Figures
Abstract
Background
In a previous study, we detected the presence of a Mycobacterium avium species-specific insertion sequence, IS1245, in Mycobacterium kansasii. Both species were isolated from a mixed M. avium-M. kansasii bone marrow culture from an HIV-positive patient. The transfer mechanism of this insertion sequence to M. kansasii was investigated here.
Methodology/Principal Findings
A linear plasmid (pMA100) was identified in all colonies isolated from the M. avium-M. kansasii mixed culture carrying the IS1245 element. The linearity of pMA100 was confirmed. Other analyses suggested that pMA100 contained a covalently bound protein in the terminal regions, a characteristic of invertron linear replicons. Partial sequencing of pMA100 showed that it bears one intact copy of IS1245 inserted in a region rich in transposase-related sequences. These types of sequences have been described in other linear mycobacterial plasmids. Mating experiments were performed to confirm that pMA100 could be transferred in vitro from M. avium to M. kansasii. pMA100 was transferred by in vitro conjugation not only to the M. kansasii strain from the mixed culture, but also to two other unrelated M. kansasii clinical isolates, as well as to Mycobacterium bovis BCG Moreau.
Conclusions/Significance
Horizontal gene transfer (HGT) is one of most important mechanisms leading to the evolution and diversity of bacteria. This work provides evidence for the first time on the natural occurrence of HGT between different species of mycobacteria. Gene transfer, mediated by a novel conjugative plasmid, was detected and experimentally reproduced.
Citation: Rabello MCdS, Matsumoto CK, de Almeida LGP, Menendez MC, de Oliveira RS, Silva RM, et al. (2012) First Description of Natural and Experimental Conjugation between Mycobacteria Mediated by a Linear Plasmid. PLoS ONE 7(1): e29884. https://doi.org/10.1371/journal.pone.0029884
Editor: Eric A. Johnson, University of Wisconsin, Food Research Institute, United States of America
Received: August 8, 2011; Accepted: December 7, 2011; Published: January 3, 2012
Copyright: © 2012 Rabello et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study received financial support from Fundação de Amparo à Pesquisa do Estado de São Paulo (www.fapesp.br) (FAPESP – 06/01533-9) and from Cooperación Interuniversitaria UAM-Banco Santander con América Latina (CEAL), UAM, Spain (http://www.uam.es/ss/Satellite/es/1234886374208/listado/CEAL_(Centro_de_Estudios_de_America_Latina).htm). MCSR was the recipient of fellowships from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) (www.cnpq.br) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes) (www.capes.gov.br). The funding agencies had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Insertion sequences (ISs) are mobile genetic elements, capable of transposing and inserting at multiple sites in target DNA molecules [1]. The genus Mycobacterium contains a large number of different insertion elements, several of them found in members of the Mycobacterium avium complex (MAC) [2]. MAC organisms are ubiquitous in nature, and besides the classical species M. avium and Mycobacterium intracellulare, two new species were recently described: Mycobacterium chimaera [3] and Mycobacterium colombiense [4]. M. avium is responsible for opportunistic infections in animals and humans, and has been frequently associated with disseminated infections in HIV-positive patients [5]. The insertion sequence IS1245 is a mobile element highly prevalent in subspecies of M. avium: M. avium subsp. avium, M. avium subsp. hominissuis, and M. avium subsp. silvaticum. Multiple IS1245 copies are usually present in M. avium clinical isolates, making this repetitive sequence a useful tool for epidemiological studies [6], [7], [8], [9], [10]. However, some studies have shown that this insertion element is sporadically present in other mycobacterial species, suggesting that it may be dispersed by horizontal gene transfer (HGT) [11].
Recently, our group confirmed the presence of the IS1245 element in colonies of Mycobacterium kansasii isolated from a M. avium-M. kansasii mixed culture from a bone marrow specimen of an HIV-positive patient [12]. Fifteen colonies were isolated from the original culture, four of which were identified as M. avium and 11 as M. kansasii. Eight of the 11 M. kansasii colonies generated IS1245 amplicons by PCR. The presence of the IS1245 element in these M. kansasii colonies was confirmed by IS1245 amplicon sequencing and by detection of a 4,750-bp hybridization band in restriction fragment length polymorphism analysis using IS1245 as the probe (RFLP-IS1245) [12]. The results obtained strongly suggested that M. kansasii acquired the IS1245 element from the M. avium strain following an HGT event.
