Figures
Abstract
Background
Human brucellosis (HB) is a bacterial zoonosis that is more frequent in low income and middle-income countries; it is sometimes associated with outbreaks. The aim of this study was to describe the largest outbreak of HB in Brazil.
Methods
A retrospective cohort study of patients suspected of having contracted HB in the state of Paraná, Southern Brazil from January 2009 to January 2017. Following an outbreak of 51 cases of HB in a slaughterhouse at Paiçandu in 2014, HB was defined as an obligatory reportable disease in the State. Diagnostic tests for HB included serum agglutination, ELISA (IgG or IgM) and polymerase chain reaction (PCR). Clinical, laboratorial and epidemiological data were analyzed. A P value of 0.05 was considered statistically significant.
Results
Out of a total of 3,941 patients, 754 presented with a positive test result for HB. After 2014, there was a significant increase in the number of cases, exceeding 100 cases per trimester. In the beginning of 2015, the workgroup of HB started several actions for prevention and treatment, and the number of cases progressively diminished to fewer than 20 cases per trimester. Of 191 reported cases, an occupational risk was found in 84.7%; most cases occurred in farmers (60.0%), veterinarians (17.6%) and slaughterhouse workers (14.7%). Manipulation of animals and unpasteurized milk consumption were associated with positive Brucella IgM ELISA with an odds ratio (OR) of 1.42 (1.09–1.84) and 1.48 (1.01–2.15), respectively.
Author summary
Human brucellosis (HB) is a bacterial zoonosis more frequent in low income and middle-income countries. The number of cases has increased in Southern Brazil since 2014. Considering the risk of dissemination of the disease, the authors evaluated the whole spectrum of the disease in the State of Paraná, where cases were reported. More than 3,500 patients at risk for the disease were evaluated and 754 presented with positive blood test results for human brucellosis. The local Health Agency established a program of brucellosis treatment and prevention in the following year. After the intensive control program, there was a significant reduction in the number of HB cases.
Citation: Lemos TS, Cequinel JC, Costa TP, Navarro AB, Sprada A, Shibata FK, et al. (2018) Outbreak of human brucellosis in Southern Brazil and historical review of data from 2009 to 2018. PLoS Negl Trop Dis 12(9): e0006770. https://doi.org/10.1371/journal.pntd.0006770
Editor: Stephen Baker, Oxford University Clinical Research Unit, VIET NAM
Received: June 14, 2018; Accepted: August 20, 2018; Published: September 18, 2018
Copyright: © 2018 Lemos et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All data from study "Outbreak of human brucellosis in Southern Brazil and historical review of data from 2009 to 2018" are available as supplemental material.
Funding: The authors received no specific funding for this work.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Human brucellosis (HB) is a bacterial zoonotic infection caused by Brucella spp. and is transmitted from several sources to humans. The main sources are cattle, sheep, goats, and pigs, which transmit the microorganism to humans through direct contact with infected animals or ingestion of contaminated food products [1]. The Gram-negative bacillus is transmitted through inhalation or the gastrointestinal route, causing a polymorphic acute or chronic inflammatory disease [2]. HB-related mortality rate was less than 1% of cases as reported by Buzgan et al. [3]. Nevertheless, the burden of disability caused by acute brucellosis is similar to that of acute malaria [4].
The burden of HB is not well defined because its incidence is always underestimated. Active surveillance of HB is not routinely performed, and most of the cases in low- and middle-income countries are poorly investigated [5]. The number of HB cases has decreased in industrialized countries, but it remains a concern in low- and middle-income countries.
In Brazil, brucellosis in cows [6], dogs [7], buffalos [8], sheep [9], goats [10], deer [11], horses [12], dolphin [13], and other animals has been reported. Human cases [14] and outbreak of laboratory-acquired Brucella abortus [15] have been described sporadically. However, serosurvey studies suggest that the infection is more prevalent than reported [16, 17].
