest a direct binding of the HD-containing Dll transcription factor to the LAE, potentially through the key activating LS2 motif within CR1.

thumbnail
Download:
Figure 5. The Dll homeodomain protein positively regulates LAE activity through direct binding to CR1 sequences.

(A) Dll activity is critically required for both bab2 and LAE-GFP expression in developing limbs. Dll immunostaining (red), Bab2 immunostaining (blue) or GFP expression (green) alone, as well as the corresponding merged images, of leg (D–D″′) and antennal (ant) (E–E″′) imaginal discs from late third-instar larvae carrying Dll null mutant clones, are shown. Large DllSA1 mutant clones (circled by dashed white lines) are indicated by white arrows in all panels. Expression of both endogenous bab2 and LAE-GFP reporter was cell-autonomously extinguished in the Dll mutant cells. (B) Dll binds in-vitro to HD-binding motifs located throughout the LAE sequence. The extents of the signal specificity and strength regions are indicated. The sequence LOGO of the consensus Dll-binding site (mainly composed of a TAAT motif), as determined from selection in bacteria [52], is shown in the left side. The positions of 11 TAAT/ATTA motifs within the LAE are indicated by vertical lines, and the corresponding DNA probes (#1–9) used in the EMSA experiments indicated above. Of note, all sites but one (probe #5) are situated within the CR1–3 conserved regions. LAE sequences (in grey) included in each labelled double-stranded DNA probe are indicated beneath, with mutated nucleotides shown in red. PhosphorImager detection of DNA-protein complexes separated by electrophoresis on native polyacrylamide gels is shown on the right. In-vitro translated Dll was omitted or added, as indicated above the lanes, numbered according to the tested probe. The positions of non- and Dll-specific shifted DNA-protein complexes are indicated by asterisks and a horizontal arrow, respectively. The extended probes #6–9 included the overlapping DNA fragments #1–2. In contrast to the two singly-mutated probes (#8–9), the high-affinity Dll-specific complex detected with the wild-type sequence (#6) was no longer detected with the doubly-mutated derivative (#7). (C) The triple TAAT-containing sequence within CR1 is critical for LAE activity in-vivo. GFP expression (green) alone and in combination with Bab2 immunostaining (red) of leg (F–F′) and antennal (G–G′) imaginal discs from a late third-instar larva expressing the H4-GFP reporter construct, a LAE-GFP derivative mutated on the three CR1 TAAT/ATTA motifs (identical to EMSA probe #7), are shown. No GFP expression could be detected, either in leg or in antennal tissues.

https://doi.org/10.1371/journal.pgen.1003581.g005

In addition to the 3 present in CR1, the entire LAE comprises 8 additional putative HD-binding sites of which 7 are clustered within the CR2 and CR3 sequences (Figures 5B and S2). To test whether Dll is able to bind in-vitro to the TAAT/ATTA-containing LAE sequences, we used an electrophoretic mobility shift assay (EMSA). All LAE fragments including one to six of the 11 TAAT/ATTA motifs bound in-vitro translated Dll, albeit with distinct affinities (Figure 5B). Unexpectedly, given the key role in-vivo of the LS2 region, each TAAT or ATTA site in CR1 showed rather low in-vitro affinity (DNA fragments #1–2), when tested individually. We therefore examined whether Dll binds with a higher efficiently to a larger DNA fragment including the three TAAT/ATTA motifs present in CR1 (i.e., AAAATTAATGGTAATAA). As a matter of fact, Dll strongly bound this extended fragment (#6) (Figure 5B). Furthermore, stable interaction was strictly dependent upon the three TAAT/ATTA motifs. Whereas singly-mutated (TAAT vs. CCCC) fragments bound Dll with lower affinity, the mutation of the double overlapping TAAT/ATTA sites (ATTAAT vs. CCCCAT; probe #9) showed a stronger effect, while Dll binding was abolished when all three TAAT/ATTA motifs were mutated (probe #7).

To investigate whether the extended AT-rich sequence mediates in-vivo regulation by Dll, we then introduced the same TAAT-mutated sequence (i.e., CAAACCCCATGGCCCCAAGCA) into the LAE-GFP reporter (H4 construct). The H4 construct no longer expressed GFP either in leg or antennal tissues (Figure 5C, F–F′ and G–G′, respectively), indicating that these three HD-binding sites are crucial for LAE activity in-vivo. Surprisingly, mutation of the two overlapping TAAT/ATTA motifs was silent in-vivo (LS3 mutant; Figure 4B). In fact, a new HD-binding site capable of stably interacting with Dll in-vitro (not shown) has been fortuitously created in LS3 (see Figure 4A), providing a likely rationale for this discrepancy.

Taken together, in-vitro and in-vivo data establish that Dll-dependent activation of bab2 expression in developing leg or antenna, involves direct binding to the conserved HD-binding sites of the CR1 regulatory sequence.

Rotund only contributes to bab2 activation in proximal leg and antennal rings

Having shown above that normal LAE activity in the proximal-most bab2-expressing cells is mediated by its 32-bp 5′-end region (R32) (Figure 3, E–E′ and L–L′), we then sought for candidate transcription factors encoded by known limb P-D patterning genes. One, spineless, has been previously shown to regulate bab2 expression in the leg proximal-most rings [19]. However, we found no evidence for any putative binding site for the Ss/Tango bHLH-PAS heterodimer (GCGTG) [31], [32] in R32, and even in the entire LAE. A second candidate was rotund (rn), a spineless target gene [9], [33] encoding a C2H2 zinc-finger protein and whose expression corresponds to proximal tarsal segments [9]. First, we compared expression patterns of both genes, using rn-Gal4 and UAS-GFP constructs. GFP expression takes place in the right cells and at the right time [34], but is still detected beyond the mid L3 stage due to perdurance of Gal4 and GFP proteins. At late L3 stage, perduring rn-Gal4 expression is only detected in the proximal-most Bab2-expressing tissues, and extends more proximally than bab2, particularly in antennal tissues (Figure 6, A–A″′ and B–B″′; see yellow and white brackets, for distal versus proximal bab2-only and rn-only expressing cells, respectively). To analyse the role of rn on bab2 and LAE-driven expression, we generated mitotic clones (GFP deficient) of cells homozygous for the rn16 null allele. Strong cell-autonomous reduction of endogenous bab2 (in blue) and LAE-RFP reporter (in red) expression was then observed for leg and antennal clones overlapping the proximal-most bab2-expressing rings (Figure 6, C–C″′ and D–D″′, respectively). This indicates that rn activity on bab2 is spatially restricted and contributes to bab2 expression only in ts1–2 leg and a3–4 antennal tissues.

thumbnail
Download:
Figure 6. rotund is required for bab2 activation only in proximal-most rings, in both leg and antenna.