Conjugation, transduction and transformation are forms of HGT that occur naturally between bacteria. These three mechanisms have already been described or suggested in studies with mycobacteria, but information and experimental evidence are scarce. The majority of studies suggesting HGT in mycobacteria are based on comparative genome analyses [13]. Phages and plasmids were demonstrated to be the main vehicles of HGT and could contribute to IS dispersion among genomes. Many plasmids and bacteriophages have been described in the genus Mycobacterium [14], [15], [16] and some mycobacterial plasmids were previously shown to carry IS elements [15], [16]. Plasmid pCLP from Mycobacterium celatum contains sequences similar to resolvases and transposases found in the Mycobacterium tuberculosis genome [15]. Plasmid pMUM001 from Mycobacterium ulcerans carries 26 copies of various ISs and IS fragments, 12 of which are known elements present in the chromosome of M. ulcerans (4 copies of IS2404 and 8 copies of IS2606) [16]. Thus, IS jumping between bacterial chromosome and plasmids does not appear to be a rare event.
In this study, we investigated the mechanism of IS1245 element transfer from M. avium to M. kansasii, resulting in the detection of a 100-kb linear conjugative plasmid (pMA100).
Results
Identification and characterization of a novel linear plasmid (pMA100)
An extrachromosomal band of approximately 100 kb, designated pMA100, was identified by pulsed-field gel electrophoresis (PFGE) of undigested DNA with four M. avium colonies and eight of the 11 M. kansasii colonies from the original M. avium-M. kansasii mixed culture, all of which produced amplicons by PCR-IS1245 (Figure 1A). The presence of IS1245 in pMA100 was confirmed by Southern blot hybridization of pulsed-field gels using a radioactivity-labeled IS1245 complementary probe (Figure 1B). Neither the 100 kb band nor any hybridization signal with the IS1245-derived probe was detected in the three M. kansasii colonies that did not generate IS1245 amplicons (Figure 1A and 1B). A second hybridization band, undetected in PFGE gels stained with ethidium bromide, was observed with two of the eight PCR-IS1245 positive M. kansasii colonies (88.14 and 88.15). This experiment was repeated and the results were reproduced (Figure 1B).
M. avium and M. kansasii colonies. (A) PFGE with undigested DNA; (B) Southern blot hybridization with IS1245-derived probe. Open arrow indicates pMA100; closed arrow indicates the uncharacterized smaller hybridization band. 88.1 to 88.4 = M. avium; 88.5 to 88.75 = PCR−IS1245-negative M. kansasii; 88.8 to 88.15 = PCR−IS1245-positive M. kansasii. On the left, Lambda Ladder PFG Marker (NewEngland BioLabs) molecular size markers.
pMA100 co-migrated with linear lambda concatemers in PFGE using three different switch times, suggesting that it was a linear molecule (Figure 2A). Experiments with exonuclease III, exonuclease lambda and topoisomerase I confirmed the linearity of this molecule. pMA100 was sensitive to exonuclease III (which degrades DNA from free 3′ ends), and its migration was not affected by topoisomerase I, an enzyme that relaxes circular plasmids. Moreover, it was resistant to the action of exonuclease lambda, which degrades DNA from free 5′ ends, suggesting that pMA100 may have covalently bound proteins at its terminals (Figure 2B and 2C).
(A) PFGE with undigested DNAs from M. avium 88.3 (1) and M. kansasii 88.8 (2) under different switch times, indicated below each figure; (B) pMA100 extracted from PFGE gels and treated with exonuclease III (3) or exonuclease lambda (4); (C) pMA100 extracted from PFGE gels and treated (+) or not (-) with topoisomerase I; (D) DNA prepared with (+) or without (-) adding proteinase K to the lysis buffer; (E) same as in (D) in PFGE gels and running buffer prepared with 0.2% SDS. λ: DNA concatemers of the bacteriophage λ genome.
In plugs prepared without the addition of proteinase K to the lysis buffer, pMA100 did not enter the gel preparation during PFGE, suggesting again the presence of covalently bound proteins at its terminals (Figure 2D). Moreover, pMA100 was able to penetrate the gel after addition of 0.2% SDS, which denatures terminal end proteins (Figure 2E).
