Ethics statement

Housing, feeding and animal care followed the national ethical standards established in the writ of February 1st, 2013 (NOR: AGRG1238753A) setting the conditions for approval, planning and operation of establishments, breeders and suppliers of animals used for scientific purposes and controls. The French Ministère de l’Agriculture et de la Pêche and French Ministère de l’Éducation Nationale de la Recherche et de la Technologie provided permit A 66040 to our laboratory for experiments on animals and certificate for animal experimentation (authorization 007083, decree 87–848) for the experimenters.

Animal breeding and preparation of parasites

The S. mansoni strain SmBre, originally sampled in Brazil was used in this study. The strain was maintained in its sympatric intermediate host strain BgBRE of the mollusk Biomphalaria glabrata, and Mus musculus as definitive vertebrate host. Cercariae were collected from infected snails 30 days after infection by pipetting from spring water and sedimentation on ice. For isolation of adults, infected mice were killed after 60 days of infection by a lethal intraperitoneal injection of sodium pentobarbital, and adult worms were recovered by retrograde perfusions of the hepatic portal system with citrate (7.5%) saline (8.5%) solution administrated through the left ventricle [19]. Worms trapped in the liver or mesenteric system were collected after excising these organs.

In-vitro transformation of cercariae to schistosomula was done as described before [20]. The shells of infected snails were cleaned to remove rotifers, transferred to de-chlorinated water (about 75 mL for 10 snails), and exposed to a light source (60 W) for two hours in order to promote cercariae emission. Cercariae were gently collected with a 1 mL micro-pipet previously moistened, avoiding snail feces and mucus. They were transferred to a sterile 50 mL conical tube and placed on ice in the dark. After 30 minutes, cercariae were concentrated by centrifugation (400×g/10 minutes/4°C) and the supernatant was removed, leaving 5 mL of liquid. Five milliliters of phosphate buffered saline, supplemented with 200 U/mL of penicillin and 200 μg/mL of streptomycin (PBS-PS) were added and put at 37°C. The tails of cercariae were sheared by vortexing at maximum speed during one minute and subsequently centrifuged (400×g/1 minute/4°C). All further handling was done under sterile conditions. The supernatant, containing only tails, was completely removed and discarded. The pellet was resuspended in 2 mL PBS-PS. Schistosomula were separated from tails by centrifugation along a gradient of polyvinylpyrolidone-coated colloidal silica particles (Percoll) [21] prepared in 15 mL conical tubes (6 mL of the Percoll [Sigma, P4937], 1 mL 10 fold PBS, 0.25 mL 100 mM HEPES, 0.25 mL penicillin/streptomycin, 2.5 mL sterile water). One milliliter of the schistosomula suspension was applied to each column without disturbing the surface of the Percoll gradient. The preparation was centrifuged at 450×g for 10 minutes, with weakest possible brake. The top layer containing the tails was removed, and the pellet containing schistosomula was resuspended and washed twice in 10 mL of Dulbecco's modified Eagle's medium (DMEM) with 200 U/mL of penicillin, 200 μg/mL of streptomycin and 10 mM HEPES at 37°C (centrifugation 400×g/1 minute/4°C). Finally, schistosomula were resuspended in modified Basch's medium without antimycotics [20,22] and maintained at 37°C under 5% CO₂ for 21 hours.

RNA extraction and reverse transcription, quantitative PCR, and native chromatin immunoprecipitation