GFP expression (green), Bab2 immunostaining (blue) and LAE-RFP expression (red) alone, as well as the merged images of leg (A–A″′ and C–C″′) and antennal (ant) (B–B″′ and D–D″′) discs from late third-instar larvae, either wild-type (A–B) or carrying rn null mutant clones (C–D), are shown. rn expression was monitored by combining rn-Gal4 and UAS-GFP constructs (rn>GFP). LAE regulatory activity was monitored with a LAE-RFP construct (Materials and methods). rn-Gal4 reporter expression is not detected in the distal-most bab2-expressing cells (yellow brackets), and extends more proximally than bab2 expression (white brackets). In mosaic tissues, rn16 mutant clones (examples are circled by dashed lines) are detected by the absence of GFP (black areas). Note that only proximally-located mutant cells (white arrows), and not those located in the distal-most ring (yellow arrows), display strongly diminished bab2 and LAE-RFP expression, in either leg or antennal tissues.

https://doi.org/10.1371/journal.pgen.1003581.g006

Rotund directly activates bab2 through the LAE T-rich 5′end region

Next, we examined whether the Rn protein activates bab2 expression via the R32 sequence at the LAE 5′end, specifically required for GFP reporter expression in the proximal-most tarsal and antennal bab2-expressing ring(s). To further confirm its functional requirement, we deleted the R32 sequence in the context of the 230-bp S5-GFP construct (Figure 3), recapitulating leg and antennal bab2 expression, although with lower level than the full size LAE (Figure 7A, D–D′ and G–G′, respectively). The R32-deleted S5 fragment (S10) drove relatively strong GFP expression in the distal-most ring but only very weakly in the proximal-most ring(s), particularly in antennal tissues (Figure 7A, brackets in E–E′ and H–H′). These data confirm that the R32 sequence is required for full LAE-driven expression in proximal bab2-expressing cells in both tarsal and antennal tissues.

thumbnail
Download:
Figure 7. Rotund Zinc-finger protein positively regulates bab2 expression through direct binding to the T13 LAE sequence.

(A) The R32 sequence is required for normal LAE-GFP reporter activation in the proximal-most bab2-expressing cells. GFP expression (green) alone and in combination with Bab2 immunostaining (red) from late L3 leg (D–F and D′–F′, respectively) and antennal (ant) (G–I and G′–I′, respectively) imaginal discs, expressing a given LAE-GFP truncated derivative (left side), are shown. The S5-GFP construct drove wild-type leg (D–D′) and antennal (G–G′) bab2 expression patterns. In contrast, GFP expression in the proximal-most bab2-expressing cells of the R32-truncated derivative S10-GFP was much more weakly detected in leg (E–E′) and not at all in antennal (H–H′) discs (see brackets). The addition of the R32 subsequence T13 to the S10-GFP construct (H3 derivative) was sufficient to increase proximal GFP expression levels (F–F′ and I–I′, see brackets), particularly in antennal tissues. (B) Rn binds in-vitro to R32. The sequence LOGO of the consensus Rn-binding site, including a T-rich track (red bracket), is shown in the upper left side. The LAE sequences included in the four labelled double-stranded DNA probes are indicated beneath, with the same color code. In probes #3–4 the wild-type T6 track was substituted by a linker sequence shown in grey. The position of a consensus G is indicated by a vertical orange line. EMSA experiments are shown on the right. In-vitro translated Rn protein was omitted or added as indicated, and line numbers refer to the four tested probes shown on the left. The positions of non- and Rn-specific shifted DNA-protein complexes are indicated by an asterisk and a horizontal arrow, respectively. Note that Rn bound T13 less strongly than the entire R32 DNA fragment. (C) The R32 sequence is critical for rn-induced LAE-GFP expression in developing limbs. GFP expression (green) alone and in combination with Bab2 immunostaining (red) from late L3 leg (J–K) and antennal (L–M) imaginal discs, over-expressing Rn under the control of the Dll regulatory sequences (Dll-Gal4 plus UAS-Rn constructs), are shown. When Rn was over-expressed throughout the Dll domain, endogenous bab2 and the S5-GFP reporter construct were both up-regulated in nearly all Dll-expressing cells, in either developing leg or antenna. In striking contrast, GFP expression in S10 reporter tissues is not detected, indicating that the R32 sequence is critically required for Rn-mediated S5-GFP expression.

https://doi.org/10.1371/journal.pgen.1003581.g007

The R32 sequence includes a 6-bp-long oligo-T track (T6) embedded within a 13-bp-long T-rich (T13) sequence (TTCGTTTTTTGTT), that resembles binding sites for the vertebrate Rn homolog [35]. To test whether the Rn protein is able to bind effectively to T13 in LAE, EMSA experiments were performed with DNA probes covering either the T13 sequence (probe #1) alone or the complete R32 sequence (#2) (Figure 7B). Though in-vitro translated Rn bound both probes, the R32 fragment was bound about 5-fold more than T13 (Figure 7B, compare lanes 1 and 2). R32 includes a sequence matching the consensus binding site for Drosophila Rn, as determined by recent bacterial one-hybrid binding site data [32] (see Figure 7B). The T6 track appeared critical for specific binding, as R32 and T13 fragments mutated in the T6 track (probes #3–4) were not stably bound by Rn. The EMSA experiments thus indicate that the LAE T13 region constitutes a strong binding site for Rn.