Partial sequencing of pMA100
DNA from M. kansasii (colony 88.8) digested with KpnI and analyzed by RFLP-IS1245 generated two hybridization fragments of approximately 3,500 bp and 4,100 bp, respectively (data not shown). Both fragments were cloned and sequenced. The analysis of the sequences obtained confirmed the presence of an intact copy of the IS1245 element in pMA100. IS1245 has a KpnI restriction site at position 499, and as a consequence, the first 499 bp of IS1245 were located in the ∼4,100 bp KpnI fragment and 914 bp in the ∼3,500 bp KpnI fragment. The IS1245 flanking region had >80% similarity to transposase-related genes present in other mycobacterial linear plasmids, namely the IS605 orfB related sequence present in plasmid pMFLV01 from Mycobacterium gilvum PYR-GCK (GenBank accession numbers NC_009339 and CP000657) and sequences related to Rv0922 and Rv0921 (IS1535) from M. tuberculosis present in plasmid pCLP from M. celatum [15]. The adjacent DNA sequences did not show similarity at the nucleotide level with other sequences in the GenBank database; however, it was possible to detect similarities at the amino acid level with two putative proteins described in the M. kansasii genome (Figure 3).
The similarities identified in the 7,525-bp sequenced fragment of pMA100 are indicated. Similarities at nucleotide levels were identified using BLASTn and the regions of similarity are depicted as hatched bars; identities at amino acid level were identified using BLASTx and each region is shown as a white arrow, indicating the direction of transcription. Black bar localizes the IS1245 element. KpnI restriction sites are indicated.
pMA100 was transmissible by conjugation to M. kansasii and Mycobacterium bovis BCG
Different mating experiments were carried out using M. avium colony 88.3, bearing pMA100, as donor and different recipient strains: M. kansasii colony 88.6, M. kansasii IAL 413 M. kansasii IEC 6805, M. bovis BCG Moreau or Mycobacterium smegmatis mc2155. Table 1 shows the results of PCR-IS1245 screening of 1,770 recipient strains colonies isolated after the mating experiments. Eight M. kansasii and 11 M. bovis BCG transconjugant colonies were detected by PCR-IS1245. No transconjugants were obtained when M. smegmatis mc2155 was used as recipient strain.
Additional experiments were carried out to confirm the presence of IS1245 and pMA100 in the transconjugant colonies. In each case, the presence of the 100 kb plasmid band, which hybridized with IS1245 was confirmed by PFGE (Figure 4A and 4B). Moreover, PFGE-DraI typing corroborated that each corresponding pair of recipient and transconjugant colonies belonged to the same strain (Figure 4C). Hybridization of DraI digested DNA from transconjugant colonies with the pMA100 derived probe was used to demonstrate that, besides the IS1245 element, the pMA100 molecule was also transferred to M. kansasii and M. bovis BCG in the mating experiments and that pMA100 did not integrate into the recipient strains chromosome (Figure 4D).
(A) PFGE with undigested DNA; (B) Southern blot of PFGE gels with undigested DNA and hybridization with IS1245-derived probe; (C) PFGE-DraI; (D) Southern blot of PFGE-DraI gels and hybridization with pMA100-derived probe. Open arrows indicate the linear plasmid pMA100. 1: M. avium 88.3; 2: M. kansasii 88.6; 3: M. kansasii IAL 413; 4: M. kansasii IEC 6805; 5: M. bovis BCG Moreau; W: wild-type colony; T: transconjugant colony.
No transconjugants were detected in mating experiments performed using the rapidly-growing mycobacterium M. smegmatis mc2155 as recipient. A total of 1,200 colonies from three mating experiments, identified as M. smegmatis for the ability to grow on LB agar in less than 7 days, were screened by PCR-IS1425 but none produced IS1245 amplicons (Table 1).
Discussion
PFGE has been previously used for the detection of mycobacterial plasmids [17], [18], [19]. In the present study, PFGE allowed the identification of a 100-kb extrachromosomal band (pMA100) in PCR-IS1245 positive M. avium and M. kansasii colonies from a mixed culture, suggesting that pMA100 could be a plasmid responsible for the natural transfer of the IS1245 element between M. avium and M. kansasii.
This plasmid was shown to contain an intact copy of the IS1245 element and was able to be transferred between M. avium and other slow-growing species, such as M. kansasii and M. bovis BCG. The weak intensity of bands corresponding to pMA100 in PFGE gels suggests that it may be a low-copy number plasmid.