As the genome annotation of S. mansoni has mostly been done through prediction software, we performed RNA-Seq on cercariae to unambiguously identify TSS and exon-intron structures. Since published RNA extraction protocols for cercariae did not yield RNA suitable for Illumina sequencing, we developed the following method: 5,000 cercariae were ground with glass beads in liquid nitrogen for 5 minutes, resuspended in 0.5 mL TRIzol (Invitrogen), and 0.1 mL of chloroform was added. The tube was shaken vigorously for 1 minute and left at room temperature for 3 minutes, and was then centrifuged at ≥12,000×g for 15 minutes at 4°C. The upper phase was transferred to a new RNase-free tube, an equal volume of 70% ethanol was added and the tube was vortexed. PureLink RNA Mini kit (Ambion, 12183020) was used for further purification following the manufacturer’s protocol. RNA was recovered in 30 μL RNAsecure (Ambion, AM7006), left for 1 minute at room temperature, collected by centrifugation for 1 minutes at 8,000xg at room temperature and incubated at 65°C for 10 minutes. To remove remaining DNA, 3 μL of 10X TURBO DNase Buffer (TURBO DNA-free, Ambion, M1907) were added to 30 μL of total RNA in RNAsecure, followed by 3 μL of TURBO DNase (2 Units/μL). The preparation was gently mixed and incubated at 37°C for 30 minutes. DNase was removed with an RNA Clean-up system (RNeasy mini kit, QIAGEN, 74104) and eluted in 30 μL RNase-free water. For schistosomula, total RNA extraction, DNase treatment and purification methods were adapted from the protocol described above. 500 ng of this purified total RNA were reverse transcribed using identical concentrations (250 nmol/L) of random hexamers and oligo(dT)₁₈ primers of Maxima H Minus Reverse Transcriptase kit (ThermoSCIENTIFIC). Quantitative PCR was performed using a LightCycler 480 System (Roche Diagnostics). We used 2.5 μL of cDNA (diluted 1/10 in water) in a total volume of 10 μL containing 1X LightCycler 480 SYBR Green I Master Mix (Roche Diagnostics) and 500 nmol/L of each primer. To ensure that a single product was generated, we separated amplification products on a Labchip GX DNA assay system (PerkinElmer). For each studied stage, the level of mRNA was normalized using the mean geometric transcription rate of three reference sequences (Smp_093230, Smp_197220 and Smp_089880) previously described by Wang and colleagues [23]. mRNA of Smp_034000 was measured using primers Smp034000.2F: GCGTGCTGTGGAGGAAAGCGA and Smp034000.2R: ACGCAGACAGGGCATCGTCA. The normalized relative quantities (NRQs) were calculated as described by Hellemans and colleagues [24], using equation 1 where E_target is the amplification efficiency of the gene of interest; E_ref is the amplification efficiency of the reference gene; ΔC_p,ref = C_p,ref(calibrator)–C_p,ref(sample); and ΔC_p,target = C_p,target(calibrator)–C_p,target(sample). For each reaction, the crossing point (Cp) was determined using the second derivative maximum method applied using Light Cycler Software version 3.3 (Roche Diagnostics). Male cercariae were arbitrarily chosen as calibrator. We obtained male cercariae by infecting host mollusk B. glabrata strain BgBre with single miracidium from SmBre strain. Sex determination was performed as described in [25]. Experiments were done in six biological replicates.

Native chromatin immunoprecipitation was done according to an earlier published protocol [26] and at least 1,500 cercariae, 2000 schistosomula or 1 adult couple using the following antibodies: H3K4me3 (Millipore, cat# 04–745 lot# NG1680351, 4 μL per reaction), H3K9Ac (Millipore, cat# 07–352 lot# DAM16924924, 8 μL per reaction), H3K9me3 (Abcam, cat# ab8898 lot# 733951, 4 μL per reaction), and H3K27me3 (Diagenode, cat# pAb-069-050 lot# A29900242, and cat# C15410069 lot# A1821D, 8 μL per reaction). For each sample, we used a control without antibody, to assess unspecific background (bound fraction) and input (unbound fraction). Inputs were used for normalization in all subsequent bioinformatics analyses. Experiments were done in duplicate. Antibodies were carefully tested for specificity as described in [27] and saturating quantities (see [27]) were used. Further details are available at http://methdb.univ-perp.fr/epievo/