To examine the functional importance of the Rn binding site in-vivo, we added the T13 sequence to the truncated S10 construct to yield the H3 construct. We found that the H3-GFP reporter activity in leg and antennal tissues was similar to that of S5-GFP (Figure 7A, brackets in F–F′ and I–I′, respectively). Even though the GFP expression level remained somewhat low in the developing antenna, we conclude that the T13 sequence is sufficient for GFP-reporter activation in the proximal-most bab2-expressing rings in both the leg and antennal imaginal discs. To further confirm that T13 is essential to mediate direct up-regulation of bab2 by the Rn activator, we performed rotund gain-of-function (GOF) experiments, using the S5 and S10 reporter constructs. Ectopically-expressed Rn (Dll>Rn) activated endogenous bab2 and S5-GFP expression throughout the Dll-expressing leg and antennal cells (Figure 7C, J–J′ and L–L′, respectively), whereas the T13-deficient S10 construct displayed GFP expression neither in leg nor in antennal tissues (Figure 7C, K–K′ and M–M′, respectively). Surprisingly, the normal GFP-expressing rings of cells were also no longer detected, suggesting that Rn protein behaves as an indirect repressor, in addition to being a direct bab2 activator through the T13 sequence.

Taken together with the clonal analyses, we deduce that (i) Rn activity is necessary (in proximal but not in distal rings) and sufficient (when ectopically expressed throughout the Dll domain) for bab2 and LAE-driven activation and (ii) this regulation is direct, via Rn binding to the LAE T13 sequence.

Joint ectopic expression of Dll and Rn is sufficient to activate bab2 in dorsal limb tissues

The above experiments indicated that both Dll and Rn are required together for full bab2 and LAE-dependent reporter activation. This raised the possibility that Dll and Rn together can instruct cells to up-regulate the LAE. To investigate their joint instructive properties, we mis-expressed Dll, Rn or Dll+Rn in wing, haltere and eye tissues using flip-out GOF experiments [36]. bab2 is weakly expressed in restricted domains in developing dorsal appendages (around the wing pouch and in the haltere pouch [19]) but silent in eye tissues. Of note, LAE-driven reporter expression could not be detected either in developing wing, haltere or eye (not shown).

Sustained ectopic expression of Dll protein in developing wing disc induces the entire leg P-D differentiation program including bab2 expression [37]. We therefore used an hsp70-Flp construct to generate small or even single cell clones through heat induction in second- or third-instar larval tissues. In such conditions, mis-expressed Dll appeared inefficient in ectopically activating bab2 as well as LAE-RFP expression in eye, wing and haltere discs (0/50, 9/180 and 0/150 examined clones, respectively) (Figure 8, A–A″′; not shown). Significantly, the few RFP positive clones in the wing disc all corresponded to cells that normally express bab2 (not shown). In equivalent analyses with mis-expressed Rn, eye, wing and haltere clones induced neither endogenous bab2 nor LAE-RFP expression (n>50 for each tissue) (Figure 8, B–B″′; not shown), even in wing and haltere cells normally expressing bab2. In striking contrast, on co-expressing Dll+Rn proteins, a large proportion of examined wing and haltere clones (120/180 and 130/180, respectively) cell-autonomously activated both bab2 and LAE-RFP expression (Figure 8, C–C″′; not shown). Further, in most of the LAE-RFP non-expressing wing and haltere clones, Dll protein was not detectably accumulated (not shown). Significantly, eye clones co-expressing Dll+Rn failed to activate endogenous bab2 and LAE-driven reporter genes (not shown), indicating tissue specificity for their joint instructive properties. These data establish that ectopic co-expression of Dll and Rn is sufficient in instructing dorsal appendage cells to activate endogenous bab2 and LAE-driven reporter expression, presumably adopting a “proximal-ring transcriptional mode”, supporting (i) their direct binding to the LAE and (ii) a tissue-specific functional synergy involving these two transcription factors.

thumbnail
Download:
Figure 8. Joint over-expression of Dll and Rn is sufficient to cell-autonomously activate bab2 in haltere cells.

Joint over-expression of Dll and Rn proteins is sufficient to cell-autonomously activate bab2 in developing haltere pouch tissues. GFP expression (green), Bab2 immunostaining (blue) and RFP expression (red) alone, as well as the merged images, of the pouch tissues from haltere imaginal discs of LAE-RFP third-instar larvae carrying flip-out clones over-expressing either Dll (A–A′″), Rn (B–B″′) and Dll plus Rn (C–C″′), are shown. Flip-out clones (GFP+) were induced by a single heat shock in second or third instar larvae (see Materials and methods). Contrary to mosaic larvae carrying haltere pouch cells expressing either Dll or Rn alone, respectively, most of the clones (some are indicated by arrows) over-expressing both Dll and Rn cell-autonomously up-regulate bab2 and LAE-RFP expression, indicating a functional synergism between these transcription factors.

https://doi.org/10.1371/journal.pgen.1003581.g008

Discussion

In this report, we have characterized a 567-bp-long evolutionarily-conserved enhancer element ensuring bab2 expression in distal leg and antennal epithelial cells, from larval to adult stages. In contrast to the view that enhancer redundancy be a rule of thumb for developmental genes [38], our rescue experiments indicate that this single CRM isolated from 150 kb of the bric-a-brac locus is both necessary and sufficient to reliably govern gene expression in distinct limb morphogenetic fields. Further, we have shown that (i) the LAE regulatory activity is under the direct control of Dll, (ii) full expression in proximal-most rings depends on the direct binding of Rn, and (iii) each transcription factor interacts with a single critical binding site. Lastly, joint mis-expression of both Dll and Rn is sufficient to ectopically up-regulate endogenous bab2 as well as LAE-RFP expression in wing and haltere cells.