Since the first case that was published in Brazil in 1934 [18], HB has been reported throughout the country, but it is generally restricted to workers of slaughterhouses, consumers of unpasteurized milk from areas of high incidence of bovine brucellosis [19], and agricultural workers [20]. In this study, we described the largest HB outbreak in Brazil.
Methods
Study design
We used the STROBE Statement for cohort studies to report the results and describe the methods. The study was approved by the ethical committee at PUC-PR (84644718.3.0000.0020). This retrospective cohort study included patients suspected to be infected with HB in the state of Paraná, Southern Brazil.
Ethics statement
Informed consent was not necessary because this was a retrospective study. The authors guarantee the security of the data.
Setting
In May 2015, HB was made statutorily reportable in Parana, Brazil. All probable or laboratory-confirmed new brucellosis cases were required to be reported. This decision was taken by the State Department of Health of Parana (SDHP) due to an outbreak comprising 51 HB cases in a slaughterhouse at Paiçandu in 2014. Thus, we evaluated the clinical data from January 2014 to January 2018 by active surveillance. Since March 2009, all laboratory tests for brucellosis are registered in the laboratory system of SDHP. We evaluated the positivity of serum tests for HB from March 2009 to January 2018. The tests used to detect HB included serum agglutination (Bengal Rose), ELISA (IgG or IgM), and polymerase chain reaction (PCR). When multiple tests provided different results in a patient, we considered only positive results. These results were used only for historical analysis of positive test results and not for case definition (see below).
Case definition
Brucellosis cases were classified according to the guidelines for the management of HB in Paraná, Brazil [21].
Suspected case: any patient with acute or insidious fever plus clinical manifestations of HB plus an epidemiological link with infected animals or contaminated food or contact of a confirmed case.
Confirmed case: a suspected case with positive test results for Brucella spp. (serum IgM by enzyme-linked immunoassay [ELISA] or detection of Brucella DNA by PCR).
Case excluded: a suspected case with negative laboratory findings and/or a confirmed diagnosis for another disease.
Laboratory tests
The current working group recommends laboratory tests for suspected cases and serology and molecular tests for the diagnosis of brucellosis. Laboratory tests required 2 mL of serum and 3–5 mL of blood to be collected in serum and ethylenediaminetetraacetic acid (EDTA) tubes, respectively. The serum was stored in a specific tube between 2°C and 8°C for 72 hours. After this period, the sample was stored at -20°C. The blood was then stored in EDTA tubes between 2°C and 8°C for 72 hours; the blood samples were not frozen. The materials used by this working group for the laboratory diagnosis of brucellosis were Brucella IgG and IgM ELISA (Serion, Maringa, Brazil) and real-time PCR. The Rose Bengal test (Laborclin, Pinhais, Brazil) has high sensitivity and specificity, but positive results can occur in asymptomatic patients after exposure to Brucella or after vaccination [22]. Real-time PCR is considered as the gold standard method for HB diagnosis because Brucella can only be cultured in laboratories with at least a biosafety level 3 [23]. The PCR test was performed using BD MAX, an open system with completely automated equipment, and the DNA-1 extraction kit and BD MAX DNA MMK with Sample Processing Control Master Mix (BD Diagnostic Systems, Québec, ON, Canada). Real-time PCR for detecting Brucella spp. was performed with primers and probes that targeted the bcsp31 gene (forward GCTCGGTTGCCAATATCAATGC and reverse GGGTAAAGCGTCGCCAGAAG) [24].
Data source and variables
Data, including patient anamnesis, exposure, clinical manifestations, and results of Brucella laboratory tests (ELISA and PCR) were obtained by local physicians.
Statistical methods
The incidence of HB was calculated based on the number of cases divided by the population of each city where cases were reported. The population sizes were obtained from the last population census conducted by the Brazilian Institute of Geography and Statistics in 2012 [25].
All variables were found to be correlated with the results of the serum Brucella IgG ELISA, Brucella IgM ELISA, and PCR. Moreover, a comparative analysis of all clinical and laboratorial data of confirmed and unconfirmed cases was performed.