Illumina library generation and sequencing

For ChIPseq library construction, the ChIP sample preparation kit (Illumina Inc., USA) was used according to the manufacturer's protocol except for the indexed adapters. Those adapters came from the Truseq DNA sample preparation kit (Illumina Inc., USA). Briefly, 30 ng of DNA per condition was blunt ended and adenylated on its 3' ends. Illumina's indexed adapters were ligated to both ends of the adenylated DNA. Ligated DNA was size separated by electrophoresis through a 2% agarose gel and a size selection was performed at 400 bp. Once extracted from the agarose, size selected DNA was enriched by 18 cycles of PCR for 10 seconds at 98°C, 30 seconds at 60°C and 30 seconds at 72°C using Illumina's proprietary primers and Phusion DNA polymerase (New England Biolabs Inc., USA). Each library was verified using a DNA 1000 Chip on a Bioanalyzer 2100, quantified by real time PCR with the KAPA Library Quantification Kit for Illumina Sequencing Platforms (Kapa Biosystems Ltd, SA) and then diluted to 10 nM.

RNAseq library construction was done with the TruSeq RNA Sample Seq kit (Illumina Inc., USA) according to the manufacturer's protocol. Briefly, poly-A containing mRNA molecules were purified from 70 to 450 ng of total RNA using oligo-dT magnetic beads. The purified mRNA was fragmented by addition of the fragmentation buffer and was heated at 94°C in a thermocycler for 8 minutes. First strand cDNA was synthesized using random primers. Second strand cDNA synthesis, end repair, A-tailing, and adapter ligation was done in accordance with the manufacturer's instructions. Purified cDNA templates were enriched by 15 cycles of PCR for 10 seconds at 98°C, 30 seconds at 65°C, and 30 seconds at 72°C using Illumina's proprietary primers and Phusion DNA polymerase. Each indexed cDNA library was verified using a DNA 1000 Chip on a Bioanalyzer 2100 and quantified by real time PCR with the KAPA Library Quantification Kit for Illumina Sequencing Platforms (Kapa Biosystems Ltd, SA) then diluted to 10 nM using Illumina's resuspension buffer.

For each lane of sequencing, four libraries (ChIPseq) or 6 libraries (RNAseq) were pooled in equimolar concentrations, denatured using 0.1N NaOH and diluted to a final concentration of 7 pM (ChIPseq) or 8 pM (RNAseq) using Illumina's HT1 buffer. 120 μL of the dilution was then transferred into a 200 μL strip tube and placed on ice before loading onto the cBot. The flow cell was clustered using Single Read Cluster Generation Kit (Illumina Inc., USA), according to the Illumina SR_amplification_Linearization_ Blocking_PrimerHyb recipe. The flow cell was loaded onto the Illumina HiSeq 2000 instrument following the manufacturer's instructions and sequencing was performed with the 50 cycles, single read, indexed protocol. Image analyses and base calling were performed using the HiSeq Control Software (HCS) and Real-Time Analysis component (RTA). Demultiplexing was performed using CASAVA (Illumina). The quality of the data was assessed using fastqc from the Babraham Institute and the Illumina software SAV (Sequence Analysis Viewer).

Illumina sequencing quality control, alignment and ChIP-Seq peak calling

All data treatment was carried out under a local galaxy instance [28](http://galaxy.univ-perp.fr). Fastq Groomer was used for verification of the fastqsanger format, and the FASTX-Toolkit (Compute quality statistics, Draw quality score boxplot, Draw nucleotides distribution chart) was used for initial quality control. Read quality was judged sufficiently good (the majority of reads showed a quality score ≥24 for all positions) and no further quality filter was applied.