Leg versus antennal bab2 regulation

The Drosophila leg and antenna are thought to be homologous structures evolved from a common ancestral appendage, as shown by leg-to-antenna or antenna-to-leg transformations caused by mis-expression of P-D patterning or homeotic genes [16], [22], [39]–[42]. To our knowledge, bab2 is the first example of a developmental gene for which a single transcriptional enhancer is shown to be both necessary and sufficient to accurately ensure a complex gene expression pattern in distinct limb morphogenetic fields. As none of our mutated LAE constructs specifically affected antennal or leg expression, our findings thus support the idea that an ancestral P-D genetic cascade emerged before limb diversification in insects.

LAE comprises separate signal specificity and intensity booster regions

bab2 expression in developing leg and antennal discs is dynamic and complex, going from broad regional expression at early L3 stage to precisely positioned rings, and later on, to graded expression at pupal and adult stages [17]–[19]. Limb-specific regulation occurs through the 230-bp-long 5′ half of the LAE, which integrates positive inputs from both Dll and Rn transcription factors, whereas the 327-bp-long 3′ half appears to be required for signal amplification to confer robust expression, but is unable alone to drive any GFP-reporter expression. The presence of this signal intensity “booster” could explain the apparent lack of shadow enhancer [38], as indicated by our phenotypic rescue experiments (Figure 2). Conversely, the 26B15 BAC construct partially rescues the bab mutant abdominal pigmentation defects (Figure S3), suggesting it may contain a shadow enhancer to assist the abdominal cis-regulatory elements identified previously within the bab1 transcription unit (i.e., excluded from the 26B15 BAC; see Figure S3) [27]. Even though we cannot formally exclude that the bab locus includes a remote secondary enhancer assisting the LAE in other environmental or genetic backgrounds, our data suggest that a single locus can harbor both partially-redundant (abdominal) and “master” (limb) tissue-specific transcriptional enhancers with distinct functional constraints.

The Dll protein is a necessary, but not sufficient, general limb-specific bab2 activator

In this study, we have established that bab2 is a direct target of the Dll homeodomain-containing transcription factor, acting through at least the critical AAATTAATGGTAAT composite binding site present in the CR1 sequence (Figure 9A). Interestingly, similar A/T-rich Dll binding sites are also present in enhancers of ss and dac (i.e., AATTTAATGGTAAA and AAATTATATTTAAT, respectively), two other direct Dll target genes [15], [23], suggesting a conserved CRM grammar for Dll-regulated genes. Although Dll protein is expressed throughout the larval, pupal and adult stages, onset of bab2 expression starts only at the early-mid L3 stage, in the form of a circular domain within the Dll-expressing distal territory (Figure 9B) [19]. Consistently, we have shown that the Dll transcription factor is required but not sufficient for cell-autonomous bab2 expression (Figure 8A). In addition to the critical CR1 TAAT-rich sequence, we have shown that Dll protein also binds strongly in-vitro to the other HD-binding sites (Figure 5B). It is thus formally possible that the Dll transcriptional activator may contribute to the signal intensity “booster” effect of the LAE 3′-half (Figure 9A). However, signal boosting sequences situated in the middle of the LAE (i.e., between positions 231–478; see Figure 3) do not contain TAAT motifs, indicating that at least one other activating transcription factor is involved. In conclusion, in addition to Dll, characterization of new TF(s) interacting with LAE 3′-half sequences may help to better understand CRM activity, both in terms of tissue specificity and expression enhancement.

thumbnail
Download:
Figure 9. A model for spatio-temporal bab2 regulation during distal limb development.

(A) LAE functional organization. Relevant cis-regulatory features are delineated beneath the DNA stretch. Within the 5′-half, critical for distal-limb specificity, key regions required for ring activation and inter-ring repression are shown as green and red lines, respectively. The 3′-half, which is only required for high level of expression (signal amplifier or “booster”), is depicted as an orange line. The binding sites for the direct bab2 regulators Dll and Rn (in grey and light green, respectively) as well as for an unknown factor (X, in dark green) required for normal distal-most ring expression level, are indicated by vertical arrows. (B) A model for spatio-temporal regulation of bab2 gene during third-instar larval (L3) stage in antennal (ant) and leg imaginal discs (see main text for details).

https://doi.org/10.1371/journal.pgen.1003581.g009

Rotund protein: a proximal-specific intermediate between spineless and bab2?

The specific requirement for rotund activity in bab2 proximal regulation contrasts with data reported in St-Pierre et al. [34], showing apparently normal bab2 expression in rn mutant leg discs. However, although a large bab2-expressing ring does indeed appear in mid L3 rn mutant larvae, the mature 4-ring pattern never emerges later on, and instead two presumably-distal rings are detected at late L3 stage (not shown). For the first time, we report that ectopically-expressed Rn protein is sufficient to activate and maintain bab2 throughout the Dll expression domain, in both developing leg and antenna (Figure 7C). In light of the dependence of rn expression in leg ts1–3 tissues on ss activity [9], our data may provide a rationale for why ss activity is required in proximal bab2 regulation [19]. Moreover, Dll and Rn transcriptional activators, that are both necessary for full bab2 expression in leg and antennal proximal-most ring cells, are also jointly sufficient to ectopically activate bab2 (and LAE-RFP reporter) expression in wing and haltere but not in eye tissues, thus forming a context-specific instructive couple. The molecular basis of their functional synergy remains to be deciphered. Furthermore, in the proximal bab2-expressing domain, Dll and Rn are likely to function together with additional, still-unknown activators binding to LS4–5 and LS8 sequences (Figures 4B and S4B), and whose identification will certainly provide insights into the tissue specificity of the LAE.

Molecular bases for transient activity of Rn on bab2 expression in developing leg?