A second smaller IS1245-hybridizing band was observed by Southern blot hybridization with two PCR-IS1245 positive M. kansasii colonies (Figure 1B). It could be the same plasmid that underwent duplication and partial deletion. Otherwise, the IS1425 element could have transposed to a second plasmid present in M. kansasii. This supplementary copy was not submitted to further investigation. The transposition of this IS during in vitro culture passages was previously described in M. avium [20], and in M. kansasii [12]. As PFGE requires recent cultures, it is possible that further transposition events occurred in some of these colonies when they were cultivated again. IS1245 copies could have inserted in the chromosome.
The observation that pMA100 co-migrated with linear molecules in PFGE and the results obtained with exonucleases and topoisomerase I support the notion that the 100 kb molecule is linear and suggest an invertron-like structure. Besides, our results suggest that pMA100 could contain a protein covalently bound to the 5′ ends. This is a characteristic of linear elements with inverted repeats at their ends such as the linear plasmid pCLP from M. celatum [19], also found in some actinomycetes, viruses, bacteriophages [21]. These elements belong to a class of genetic elements called invertrons [21]. Conjugative linear plasmids have been identified in Streptomyces spp. [22], [23]. Because of this ability to conjugate, these elements can be spread among other actinomycetes, including mycobacteria and related organisms.
Partial sequencing of pMA100 confirmed that this plasmid contains an intact copy of IS1245, which is inserted in a transposase-related sequence homolog to orfB of IS605 from M. gilvum plasmid pMFLV01 (acc. number: CP000657) and to a transposase identified in M. celatum plasmid pCLP (acc. number: AF312688). IS605 is an insertion sequence reported frequently in strains of Helicobacter pylori, but has also been described in other bacteria [24]. The insertion of an IS within another IS is not a rare event, it has been described in M. tuberculosis [25] and other bacteria, such as Pseudomonas syringae [26], Rhizobium meliloti [27] and Escherichia coli K-12 [28]. It has been previously shown that the genomic insertion loci of IS1245 and IS1311, in M. avium strains carrying a single copy of any of these insertion sequences, are located in areas containing putatively truncated integrases and/or transposases [29]. Likewise, the transposase-related sequence identified in pMA100 could be a preferential locus for insertion of IS1245.
There are few studies and experimental evidence of HGT in the genus Mycobacterium. Reports on natural HGT in mycobacteria have been mostly based on circumstantial evidence, such as sequence similarities in phylogenetically distant organisms [15], [30], [31], [32]. Recent genetic and genomic studies have provided evidence of the contribution of HGT to the emergence of members of the M. tuberculosis complex and Mycobacterium ulcerans [33], [34], [35]. M. ulcerans is phylogenetically related to Mycobacterium marinum and is thought to have diverged from a common progenitor by acquisition of the virulence plasmid pMUM001 [35]. Genome sequencing of the rapidly-growing mycobacterium Mycobacterium abscessus CIP 104536T, revealed that this strain acquired a full-length prophage containing non-mycobacterial genes and also a mercury resistance circular plasmid (23 kb) almost identical to plasmid pMM23 from M. marinum [36], thus suggesting the occurrence of HGT among mycobacteria. Promiscuous mycobacterial plasmids with the ability to propagate among different members of MAC have been identified, and they could promote the acquisition of genetic material through HGT in nature [15], [37], [38].
Experimental studies have demonstrated HGT in mycobacteria in conjugation and transformation events artificially induced in the laboratory. Gormley and Davies obtained the conjugative transfer of a mobile plasmid from Escherichia coli to M. smegmatis [39]. Conjugation-mediated Hfr (high frequency recombination)-like transfer of chromosomal DNA was described in M. smegmatis, with a mechanism distinct from that observed in E. coli Hfr strains and not mediated by plasmids [40]. Bhatt et al. showed spontaneous transference of hybrids of Streptomyces coelicolor conjugative plasmid SCP2* and Mycobacterium fortuitum plasmid pAL5000 from Streptomyces coelicolor or Streptomyces lividans to M. smegmatis mc2155 in plate crosses. This transfer was DNase I sensitive and thus involved release of DNA from Streptomyces [41]. All these previous experiments involved only rapidly-growing mycobacterial species. The mating experiments described here demonstrated the transfer of the linear plasmid pMA100 and the IS1245 element between slowly-growing mycobacteria.
We concluded that the most probable mechanism of acquisition of IS1245 by M. kansasii and M. bovis BCG in mating experiments was conjugation. The possibility that this transference occurred by transformation or transduction was not completely ruled out yet but would be very unlikely.