For ChIP-Seq, reads were aligned to the S. mansoni reference genome, assembly version 5.0 (downloaded from ftp://ftp.sanger.ac.uk/pub/pathogens/Schistosoma/mansoni/genome/Assembly-v5/) using Bowtie2 [29] evoking parameters—sensitive-k 2. Mapping quality (mapq) in Bowtie2 is related to “uniqueness” of the read. The higher the quality score is, the lower is the probability that a read can map elsewhere in the genome. By filtering mapped reads with a score of 255 (the highest possible) in samtools [30] (samtools view-hS-q 255), we kept reads with a single match on the genome. In Bowtie 2.1 score 255 was abandoned and filtering of uniquely mapped reads was done with “samtools view-Sh-q quality value 40–42-F 0x0004 - | grep-v XS:i. “. SAM alignment files were converted into the bed format with pyicos [31] and sorted with sortBed-i of the bedtools suite [32]. For peak identification an equal number of random lines in the bed-file was chosen for each biological replicate (Table 1). Although comparative analysis software usually include a normalization step to handle the different numbers of mapped reads in conditions or replicates when comparing samples, we found that the random sampling step drastically reduces the amount of false positives without lowering the sensitivity. Mostly, this removes background peaks. Identification of peaks was done with ranger of Peakranger v1.16 [33] with P value cut off 0.0001, FDR cut off 0.01, Read extension length 200, Smoothing bandwidth 99 and Delta 1. We used the input samples as negative controls for the peakcalling (-c). For data visualization, wiggle files were generated and uploaded to a local GBrowse instance [34] (http://genome.univ-perp.fr).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Summary of next-generation sequencing data and analysis results.

https://doi.org/10.1371/journal.pntd.0003853.t001

ChIP-Seq results in adults and cercariae were verified by qPCR (primers in S1 Table) in 20 randomly chosen regions using the following conditions: denaturation 95°C for 10 seconds, annealing 60°C for 10 seconds, extension 72°C for 20 seconds, over 40 cycles. The kit used for the amplification is the LightCycler 480 SYBR Green 1 Master (Roche, 04887352001) and the instrument is a LightCycler 480 (Roche). To compare ChIP-Seq and qPCR results, coverage was calculated with coverageBed of the bedtools suite for the regions whose boundaries were defined by the corresponding qPCR primer positions and divided by the coverage in the alpha-tubulin reference locus (Smp_scaff000423:21,107–21,289). Spearman rank correlation gave values > 0.8, R2 was 0.64 for H3K4me3 and 0.59 for H3K27me3 indicating that both methods gave comparable results (S1 Fig).

For RNA-Seq, reads were aligned to the genome with TopHat v1.4.1 with default parameters and exon-intron structure was reconstructed with cufflinks v1.3.0 evoking-q-I 40000-F 0.100000-j 0.150000-p 8 on each library and data were merged and linked to the gene prediction of the Sanger Centre (ftp://ftp.sanger.ac.uk/pub/pathogens/Schistosoma/mansoni/genome/Assembly-v5/) with Cuffmerge v1.0.0 [35].

Comparative ChIP-Seq analysis

To identify peaks that were different between cercariae and adults, we used the DiffBind library 1.6.1 [36] available on Bioconductor [37] for R version 2.15.1. As input, we used the randomly sampled aligned reads that also served as inputs for PeakRanger and the regions file generated with PeakRanger, all in bed format. Diffbind allows for replicates and “input” negative control to be taken into account to search for differential peak distribution between conditions. For H3K9ac, PCR duplicates were removed with pyicos, which improved sample autocorrelation. For H3K4me3 all differences were inspected on GBrowse. For the other histone isoforms, one hundred regions identified by DiffBind were randomly sampled with a custom Perl script and verified by visual inspection. Average histone modification profiles around TSS were generated by doing a “window analysis” around the TSS of genes, using EpiChIP v0.9.7-e [38]. EpiChIP allows for generating genome-wide, average profiles for histone modifications at a given genomic feature (in our case, around the TSS for genes). For this purpose, we used the output file of Cuffmerge and selected only those 12,871 genes located on linkage groups that were assembled at the chromosome level. Chromosome names were converted in the input bed files into EpiChIP canonical names (“Chrnumber”) with a custom script. EpiChIP was also used to correlate transcription and histone modification, and to quantify the proportion of peaks that contribute significantly to the average profiles. Common peaks were detected from Peakranger region bed-files with multiIntersectBed of the BedTools package.

For the analysis of chromatin structure around repetitive sequences, reads were aligned to a fasta file containing all 3,145 known repeats of S. mansoni as consensus sequences (available http://methdb.univ-perp.fr/downloads/) [39] using Bowtie2 [29] evoking parameter–k 2 and parameter preset “sensitive”. Unique matches were filtered using samtools [30] (mapping quality mapq = 255). In order to obtain identical effective library sizes for each sample, the same number of aligned reads was randomly sampled for each of the ChIP experiments (Table 1). After the counts had been normalized, they were compared between samples using the DESeq package of the R software [40]. This package uses the negative binomial distribution to calculate the P-value for each element between two compared samples and find elements that present significant differences in their read enrichment levels.

