Advertisement

  • Loading metrics

Open Access

Correction

Correction: Kinesin-1 promotes chondrocyte maintenance during skeletal morphogenesis

  • Adrian Santos-Ledo,
  • Marina Garcia-Macia,
  • Philip D. Campbell,
  • Marta Gronska,
  • Florence L. Marlow
  • Article
  • Metrics
  • Comments
  • Media Coverage

In Table 1, the incorrect primer sequences are shown for bip-F and bip-R. The sequence for bip-F should read bip-F: AGTGATTGGGATCGACCTTG and the sequence for bip-R should read bip-R: AGCTGGATGTGAGGCTTGTT. Please see the corrected Table 1 here.

thumbnail
Download:
Table 1. Primers used in this work.

https://doi.org/10.1371/journal.pgen.1007099.t001

Reference

  1. 1. Santos-Ledo A, Garcia-Macia M, Campbell PD, Gronska M, Marlow FL (2017) Kinesin-1 promotes chondrocyte maintenance during skeletal morphogenesis. PLoS Genet13(7): e1006918. pmid:28715414

Citation: Santos-Ledo A, Garcia-Macia M, Campbell PD, Gronska M, Marlow FL (2017) Correction: Kinesin-1 promotes chondrocyte maintenance during skeletal morphogenesis. PLoS Genet 13(11): e1007099. https://doi.org/10.1371/journal.pgen.1007099

Published: November 15, 2017

Copyright: © 2017 Santos-Ledo et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.