Rotund transcription factor is required for proximal bab2 expression in both legs and antennae. However, unlike antenna, rn (and spineless) expression is transient in leg tissues. In addition to their previously described roles in ts1–3 growth [9], [33], we propose that transiently-expressed ss and rn counteract repressive activities of dac and/or bowl, both of which are dynamically expressed during the critical L3 stage [9], [25]. In fact, de Celis and Bray [25] anticipated that a transiently-expressed bab2 activator should be present to relieve transient repression by bowl. Consistent with this view, ss activity represses bowl (and dac) expression [25], [33], in addition to its role in rn activation. As bowl (and dac) expression has decayed in the tarsal cells which earlier transiently expressed ss and rn, maintenance of bab2 expression would no longer require Rn activity. Maintenance of antennal Rn (and Ss) expression may in fact counteract additional bab2 repressors whose expression persists throughout development, such as hth and spalt (Figure 9B) [19]. Identification of repressive elements within the LAE will help address these issues. None of 16 different LAE reporter constructs displayed detectable de-repression in the proximal- and distal-most territories, suggesting thus the existence of functionally-redundant repressive DNA elements or alternatively of a competition between transcriptional repressors and activators for binding to the same sites. Of note, site-directed mutagenesis identified a leg inter-ring repression element (LS1 motif) at the CR1 3′-end. Inter-ring repression has been linked to Notch signalling [25]. However, the absence of putative Su(H) binding sites from the LAE sequence suggests that Notch-mediated repression is likely to be indirect. As the LS1 repressive motif is precisely located in the immediate vicinity of the critical composite HD-binding site (Figure 9A), competitive binding processes may well operate between Dll and LS1-bound repressor(s). Whatever the nature of the latter, a functional link with Dac, a non-specific DNA binding protein known to function as part of a multi-protein complex [43], certainly will deserve to be investigated.

A model for bab2 regulation in developing limbs

Our findings, coupled with results of previous studies [19], allow us to propose a model for distal limb-specific bab2 regulation (Figure 9). bab2 expression starts during the early-mid L3 stage at about 84 hours (hr) after egg laying (AEL) as a circular domain nested within the earlier-initiated Dll expression domain [44]–[46]. Our data indicate that Dll is required but not sufficient to activate bab2. We suppose that a hypothetical distal activator (X) binding to CR2 (Figure 9A) may contribute to the onset of bab2 expression. In response to EGFR signalling, bab2 down-regulation in the distal-most leg territory occurs in mid L3 tissues (at ∼90–96 hr AEL), giving rise to a single large ring (Figure 9B, depicted in dark green). Note that EGFR-mediated bab2 repression has not been yet described in the distal antenna. From about the same stage, as rotund expression starts (∼84–96 hr AEL), a second ring emerges proximally, both in the antenna and the leg tissues (Figure 9B, light green). By late L3 stage (120 hr AEL), bab2 expression consists of two well-separated rings in the developing antenna and of four concentric rings of distinct intensities in the developing leg. The two proximal-most rings (light green), depending on transient Rn activity, and the two distal-most rings (dark green) emerge both by tarsal growth and inter-ring down-regulation (through at least the LS1-binding repressor). Of note, rotund activity is indirectly required for the appearance of the two distal-most rings, due to its role in ts3 growth [9]. Lastly, in the developing leg, precise ring positioning depends on repression by EGFR and Notch signalling [21], [24], the molecular bases for their action remaining to be deciphered.

LAE is under strong evolutionary constraints among Drosophilidae and beyond

The LAE identified in the present work is systematically located between bab1 and bab2 transcription units of 22 Drosophilidae species for which the entire bab locus sequence is available (not shown). This suggests strong topological constraints during evolution. As (i) the duplicated bab genes are merely co-expressed during leg and antennal development [17], (ii) we have shown a critical role of the LAE in ensuring bab2 expression (this study) and (iii) no other limb-specific cis-regulatory regions could be identified within the 150-kb bab locus [27], we thus infer that the LAE is likely to reliably govern bab1 expression as well. Consistent with our assumption that strong functional constraints have operated during evolution, a LAE-like sequence with partially conserved CR1-2 sequences is even present between paralogous bab1 and bab2 genes of the tsetse fly Glossina morsitans (Figure S5A and not shown), which diverged from Drosophilidae about 260 million years ago [47]. Furthermore, we have shown that the LAE from D. virilis ensures normal regulatory functions in D. melanogaster. Although strongly conserved among Sophophora subgenus species (i.e. D. melanogaster group), the T13 Rn-binding site is poorly conserved in D. virilis and related Drosophila subgenus species (Figure S5B). It is formally possible that Rn has been co-opted recently in the Sophophora subgenus. Alternatively, D. virilis Rn could act through subgenus-specific LAE sequences. Consistent with this hypothesis, a T13-related sequence, only conserved among Drosophila subgenus species, is located between CR1-2 (Figure S5B). Investigating the molecular basis of Rn action in the positive regulation of bab2 may provide an entry point to tackle these evolutionary issues.

Materials and Methods

Fly stocks, culture and genetic manipulations

Drosophila lines were grown on standard yeast extract-sucrose medium. The vasa-PhiC31 ZH2A attP stock was kindly provided by F. Karch and was used to generate most of the transgenic GFP and RFP reporters and the two P[acMan] BAC constructs. rn or Dll mutant clones were generated by 30 minute (mn) heat shocks at 38°C, in early first- to late second-instar larvae of genotypes: (i) y w hsFlp; FRT82B Ub-GFP/FRT82B rn16 and (ii) y w hsFlp; arm-lacZ FRT42D/DllSA1 FRT42D, respectively. Flip-out clones over-expressing either Dll, Rn or both Dll plus Rn were generated by 40mn heat shocks at 38°C, in second- or third-instar larvae of genotypes: (i) y w LAE-RFP hsFlp; Pact>y+>Gal4, UAS-GFP/UAS-Dll, (ii) y w LAE-RFP hsFlp; Pact>y+>Gal4, UAS-GFP/UAS-Rn1 and (iii) y w LAE-RFP hsFlp; Pact>y+>Gal4, UAS-GFP/UAS-Dll UAS-Rn1, respectively. UAS-GFP.[S65T], UAS-Rn1 and rn-Gal4 lines were obtained from the Bloomington stock center. UAS-Dll and DllEM212-Gal4 line were provided by S. Cohen and M. Suzanne, respectively.