In-situ detection of replication and transcription

For the detection of mRNA synthesis, cercariae were incubated in spring water at 28°C with a concentration of 1mM of 5-ethynyl-uridine (EU, Invitrogen Click-iT RNA Imaging Kit, MP10329) for 2, 18 h and 21 h. Freshly transformed schistosomula were grown in Basch medium at the same EU concentration in an incubator at 37°C and 5% CO₂, also for 2, 18, and 21 h. Labeling of replicating cells was performed in the exact same conditions, only substituting EU by a concentration of 10 mM of 5-ethynyl-2’-deoxyuridine (EDU, Invitrogen Click-iT DNA Imaging Kit, MP10337). Negative controls without the addition of 5-ethynyl-uridine (EU) and 5-ethynyl-2’-deoxyuridine (EDU) were also performed for every condition. Fixation, development and Hoechst 33342 coloration after incubation were performed following the protocols of the supplier. Imaging was done on a confocal microscope Zeiss LSM 700 at 488 nm (EU and EDU) and 405 nm (Hoechst 33342). For every condition, 100 animals were observed for transcription and replication.

Accession numbers

RNA-Seq and ChIP-Seq reads are available at the NCBI-SRA under study accession numbers SRP034587 (ChIP-Seq) and SRP035609 (RNA-Seq).

Chromatin landscape in S. mansoni cercariae and adults

To link transcription and chromatin structure, we considered the correct identification of the TSS as crucial. Anecdotal evidences had suggested that the available automatic annotation had missed a certain proportion of first exons and we decided to perform RNA-Seq with RNA extracted from cercariae. Indeed, our data showed that in about 20% of the genes, TSS had to be corrected. We then performed ChIP-Seq. For H3K4me3, we found relatively sharp peaks with a mean peak maximum located 250 bp (or 1–2 nucleosomes) downstream of the transcription start site (TSS) of genes (Fig 1A). We detected on average 7,746 peaks in cercariae and 8,868 peaks in adults (Table 1). For about ~24% of genes, EpiChIP identified transcripts but no significant H3K4me3 peaks (FDR = 0.01). Examples for genes that are free of H3K4me3 peaks are all known micro exon genes (MEGs) supplementary table S5.4 in [41] (Fig 2A), with the exception of Smp_163710 that shows small peaks in adults. MEGs contain unusually small exons of 3–36 bp that are repeated in tandem [42]. Their function remains elusive but it is thought that hypervariable proteins can be generated by MEGs through a ‘pick and mix’ splicing strategy. It is conceivable that such types of genes have a specific control mechanism. Other H3K4me3-peak free genes are polycistronic genes that are located downstream of the trans-splicing site. Protasio et al. estimated trans-splicing events to occur in 11% of S. mansoni genes [18] and had compiled a list of putative polycistronic transcripts. We used this list and show that in 143 (89.9%) genes, the H3K4me3 peak is located exclusively in the gene upstream of the trans-splicing acceptor site (Fig 2B), in 2 (1.2%) cases peaks are present in both genes (upstream and downstream), and in 13 (8.2%) genes we did not find any peak, although in 3 cases we suspect that an upstream gene with a peak may be the first of the polycistronic unit (S2 Table). Our data are in line with the view that these genes are indeed transcribed as one unit from a single TSS (that has the H3K4me3 signal) and fragmented by trans-splicing. For H3K27me3 we found with Diagenode antibody cat# pAb-069-050 lot# A29900242 enrichment at the TSS (-500 to +1,000 bp), while it was reduced to background level in adults. Since there was anecdotic evidence for cross-reactivity of this antibody with H3K4me3, we repeated the experiment with cat# C15410069 (that replaces pAb-069-050) lot# A1821D. With this antibody we also observe enrichment of H3K27me3 in cercariae compared to adults, but shifted towards the body of the gene (Fig 1C and Fig 2C). Methylation and acetylation in H3K9 are mutually exclusive at the same histone and H3K9me3 is considered a repressive mark. H3K9me3 shows a peak about 200 bp upstream of the TSS in cercariae, which is reduced to an upstream background in adults (Fig 1D and Fig 2C). H3K9ac is a hallmark of active transcription. In cercariae we detected this modification primarily around the TSS (-500 to +1,000 bp) while in adults acetylation spans the body of the genes (Fig 1B and Fig 2C). Taken together, our results indicate that all four studied histone modifications show an unusual enrichment around the TSS in cercariae, while in adults their distribution is similar to that found in other metazoans. We saw no differences between the input fractions (negative controls used for normalization) of cercariae and adults (Fig 1E).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Comparison of EpiChIP profiles 2kb upstream and 4kb downstream of the TSS (average for 12,871 genes located on linkage groups that are assembled on chromosome level) for cercariae (light color) and adults (dark color).