Quantitative variables were expressed as mean with standard deviation (SD) and median with 25%-75% interquartile range (IQR). A comparative analysis of continuous data was performed using Mann-Whitney test (nonparametric) and Student’s t-test (parametric). Categorical data were analyzed using a chi-square or Fisher’s exact test (when any categorical data presented a value < 5 cases). A binary logistic regression was used to control confounding variables. A rate mapping was performed to visualize the change in the city over a period by city with free software TerraView (version 5.3.1). A P value of 0.05 was considered significant. For significant categorical data, the relative risk (RR) with a 95% of confidential interval (95% CI) was calculated. The statistical analysis was performed using SPSS 23.0.
Results
A total of 9,523 tests for HB were performed in the state of Paraná between January 2009 and January 2018. However, within this period, 5,582 were repeated tests, and 3,941 were single tests (3,941 patients). From 3,941 patients, 754 tested positive for HB (673 by serum agglutination, 33 by ELISA IgG, and 48 by ELISA IgM). Fig 1 shows a histogram of the positive and negative test results in the period evaluated.
The line represents the proportion of negative test results for each positive test result.
From 2009 to July 2014, only a small number of HB cases were reported (< 20 cases per trimester). However, after 2014, there was a significant increase in the number of cases, exceeding 100 cases per trimester. At the start of 2015, the HB workgroup started several preventive actions and treatments. After the guidelines were implemented, the number of cases progressively declined to fewer than 20 cases per trimester.
Considering only the number of clinically available patients, a total of 191 suspected HB cases were reported: 55 (28.8%) cases in 2014, 47 (24.6%) in 2015, 23 (12.0%) in 2016 and 66 (34.6%) in 2017. Based on the number of cases in each year, the incidence of HB in the state of the Paraná was 0.49, 0.42, 0.20, and 0.59 cases per 100,000 population, in 2014, 2015, 2106 and 2017, respectively. The mean age was 37.7 ± 15.5 years (median 35, IQR 26–49) with higher prevalence in males (n = 126, 66%). Of 170 cases, 144 (84.7%) had occupational risk (21 had missing occupation data); most cases occurred in farmers (n = 102, 60.0%), veterinarians (n = 30, 17.6%), and slaughterhouse workers (n = 25, 14.7%). The state of Paraná is divided into 18 macroregions. Of the 18 regions, 9 accounted for 90.6% of cases (Fig 2). Approximately 74% of cases (n = 126) were from rural areas and 27.6% (n = 48) from urban areas. The distribution of cases per city is shown in Fig 2.
The prevalence of symptoms is detailed in Table 1. Myalgia/arthralgia (54.1%), fever (40.7%), and sweat (27.3%) were the most common symptoms. Brucella IgM ELISA was performed in 150 patients, and 89 patients tested positive for Brucella infection (59.3%). Brucella IgG ELISA was performed in 76 patients with 30 positive test results (39.5%). PCR test was performed in 59 patients, with amplification in 4 patients (6.8%). Based on the diagnostic criteria, 90 of 191 patients were diagnosed with confirmed HB (47.1%).
All patients with suspect HB with positive Brucella IgG ELISA were analyzed to check correlation between the test and clinical findings. The clinical, epidemiological, and laboratorial data are shown in Table 2. Unpasteurized milk was the only factor associated with positive Brucella IgG ELISA. Similarly, all patients with positive Brucella IgM ELISA were analyzed to check for any correlation with a positive test. The clinical, epidemiological, and laboratorial data are presented in Table 3. Animal manipulation, unpasteurized milk, and weight loss were factors associated with positive Brucella IgM ELISA (OR = 1.42 (1.09–1.84), OR = 1.48 (1.01–2.15), and OR = 2.03 (0.92–4.33), respectively).
The 90 HB cases confirmed were found to be associated with animal manipulation, unpasteurized milk, exposure to RB51 vaccine, presence of symptoms, and weight loss (Table 4). A logistic regression was performed using the variables associated with confirmed HB cases, and none of the variables were independently associated with the confirmed HB cases.