Reporter constructs, mutagenesis, BAC recombineering and germline transformation

Genomic DNA fragments from the D. melanogaster or D. virilis bab locus were amplified by standard PCR (using the following primer pairs: cccgaattcGCGCCTAACTAGCCAACAAT/cccggatCCTTTGACTCCGCTTTCGTCTTC and cccgaattcGAAACATCACGTTATCTAGCCACA/cccggatccAGAGTTGCTTGCACACACTCAC, respectively; BamHI and EcoRI restriction sites are underlined), cloned into pBP-S3aG, a home-made derivative of the attB-containing pS3aG plasmid obtained from T.M. Williams and S. Carroll [27]. Of note, the pBP-S3aG vector includes the TATA-less bab2 minimal promoter. The pLAE-RFP and pLAE-Bab2 plasmid constructs were made by substituting the GFP insert of the pLAE-GFP construct by a pH2B-RFP insert (obtained from A. Vincent) or a bab2 full-length cDNA (from pNB-bab2), respectively. Site-directed mutagenesis (including linker scanning) was performed by PCR, using the overlap extension method [48]. All constructs were sequence-verified. BAC recombineering and PhiC31-mediated germline transformation were performed as described [49]. The LAE was validated through insertions within several attP genomic sites, including the 2A platform on the X chromosome that was used for all constructs reported in this study.

LAE sequence identification and alignment

The genomic sequences homologous to the D. melanogaster LAE were recovered by Blat analysis at the UCSC Genome Browser website (http://genome.ucsc.edu/cgi-bin/hgBlat?command=start) and aligned with MAFFT (http://mafft.cbrc.jp/alignment/server/). The multiple alignment was then shaded with Boxshade (http://www.ch.embnet.org/software/BOX_form.html).

Immunofluorescence and image quantification

Third-instar larval imaginal discs were prepared and stained using standard procedures. Confocal analyses were done with a LEICA TCS SP5 microscope. Rat anti-Bab2 [17] and rabbit anti-Dll [50] antibodies were used at 1/2000 and 1/200, respectively. For each reporter construct, GFP fluorescence quantification was obtained from 10 distinct T2 leg and eye-antennal discs (i) dissected from late third-instar larvae grown in the same environmental conditions (temperature and larval density), and then (ii) fixed in the same conditions. Confocal images were analyzed with ImageJ software, using the same area (centered on the distalmost ring of cells), laser excitation settings (75% maximal detection) and brightness/contrast image acquisition.

In-vitro translation and electrophoretic mobility-shift assay

Dll and Rn proteins were synthesized by coupled in-vitro transcription/translation with T7 RNA polymerase and rabbit reticulocyte lysate (TNT assay, Promega). pET-Dll and pCS2-MycRn plasmid constructs were obtained from S. Cohen and P. Couso, respectively. EMSA experiments were performed mainly as described [51], using Novex 6% DNA retardation gels (InvitroGene). Probes were assembled from synthetic oligonucleotides including 4 additional G bases at their 5′-ends, labeled with the Klenow fragment of E. coli DNA polymerase I in presence of [α-32P]dCTP, and purified on mini Quick spin columns (Roche). Specific activities were roughly similar for all tested probes. Free and shifted probes were revealed with a PhosphorImager.

Supporting Information

Figure S1.

GFP-reporter constructs recapitulating leg and antennal bab2 expression. Leg (A–F) and antennal (ant) (G–L) imaginal discs from late third-instar larvae expressing GFP-reporter constructs (depicted in the left side) shown in Figure 1. GFP expression (green) alone and combined with Bab2 immunostaining (red) are shown for each construct (A–L and A′–L′, respectively). The reporter constructs encompassing the 1.5 kb-long BP47/42 overlapping region, including the 1.5 kb genomic fragment in isolation (construct #7), all faithfully drove limb-specific bab2 expression.

https://doi.org/10.1371/journal.pgen.1003581.s001

(TIF)

Figure S2.

LAE sequence alignment from 22 Drosophila species. The genomic sequences homologous to the D. melanogaster LAE were recovered by Blat analysis at the UCSC Genome Browser website (http://genome.ucsc.edu/cgi-bin/hgBlat?command=start) and aligned with MAFFT (http://mafft.cbrc.jp/alignment/server/). The multiple alignment was then shaded with Boxshade (http://www.ch.embnet.org/software/BOX_form.html). The large (>20 bp) highly-conserved regions (CR1–3) are framed. Notice that D. mojavensis and D. willistoni LAE sequences have long inserts (1–2 kb) between the CR2 and CR3 regions.

https://doi.org/10.1371/journal.pgen.1003581.s002

(PDF)

Figure S3.

The 26B15 BAC partially rescues bab mutant abdominal phenotypes, independently of the LAE. (A) The 150-kb bab locus is shown (see Figure 1A). The position of the bab2-containing 26B15 BAC (in blue) used for phenotypic rescue experiments is indicated, with the internal LAE depicted as a red box. The positions of the two abdominal-specific cis-regulatory elements, within the bab1 transcription unit, are indicated as yellow boxes. (B) Dorsal views of female abdomens from the wild-type (C) and babAR07 heterozygous, carrying none (D) or a 26B15 BAC construct copy either unmodified (E) or LAE-deleted (F), are shown. Whereas pigmentation of wild-type abdominal tergites on segment A2–6 is limited to posterior stripes, females carrying a single babAR07 allele display nearly fully-pigmented A5–6 segments, evoking male-specific pigmentation. For the A5–6 segments of each genotype, pigmentation extends toward the anterior are indicated by solid bars. The bab mutant pigmentation defects are partially rescued in females carrying either an unmodified or a LAE-deleted 26B15 BAC construct.

https://doi.org/10.1371/journal.pgen.1003581.s003

(TIF)

Figure S4.

A linker-scanning mutagenesis of the critical CR1 region reveals functionally relevant motifs. (A) The sequences of the wild-type and of each mutated CR1 sub-region are shown in beneath the entire LAE structural organization, as determined by evolutionary conservation among Drosophilidae (Figure S2). For each of the eight mutated constructs, the inserted linker sequence (AGCTAGCA) is italicized with nucleotide substitutions depicted in red. Positively- or negatively-acting elements are framed in green or red, respectively, dashed lines indicating partially redundant functions. (B) Leg (C–G) and antennal (ant) (H–L) imaginal discs from late third-instar larvae, expressing either the unmodified LAE-GFP construct or one out of its four LS-mutated derivatives not shown in Figure 4. GFP fluorescence emission (green) in isolation and in combination with Bab2 immunostaining (red) (C–L and C′–L′, respectively), are shown.

https://doi.org/10.1371/journal.pgen.1003581.s004

(TIF)

Figure S5.