TSS and direction of transcription indicated by an arrowhead. X-axis in bp, y-axis in relative enrichment (% of all mapped reads). (A) H3K9me3, (B) H3K9ac, (C) H3K27me3, (D) H3K9me3, and (E) unbound fractions UB of mock ChIP without antibody that corresponds to input that shows no difference between cercariae and adults and no enrichment at the TSS.

https://doi.org/10.1371/journal.pntd.0003853.g001

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Typical examples of chromatin profiles.

(A) H3K4me3 peaks are absent in the TSS of MEG Smp_085840 (highlighted in yellow) while surrounding genes show characteristic peaks in all 4 samples. (B) Polycistronic genes Smp_038430, Smp_038420 and Smp_038410 (from right to left, highlighted in yellow) show an H3K4me3 peak only in the first gene. (C) Changes in chromatin structure in cercariae (left) and adults (right). On top predicted genes, below RNA-Seq based exon/intron structure, followed by H3K4Me3 (blue), H3K9Ac (green), H3K27Me3 (yellow) and H3K9Me3 (red), identical scale for cercariae and adults. Positions of TSS that were detected by RNA-Seq are indicated by a dotted line.

https://doi.org/10.1371/journal.pntd.0003853.g002

In cercariae and adults, both H3K4me3 and H3K9ac showed globally low association with repeats (4.10±0.43% and 6.45±0.65%, respectively of the total reads aligned) (details in Table 1). For H3K27me3 and H3K9me3 the percentage was higher with 7.60±1.00% and 7.75±0.60%. DESeq [40] identified repeats that change chromatin structure during transformation from cercariae to adults. DESeq uses a negative binomial distribution to model read counts that can be assigned to a locus. To estimate variance within a sample it pools the data from genes with similar hit counts, thus allowing variance estimation and identification of significant differences based on a small number of biological replicates [40]. We used DESeq because we had earlier compared it to edgeR [43], and DESeq2 and in our hands it gave the most consistent results. Using a p-value of < 10⁻⁵ as the selection criterion, we identified 17 (0.54%) repeats that change their chromatin status for H3K4me3, 182 (5.79%) for H3K9ac, 263 (8.36%) for H3K9me3, and 40 (1.27%) for H3K27me3. Results are summarized in S3 Table. Interestingly, not all repeats were concerned equally: in roughly two thirds of these repeats (n = 363, 11.5%) more than one histone isoform had changed meaning that about 10% of all repeat families undergo important chromatin structure changes during the transformation of cercariae into adults. Two results were particularly interesting (Fig 3). The first is a chromatin change in five regions that are composed of tandemly repeated stretches of class I LTR retrotransposons and class II DNA transposons. These regions are located on the large S. mansoni chromosomes (1 to 4), but there might be similar regions on the three smaller chromosomes that were overlooked. Each of the regions is composed of a different repeat, but they all belong to the same repeat class (i.e. transposon). In these five regions, enrichment of histone forms H3K9me3 and H3K27me3 decreases during cercariae to adult metamorphosis, while enrichment of H3K9ac and H3K4me3 increases. Considering five states (H3K4me3 up, H3K9ac up, H3K9me3 down, H3K27me3 down, transposon or other), the individual term binomial distribution probability to obtain such a combination by chance is 3.7⁻³⁶. Our data suggest therefore that the process is not randomly distributed along the genome. Stretches of (retro)transposons could form heterochromatic knobs in the cercariae and their change in chromatin structure could be an indication of large scale chromatin rearrangements or chromosome displacements in the nucleus during transformation into adults. Another peculiar observation during transformation from cercariae to adults is the nearly complete loss of H3 modifications in 22 of the 36 W-specific repeats (61%). We had shown earlier that transcription of these repeats can only be observed during larval stages and is undetectable in adults [44]. From qPCR data for a small subset we had already postulated that these repeats acquire an “adult-specific” chromatin structure. This view is confirmed by the new NGS data: H3K9/K4/K27 methylation and H3K9 acetylation are lost. Cytogenetic images suggest that the repeat containing large pericentromeric regions becomes heterochromatic when cercariae develop in the snail, but no clear data is available for adult worms [45]. It is tempting to speculate that H3 is replaced by another H3 isoform similar to what is observed in centromeres and neo-centromeres of other species for instance [46]. A homologue of the centromere specific form of H3, CENP-A, was detected in S. mansoni (Smp_040020) [47] but homology with CENP-A of other species is vague and basically restricted to the core H3/H4 domain.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Schematic representation of chromatin structure changes in tandem-repeat regions during metamorphosis of cercariae into adults.