Discussion
In Brazil, the first HB case was reported in Rio de Janeiro in 1934 [18]. Since then, the number of reported cases has increased. To our knowledge, this study is the first to report a cohort of cases after the implementation of compulsory reporting of the disease. This political decision was made after an outbreak of 8 confirmed HB cases in a slaughterhouse in Paiçandu (state of Paraná). The incidence of HB within this period was less than 1 case per 100,00 population. In China, reporting of HB cases has been compulsory for several decades. From 1970 to 2000, the incidence of HB was lower than 0.5 per 100,000 population [26]. In other endemic countries, such as Iraq [27], Azerbaijan [28], and Kyrgyzstan [29], the incidence reached more than 100 cases per 100,000 population. These low-income countries are now facing challenges in diagnosing HB, as it is often misdiagnosed as tuberculosis, Q fever, typhoid fever, and malaria [30]. The incidence in developed countries is extremely low and is more frequent in immigrant patients or occur in individuals after travelling [31].
In this study, the outbreak was clearly defined in 2014, with more than 100 cases per trimester and fewer than 20 cases per trimester in the previous years. After the outbreak in the slaughterhouse was identified, an educational approach was initiated in the specific slaughterhouse as well as in other cities, and cases declined progressively in the following year.
The HB we reported can be considered an occupational disease, as it is associated with exposure to contaminated animals in slaughterhouses and manipulation of animal products, including unpasteurized milk. Most of the patients were young male adults, had high occupational risks, and lived in rural areas. The map (Fig 2) showed an evident dissemination of the disease in the State of Paraná. Despite the intensive vaccination of cattle with RB51 as a matter of policy in the state of Paraná, the vaccine is only available for dairy cattle.
The frequency of HB symptoms is comparable with that reported in the literature. However, most cases were not adequately reported by the local physicians. This underestimated some symptoms and signs and it was impossible to classify the different forms of HB. Most cases were subjectively classified as acute cases with the following classical symptoms: fever, arthralgia, and weight loss. We identified certain chronic forms of HB, but most of them were not adequately classified.
The diagnosis of HB is a real challenge because cultures are not available. The state of Paraná does not have a safety level 3 laboratory, and previous diagnoses were based only on serum tests, specifically the Bengal rose test. After the outbreak in Paiçandu, a molecular test was standardized by the central laboratory of the state using B. abortus isolated from one patient as a positive control. Molecular techniques have been employed as important tests for several diseases; however, we cannot extend this concept for HB. In most cases with typical symptoms, positive ELISA serum test results and clinical response to HB therapy with aminoglycoside and doxycycline contrast with undetectable DNA by PCR. The positive control developed in the lab and used in the PCR had high accuracy, as reported in the literature, but we cannot extend these results to clinical practice [32–34]. Unfortunately, PCR was not performed in most cases due to inadequate blood samples. The protocol uses EDTA tubes, and only the tubes used for serology had been sampled. Most diagnoses were based on the symptoms and IgM ELISA, a well-established method in the literature, despite false positive test results [35–37]. Considering all the challenges to the diagnosis and management of HB, a study group developed local guidelines to help physicians, local epidemiology divisions, and veterinarians in the diagnosis, management after exposure, and reporting of the disease [21].
The correlation of serum tests with epidemiological data showed that positive Brucella IgG ELISA was associated with the consumption of unpasteurized milk. Positive Brucella IgM ELISA was also associated with animal manipulation. ELISA for Brucella IgG is a sensitive test for acute and chronic infections. Patients with past infections also present with a positive Brucella IgG ELISA, and in rare cases, this test can be falsely positive due to its sensitivity, which ranges from 90% to 100% [38, 39]. In the context of this outbreak, positive Brucella IgG and IgM ELISA correlated with the risk factors associated with HB. Serum tests were fundamental in the diagnosis of HB, and PCR presented a low positivity, but it was possible to diagnose one case based solely on PCR. Furthermore, PCR can be useful when serum tests are contradictory [40].