LAE sequences have been conserved among Dipterans. (A) Sequence conservation of the limb-specificity LAE portion among Drosophilidae and in the Glossinidae Glossina morsitans. G. morsitans LAE-like sequence was identified though blast analyses using the Trace archive nucleotide blast server at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and aligned with LAE sequences from representative Drosophilidae species, using MAFFT (http://mafft.cbrc.jp/alignment/server/index.html). Homology shading was made using BoxShade (http://www.ch.embnet.org/software/BOX_form.html). The CR1-2 sequences are framed and locations of the Rn and Dll binding sites are indicated above the alignment. Note that the Rn binding site is poorly conserved. (B) Sequence conservation of the CR1-encompassing LAE portion among Sophophora and Drosophila subgenera. Sequences were aligned and processed as above. The structural organization scheme of the entire D. melanogaster (Sophophora subgenus) and D. virilis (Drosophila subgenus) LAE sequences are shown in the middle part, with the aligned portions depicted with broken lines. The T13 Rn-binding site of D. melanogaster and the T13-like sequence of D. virilis are well conserved among Sophophora and Drosophila subgenus species, respectively (T-rich sequences are underlined). Note that the T13-like D. virilis sequence is located (i) in a 3′-end extended CR1 and (ii) in an inverted orientation.

https://doi.org/10.1371/journal.pgen.1003581.s005

(TIF)

Acknowledgments

We thank T. Kojima, G. Campbell, G. Boekhoff-Falk, S. Cohen, N. Gompel, T.M. Williams, S. Carroll, P. Couso, M. Suzanne, A. Vincent, F. Laski and the Bloomington Stock Center for fly stocks and reagents, and the Developmental Studies Hybridoma Bank (DSHB) at the University of Iowa for antibodies. We are grateful to A. Vincent, S. Plaza, M. Crozatier and C. Immarigeon for discussions and helpful suggestions on the manuscript or during the course of this work. We thank S. Bernat-Fabre and J. Favier for technical assistance, as well as C. Faucher and O. Bardot for their contributions to this project. Lastly, we acknowledge the Toulouse RIO Imaging platform.

Author Contributions

Conceived and designed the experiments: DLC MB H-MB. Performed the experiments: AB LHM-V GD. Analyzed the data: AB LHM-V GD MB H-MB. Contributed reagents/materials/analysis tools: AB LHM-V DLC J-LC. Wrote the paper: MB H-MB.