Autosomes 1–7 are labeled with numbers, sex chromosomes with letters. Repeat regions are indicated on each chromosome as inferred by alignment to the reference genome, or previously by FISH on the W-chromosome. Repeat class smr_3427 is presumably on chromosome 2 but the exact position is unknown (unpositioned contig).

https://doi.org/10.1371/journal.pntd.0003853.g003

Bivalent trimethylation of H3K4 and H3K27 is specific for a subset of genes in cercariae

While PeakRanger identify 1,122 more peaks in adults than cercariae for H3K4me3, Diffbind considers only 224 differences to be statistically significant. After visual inspection, we confirmed differential enrichment in only 124 regions along the genome with 95 (77%) hypermethylated in cercariae and 29 (23%) in adults. This means that less than 2% of H3K4me3 peaks are different, while gene transcription patterns of cercariae and adults are clearly distinct [48]. A peculiar feature of the S. mansoni epigenome was revealed when we analyzed the distribution of the heterochromatic H3K27me3. In cercariae, H3K27 trimethylation is high in the gene body (Fig 4). H3K27me3 and H3K4me3 are also statistically significantly enriched around the TSS in 150 genes. This number was reduced to 121 after visual inspection (S4 Table). Thirty-five days of development separate cercariae and full-grown adults worms. To determine more precisely the time window during which chromatin is remodeled we performed ChIP-Seq on schistomula. Our results show that the adult chromatin structure is already established in schistosomula by 18 h after infection (Fig 4). Most importantly, in schistosomula, bivalent methylation is absent in the 121 genes that were significantly enriched in cercariae.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Comparison of EpiChIP profiles 2 kb upstream and 4 kb downstream of the TSS (average for 12,871 genes located on linkage groups that are assembled on chromosome level) between different histone isoforms in cercariae (left up), schistosomula (left down) and adults (right).

TSS and direction of transcription indicated by an arrowhead. Bivalent methylation of H3K4 and H3K27 occurs in cercariae but not in adults, left y-axis for H3K4me3, right y-axis for H3K27me3.