We describe the distribution of HB in the state of Paraná using the reported data and emphasize its recent reemergence. Improving our understanding of the epidemiology of this disease can help in the formulation of plans for regional and possibly national strategies to control HB.
References
- 1. Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV. The new global map of human brucellosis. Lancet Infect Dis. 2006;6(2):91–9. pmid:16439329.
- 2. Dean AS, Crump L, Greter H, Hattendorf J, Schelling E, Zinsstag J. Clinical manifestations of human brucellosis: a systematic review and meta-analysis. PLoS Negl Trop Dis. 2012;6(12):e1929. pmid:23236528; PubMed Central PMCID: PMCPMC3516581.
- 3. Buzgan T, Karahocagil MK, Irmak H, Baran AI, Karsen H, Evirgen O, et al. Clinical manifestations and complications in 1028 cases of brucellosis: a retrospective evaluation and review of the literature. Int J Infect Dis. 2010;14(6):e469–78. pmid:19910232.
- 4. Roth F, Zinsstag J, Orkhon D, Chimed-Ochir G, Hutton G, Cosivi O, et al. Human health benefits from livestock vaccination for brucellosis: case study. Bull World Health Organ. 2003;81(12):867–76. pmid:14997239; PubMed Central PMCID: PMCPMC2572379.
- 5. McDermott J, Grace D, Zinsstag J. Economics of brucellosis impact and control in low-income countries. Rev Sci Tech. 2013;32(1):249–61. pmid:23837382.
- 6. Borba MR, Stevenson MA, Goncalves VS, Neto JS, Ferreira F, Amaku M, et al. Prevalence and risk-mapping of bovine brucellosis in Maranhao State, Brazil. Prev Vet Med. 2013;110(2):169–76. pmid:23218657.
- 7. Keid LB, Chiebao DP, Batinga MCA, Faita T, Diniz JA, Oliveira T, et al. Brucella canis infection in dogs from commercial breeding kennels in Brazil. Transbound Emerg Dis. 2017;64(3):691–7. Epub 2017/03/16. pmid:28296215.
- 8. Dos Santos LS, Sa JC, Dos Santos Ribeiro DL, Chaves NP, da Silva Mol JP, Santos RL, et al. Detection of Brucella sp. infection through serological, microbiological, and molecular methods applied to buffaloes in Maranhao State, Brazil. Trop Anim Health Prod. 2017;49(4):675–9. Epub 2017/02/20. pmid:28214920.
- 9. Costa LF, Pessoa MS, Guimaraes LB, Faria AK, Morao RP, Mol JP, et al. Serologic and molecular evidence of Brucella ovis infection in ovine and caprine flocks in the State of Minas Gerais, Brazil. BMC Res Notes. 2016;9:190. Epub 2016/03/29. pmid:27017445; PubMed Central PMCID: PMCPMC4808293.
- 10. Lilenbaum W, de Souza GN, Ristow P, Moreira MC, Fraguas S, Cardoso Vda S, et al. A serological study on Brucella abortus, caprine arthritis-encephalitis virus and Leptospira in dairy goats in Rio de Janeiro, Brazil. Vet J. 2007;173(2):408–12. Epub 2006/02/04. pmid:16455276.
- 11. Mathias LA, Girio RJ, Duarte JM. Serosurvey for antibodies against Brucella abortus and Leptospira interrogans in pampas deer from Brazil. J Wildl Dis. 1999;35(1):112–4. Epub 1999/03/12. pmid:10073359.
- 12. Portugal MA, Nesti A, Giorgi W, Franca EN, de Oliveira BS Jr. [Brucellosis in equins caused by Brucella suis]. Arq Inst Biol (Sao Paulo). 1971;38(3):125–32. pmid:5168558.