References

  1. 1. Levine M, Tjian R (2003) Transcription regulation and animal diversity. Nature 424: 147–151.
  2. 2. Levine M (2010) Transcriptional enhancers in animal development and evolution. Curr Biol 20: R754–763.
  3. 3. Lagha M, Bothma JP, Levine M (2012) Mechanisms of transcriptional precision in animal development. Trends Genet 2012: 16.
  4. 4. Couso JP, Bishop SA (1998) Proximo-distal development in the legs of Drosophila. Int J Dev Biol 42: 345–352.
  5. 5. Estella C, Voutev R, Mann RS (2012) A dynamic network of morphogens and transcription factors patterns the fly leg. Curr Top Dev Biol 98: 173–198.
  6. 6. Galindo MI, Couso JP (2000) Intercalation of cell fates during tarsal development in Drosophila. Bioessays 22: 777–780.
  7. 7. Kojima T (2004) The mechanism of Drosophila leg development along the proximodistal axis. Dev Growth Differ 46: 115–129.
  8. 8. Morata G (2001) How Drosophila appendages develop. Nat Rev Mol Cell Biol 2: 89–97.
  9. 9. Natori K, Tajiri R, Furukawa S, Kojima T (2012) Progressive tarsal patterning in the Drosophila by temporally dynamic regulation of transcription factor genes. Dev Biol 361: 450–462.
  10. 10. Abu-Shaar M, Mann RS (1998) Generation of multiple antagonistic domains along the proximodistal axis during Drosophila leg development. Development 125: 3821–3830.
  11. 11. Diaz-Benjumea FJ, Cohen B, Cohen SM (1994) Cell interaction between compartments establishes the proximal-distal axis of Drosophila legs. Nature 372: 175–179.
  12. 12. Lecuit T, Cohen SM (1997) Proximal-distal axis formation in the Drosophila leg. Nature 388: 139–145.
  13. 13. Wu J, Cohen SM (1999) Proximodistal axis formation in the Drosophila leg: subdivision into proximal and distal domains by Homothorax and Distal-less. Development 126: 109–117.
  14. 14. Estella C, McKay DJ, Mann RS (2008) Molecular integration of wingless, decapentaplegic, and autoregulatory inputs into Distalless during Drosophila leg development. Dev Cell 14: 86–96.
  15. 15. Giorgianni MW, Mann RS (2011) Establishment of medial fates along the proximodistal axis of the Drosophila leg through direct activation of dachshund by Distalless. Dev Cell 20: 455–468.
  16. 16. Dong PD, Chu J, Panganiban G (2000) Coexpression of the homeobox genes Distal-less and homothorax determines Drosophila antennal identity. Development 127: 209–216.
  17. 17. Couderc JL, Godt D, Zollman S, Chen J, Li M, et al. (2002) The bric à brac locus consists of two paralogous genes encoding BTB/POZ domain proteins and acts as a homeotic and morphogenetic regulator of imaginal development in Drosophila. Development 129: 2419–2433.
  18. 18. Godt D, Couderc JL, Cramton SE, Laski FA (1993) Pattern formation in the limbs of Drosophila: bric a brac is expressed in both a gradient and a wave-like pattern and is required for specification and proper segmentation of the tarsus. Development 119: 799–812.
  19. 19. Chu J, Dong PD, Panganiban G (2002) Limb type-specific regulation of bric a brac contributes to morphological diversity. Development 129: 695–704.
  20. 20. Campbell G, Tomlinson A (1998) The roles of the homeobox genes aristaless and Distal-less in patterning the legs and wings of Drosophila. Development 125: 4483–4493.
  21. 21. Galindo MI, Bishop SA, Greig S, Couso JP (2002) Leg patterning driven by proximal-distal interactions and EGFR signaling. Science 297: 256–259.
  22. 22. Duncan DM, Burgess EA, Duncan I (1998) Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes Dev 12: 1290–1303.
  23. 23. Duncan D, Kiefel P, Duncan I (2010) Control of the spineless antennal enhancer: direct repression of antennal target genes by Antennapedia. Dev Biol 347: 82–91.
  24. 24. Campbell G (2002) Distalization of the Drosophila leg by graded EGF-receptor activity. Nature 418: 781–785.
  25. 25. de Celis Ibeas JM, Bray SJ (2003) Bowl is required downstream of Notch for elaboration of distal limb patterning. Development 130: 5943–5952.
  26. 26. Greenberg L, Hatini V (2009) Essential roles for lines in mediating leg and antennal proximodistal patterning and generating a stable Notch signaling interface at segment borders. Dev Biol 330: 93–104.
  27. 27. Williams TM, Selegue JE, Werner T, Gompel N, Kopp A, et al. (2008) The regulation and evolution of a genetic switch controlling sexually dimorphic traits in Drosophila. Cell 134: 610–623.
  28. 28. Bischof J, Maeda RK, Hediger M, Karch F, Basler K (2007) An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci U S A 104: 3312–3317.
  29. 29. Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, et al. (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450: 203–218.
  30. 30. Venken KJ, Carlson JW, Schulze KL, Pan H, He Y, et al. (2009) Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. Nat Methods 6: 431–434.
  31. 31. Kozu S, Tajiri R, Tsuji T, Michiue T, Saigo K, et al. (2006) Temporal regulation of late expression of Bar homeobox genes during Drosophila leg development by Spineless, a homolog of the mammalian dioxin receptor. Dev Biol 294: 497–508.
  32. 32. Noyes MB (2012) Analysis of specific protein-DNA interactions by bacterial one-hybrid assay. Methods Mol Biol 786: 79–95.
  33. 33. Pueyo JI, Couso JP (2008) The 11-aminoacid long Tarsal-less peptides trigger a cell signal in Drosophila leg development. Dev Biol 324: 192–201.
  34. 34. St Pierre SE, Galindo MI, Couso JP, Thor S (2002) Control of Drosophila imaginal disc development by rotund and roughened eye: differentially expressed transcripts of the same gene encoding functionally distinct zinc finger proteins. Development 129: 1273–1281.
  35. 35. Torrungruang K, Alvarez M, Shah R, Onyia JE, Rhodes SJ, et al. (2002) DNA binding and gene activation properties of the Nmp4 nuclear matrix transcription factors. J Biol Chem 277: 16153–16159 Epub 12002 Feb 16126.
  36. 36. Struhl G, Basler K (1993) Organizing activity of wingless protein in Drosophila. Cell 72: 527–540.
  37. 37. Gorfinkiel N, Morata G, Guerrero I (1997) The homeobox gene Distal-less induces ventral appendage development in Drosophila. Genes Dev 11: 2259–2271.
  38. 38. Perry MW, Boettiger AN, Levine M (2011) Multiple enhancers ensure precision of gap gene-expression patterns in the Drosophila embryo. Proc Natl Acad Sci U S A 108: 13570–13575.
  39. 39. Casares F, Mann RS (1998) Control of antennal versus leg development in Drosophila [see comments]. Nature 392: 723–726.
  40. 40. Cummins M, Pueyo JI, Greig SA, Couso JP (2003) Comparative analysis of leg and antenna development in wild-type and homeotic Drosophila melanogaster. Dev Genes Evol 213: 319–327.
  41. 41. Pai CY, Kuo TS, Jaw TJ, Kurant E, Chen CT, et al. (1998) The Homothorax homeoprotein activates the nuclear localization of another homeoprotein, extradenticle, and suppresses eye development in Drosophila. Genes Dev 12: 435–446.
  42. 42. Struhl G (1981) A homoeotic mutation transforming leg to antenna in Drosophila. Nature 292: 635–638.
  43. 43. Chen R, Amoui M, Zhang Z, Mardon G (1997) Dachshund and eyes absent proteins form a complex and function synergistically to induce ectopic eye development in Drosophila. Cell 91: 893–903.
  44. 44. Cohen SM, Bronner G, Kuttner F, Jurgens G, Jackle H (1989) Distal-less encodes a homoeodomain protein required for limb development in Drosophila. Nature 338: 432–434.
  45. 45. Cohen SM, Jürgens G (1989) Proximal-distal pattern formation in Drosophila: cell autonomous requirement for Distal-less gene activity in limb development. EMBO J 8: 2045–2055.
  46. 46. Cohen SM (1990) Specification of limb development in the Drosophila embryo by positional cues from segmentation genes. Nature 343: 173–177.
  47. 47. Liu R, Lehane S, He X, Lehane M, Hertz-Fowler C, et al. (2010) Characterisations of odorant-binding proteins in the tsetse fly Glossina morsitans morsitans. Cell Mol Life Sci 67: 919–929.
  48. 48. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77: 51–59.
  49. 49. Venken KJ, He Y, Hoskins RA, Bellen HJ (2006) P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314: 1747–1751.
  50. 50. Panganiban G, Sebring A, Nagy L, Carroll S (1995) The development of crustacean limbs and the evolution of arthropods. Science 270: 1363–1366.
  51. 51. Gebelein B, McKay DJ, Mann RS (2004) Direct integration of Hox and segmentation gene inputs during Drosophila development. Nature 431: 653–659.
  52. 52. Noyes MB, Christensen RG, Wakabayashi A, Stormo GD, Brodsky MH, et al. (2008) Analysis of homeodomain specificities allows the family-wide prediction of preferred recognition sites. Cell 133: 1277–1289.