https://doi.org/10.1371/journal.pntd.0003853.g004

Cercariae are transcriptionally silent

While RNA is clearly present in cercariae, the co-localization of all four histone modifications at the TSS made us wonder if transcription is indeed ongoing or if it is poised. Cercariae are short lived and they do not grow outside the host. It is therefore conceivable that their RNA was produced during their development in the snail. We used incorporation of the cytosine analog 5-ethynyl-uridine (EU) and fluorescence labeling to detect active transcription in vivo. At 28°C, the maximum life span of a cercaria is 32 h (90% of mortality occurs past 26 h [49]) but infection capacity decreases rapidly and probably does not exceed 6 h. We decided therefore to use a relatively long EU pulse of 18 h. Despite this, we detected fluorescence signals in less than 10% of the cercariae. With the exception of a single individual (out of one hundred) signals were detected in only a few of the roughly 1,000 cells of an individual larva, and were always restricted to the nucleus (examples shown in Fig 5). In contrast, schistosomula, the first developmental stage after infection of the vertebrate host, showed consistent staining in the 100 arbitrarily chosen individuals and staining was more dispersed. We conclude that there is very little transcription in cercariae and that transcription is rapidly activated upon transformation into schistosomula. Our observation that in cercariae the repressive mark H3K9me3 is slightly upstream and the permissive mark H3K9ac is slightly downstream but close to the TSS is in accordance with stalled transcription. In contrast, in adults H3K9 acetylation and methylation are spread out with H3K9ac occurring along the gene body and H3K9me3 in the upstream regions separating genes (Fig 6A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Detection of RNA synthesis by incorporation of EU by fluorescence microscopy.

Top panel (blue) Hoechst 33342 staining of DNA, bottom panel (green) EU incorporation and detection with Alexa Fluor 488. White bar 20 μm.

https://doi.org/10.1371/journal.pntd.0003853.g005

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Comparison of EpiChIP profiles 2 kb upstream and 4 kb downstream of the TSS (average for 12,871 genes located on linkage groups that are assembled on chromosome level) between different histone isoforms in cercariae (left) and adults (right).

TSS and direction of transcription indicated by an arrowhead. (A) methylation of H3K9 upstream of TSS and acetylation downstream, concentrated around TSS in cercariae and spanning the gene body (H3K9ac) and the intergenic region (H3K9me3) in adults, (B) methylation of H3K9 and H3K4 are mutually exclusive in adults but overlap in cercariae.

https://doi.org/10.1371/journal.pntd.0003853.g006

Bivalent H3K4/H3K27 trimethylation and absence of transcription are reminiscent of what occurs in ESC of vertebrates, e.g. mice [13], human [50] and zebrafish [51]. There, bivalent H3K4/H3K27 trimethylation occurs at the transcription start site of lineage-specific genes and it was proposed that it keeps them transcriptionally “poised”, with the transcription machinery in place, ready to start transcription upon removal of the H3K27me3 mark (reviewed in [51]). ESC do not exist in schistosomes, but totipotent somatic stem cells (neoblasts) were found in platyhelminthes from the free-living turbellarians (for review [52]) to the endo- or ecto-parasitic flatworms (monogenea, cestoda, trematoda) [53]. Recently, somatic stem cells were detected in adult schistosomes and called proliferating somatic cells (PSCs) [23,54]. Another type of stem cells, totipotent germinal cells, is present in the intramolluscan stages of S. mansoni but they are restricted to a small germinal cell cluster in cercariae [23]. Chromatin structure profiles for these cells have not been studied but it could be that cercariae possess simply a large number of ESC-like cells. The ultrastructure of cercariae was described in great detail in the past [55,56] and apart from the above-mentioned small population of germinal cells, no stem cells were detected. Stem cells could be identified thanks to the expression of characteristic marker genes such as vasa, piwi, tudor and nanos. However, piwi and tudor-domain containing genes are absent from flukes and tapeworms and no true vasa orthologue has been identified in schistosomes [41]. Thus, we sought to exploit rapid replication as another characteristic feature of these cells to identify them in schistosomes.

No DNA replication in cercariae

We used 5-ethynyl-2’-deoxyuridine (EDU) incorporation to detect replication in cercariae and schistosomula. While the latter showed at least one replicating cell per individual in 27% (36 out of 135) after 2 h EDU pulse and 86% (156 out of 181) after 18 h, in none of the cercariae did we detect replication. Consequently, cercariae do not contain large amounts of rapidly replicating ES-like cells or neoblasts that could explain the ChIP-Seq profiles.