- 13. Sanchez-Sarmiento AM, Carvalho VL, Sacristan C, Groch KR, Ressio RA, Fernandes N, et al. Brucellosis in a Clymene dolphin (Stenella clymene) stranded in Brazil. Transbound Emerg Dis. 2018;65(1):289–91. Epub 2017/08/18. pmid:28816014.
- 14. Meirelles-Bartoli RB, Mathias LA, Samartino LE. Brucellosis due to Brucella suis in a swine herd associated with a human clinical case in the State of Sao Paulo, Brazil. Trop Anim Health Prod. 2012;44(7):1575–9. pmid:22388711.
- 15. Rodrigues AL, Silva SK, Pinto BL, Silva JB, Tupinambas U. Outbreak of laboratory-acquired Brucella abortus in Brazil: a case report. Rev Soc Bras Med Trop. 2013;46(6):791–4. Epub 2014/01/30. pmid:24474027.
- 16. Garcia JL, Navarro IT. [Serologic survey for leptospirosis and brucellosis in patients from the rural area of Guaraci County, Parana State, Brazil]. Rev Soc Bras Med Trop. 2001;34(3):301–2. pmid:11460219.
- 17. Angel MO, Ristow P, Ko AI, Di-Lorenzo C. Serological trail of Brucella infection in an urban slum population in Brazil. J Infect Dev Ctries. 2012;6(9):675–9. Epub 2012/09/25. pmid:23000868; PubMed Central PMCID: PMCPMC3800144.
- 18. Pacheco G, de MM. [Human brucellosis in Brazil]. Mem Inst Oswaldo Cruz. 1950;48:393–436. pmid:24539409.
- 19. Souza AP, Moreira Filho DC, Favero M. [Brucellosis in cattle and in human consumers of milk]. Rev Saude Publica. 1977;11(2):238–47. pmid:905750.
- 20. Wiesmann E, Mosimann J, Drolshammer I, Eckert J, Marki H, Munzinger J, et al. [Study of Brazilian agricultural workers. A medico-socio-psychological study]. Acta Trop. 1975;32(1):1–36. Epub 1975/01/01. pmid:239549.
- 21. Tuon FF, Cerchiari N, Cequinel JC, Droppa EEH, Moreira SDR, Costa TP, et al. Guidelines for the management of human brucellosis in the State of Parana, Brazil. Rev Soc Bras Med Trop. 2017;50(4):458–64. Epub 2017/09/28. pmid:28954065.
- 22. Diaz R, Casanova A, Ariza J, Moriyon I. The Rose Bengal Test in human brucellosis: a neglected test for the diagnosis of a neglected disease. PLoS Negl Trop Dis. 2011;5(4):e950. PubMed Central PMCID: PMCPMC3079581. pmid:21526218
- 23. Wang Y, Wang Z, Zhang Y, Bai L, Zhao Y, Liu C, et al. Polymerase chain reaction-based assays for the diagnosis of human brucellosis. Ann Clin Microbiol Antimicrob. 2014;13:31. pmid:25082566; PubMed Central PMCID: PMCPMC4236518.
- 24. Probert WS, Schrader KN, Khuong NY, Bystrom SL, Graves MH. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J Clin Microbiol. 2004;42(3):1290–3. Epub 2004/03/09. pmid:15004098; PubMed Central PMCID: PMCPMC356861.
- 25.
IBGE. Instituto Brasileiro de Geografia e Estatísticas—Censo Populacional. 2012.
- 26. Lai S, Zhou H, Xiong W, Gilbert M, Huang Z, Yu J, et al. Changing Epidemiology of Human Brucellosis, China, 1955–2014. Emerg Infect Dis. 2017;23(2):184–94. Epub 2017/01/19. pmid:28098531; PubMed Central PMCID: PMCPMC5324817.
- 27. Yacoub AA, Bakr S, Hameed AM, Al-Thamery AA, Fartoci MJ. Seroepidemiology of selected zoonotic infections in Basra region of Iraq. East Mediterr Health J. 2006;12(1–2):112–8. Epub 2006/10/14. pmid:17037228.
- 28. Abdullayev R, Kracalik I, Ismayilova R, Ustun N, Talibzade A, Blackburn JK. Analyzing the spatial and temporal distribution of human brucellosis in Azerbaijan (1995–2009) using spatial and spatio-temporal statistics. BMC Infect Dis. 2012;12:185. pmid:22873196; PubMed Central PMCID: PMCPMC3482564.
- 29. Bonfoh B, Kasymbekov J, Durr S, Toktobaev N, Doherr MG, Schueth T, et al. Representative seroprevalences of brucellosis in humans and livestock in Kyrgyzstan. Ecohealth. 2012;9(2):132–8. pmid:22143553; PubMed Central PMCID: PMCPMC3415613.
- 30. Dean AS, Bonfoh B, Kulo AE, Boukaya GA, Amidou M, Hattendorf J, et al. Epidemiology of brucellosis and q Fever in linked human and animal populations in northern togo. PLoS One. 2013;8(8):e71501. pmid:23951177; PubMed Central PMCID: PMCPMC3741174.
- 31. Dean AS, Crump L, Greter H, Schelling E, Zinsstag J. Global burden of human brucellosis: a systematic review of disease frequency. PLoS Negl Trop Dis. 2012;6(10):e1865. pmid:23145195; PubMed Central PMCID: PMCPMC3493380.
- 32. Al Nakkas AF, Wright SG, Mustafa AS, Wilson S. Single-tube, nested PCR for the diagnosis of human brucellosis in Kuwait. Ann Trop Med Parasitol. 2002;96(4):397–403. pmid:12171621.
- 33. Al-Attas RA, Al-Khalifa M, Al-Qurashi AR, Badawy M, Al-Gualy N. Evaluation of PCR, culture and serology for the diagnosis of acute human brucellosis. Ann Saudi Med. 2000;20(3–4):224–8. pmid:17322662.
- 34. Al-Nakkas A, Mustafa AS, Wright SG. Large-scale evaluation of a single-tube nested PCR for the laboratory diagnosis of human brucellosis in Kuwait. J Med Microbiol. 2005;54(Pt 8):727–30. pmid:16014425.
- 35. Araj GF, Lulu AR, Mustafa MY, Khateeb MI. Evaluation of ELISA in the diagnosis of acute and chronic brucellosis in human beings. J Hyg (Lond). 1986;97(3):457–69. pmid:3794323; PubMed Central PMCID: PMCPMC2082895.
- 36. Araj GF, Lulu AR, Saadah MA, Mousa AM, Strannegard IL, Shakir RA. Rapid diagnosis of central nervous system brucellosis by ELISA. J Neuroimmunol. 1986;12(3):173–82. pmid:3734058.
- 37. Aranis JC, Oporto CJ, Espinoza M, Riedel KI, Perez CC, Garcia CP. [Usefulness of the determination of IgG and IgM antibodies by ELISA and immunocapture in a clinical series of human brucellosis]. Rev Chilena Infectol. 2008;25(2):116–21. pmid:18483644.
- 38. Hasibi M, Jafari S, Mortazavi H, Asadollahi M, Esmaeeli Djavid G. Determination of the accuracy and optimal cut-off point for ELISA test in diagnosis of human brucellosis in Iran Acta Med Iran. 2013;51(10):687–92. pmid:24338140.
- 39. Park SH, Lee YH, Chu H, Hwang SD, Hwang KJ, Choi HY, et al. Application of the microagglutination test for serologic diagnosis of human brucellosis. Osong Public Health Res Perspect. 2012;3(1):19–23. pmid:24159482; PubMed Central PMCID: PMCPMC3738686.
- 40. Sohrabi M, Mohabati Mobarez A, Khoramabadi N, Hosseini Doust R, Behmanesh M. Efficient diagnosis and treatment follow-up of human brucellosis by a novel quantitative TaqMan real-time PCR assay: a human clinical survey. J Clin Microbiol. 2014;52(12):4239–43. pmid:25275001; PubMed Central PMCID: PMCPMC4313293.