Transformation would require competent bacteria. There are no reports of slowly-growing mycobacteria being naturally competent and we did not carry out any procedure to produce competent mycobacteria before the mating experiments. High-efficiency transformation has been a major limitation in the study of mycobacteria and the most successful method to transform mycobacteria is by electroporation, which was not used here. Spontaneous plasmid transformation was observed with rapidly-growing M. smegmatis, but was limited to small plasmids, which were taken up intact, while larger plasmids suffered deletions [41]. We showed here that pMA100 was not transferred to M. smegmatis. It seems highly improbable that a linear molecule of ∼100 k that might contain proteins attached to its ends could be easily and repeatedly transferred by natural transformation.
Transfection would require the presence of lytic phages and we never detected lytic plaques in any of our plates (data not shown). Repeated phage transduction of a unique 100 kb plasmid to different recipient bacteria would be highly unlikely. Otherwise, if the 100 kb molecule corresponded to phage DNA, it would have to integrate in the chromosome (lysogenic cycle) in order to be stably maintained in the recipient strains, and therefore would not be detected as an extrachromosomal molecule in PFGE gels, as shown in Figure 4.
Moreover, we have demonstrated that pMA100 is a linear molecule with an invertron-like structure. Invertrons were shown to be responsible for conjugation transfer in Rhodococcus [42], [43], [44] and Streptomyces [45], [46]. Similarly to Mycobacterium, both genera belong to the class Actinobacteria.
According to the number of transconjugants carrying IS1245 in the mating experiment, the transfer frequency of pMA100 appears to be high under laboratory conditions. It is noteworthy that no transconjugants were obtained in mating experiments performed with M. smegmatis as the recipient bacterium. The analysis of more than 1,000 M. smegmatis colonies in mating experiments, suggests that this plasmid is not transferable from slow-growing to rapid-growing mycobacteria. Even though this conclusion needs further confirmation, it may indicate that conjugative mechanisms could differ between slow- and rapid-growing mycobacteria.
In conclusion, natural and experimental conjugation-mediated HGT between different species of slow-growing mycobacteria was demonstrated here for the first time. Details of the conjugation mechanism are still to be investigated. The presence of the IS1245 element in the conjugative plasmid pMA100 is one of the possible molecular mechanisms to explain the distribution of this insertion sequence in mycobacterial species other than M. avium.
The complete sequencing of this linear plasmid is in progress. Sequence analysis could generate important information about genes involved in the mechanism of horizontal transfer in mycobacteria. Moreover, it has the potential to expand our understanding of how these acquired genes may influence the virulence, evolution and genetic diversity of mycobacteria. Finally, molecular tools could be developed from this conjugative linear plasmid, which could be used in genetic studies in mycobacteria, particularly with the avirulent strain M. bovis BCG.
Materials and Methods
Bacterial isolates and strains
Fifteen colonies, named 88.1 to 88.15, used in this study, were isolated from a M. avium-M. kansasii mixed culture obtained from a single bone marrow specimen from an HIV-positive patient, as described in a previous study [12]. Four colonies (88.1. to 88.4) were identified as M. avium and 11 as M. kansasii by phenotypic characteristics (growth rate and pigment production) and by PCR-restriction enzyme analysis of the 16S–23S internal transcribed sequence (PRA-ITS) [47] (Table 2). The 11 M. kansasii colonies showed indistinguishable PFGE-DraI patterns, except for the presence of a band of approximately 100 kb in eight of the 11 isolates and were, in fact, the same strain [12]. Two M. kansasii clinical isolates, IAL 413 and IEC 6805, Mycobacterium smegmatis mc2155, Mycobacterium bovis BCG Moreau and Escherichia coli DH5α (Life Technologies Co., Carlsbad, CA) were used in this study (Table 2).
Mycobacteria were cultivated in Middlebrook 7H9 liquid medium supplemented with albumin, dextrose and catalase (7H9-ADC) (Becton Dickinson, Franklin Lakes, NJ) or in Middlebrook 7H10 solid medium supplemented with oleic acid, albumin, dextrose and catalase (7H10-OADC) and stored at −80°C until use. Luria-Bertani (LB) liquid or solid medium [48] were used to cultivate M. smegmatis mc2155 and E. coli. Mycobacterial genomic DNA was extracted from a loop full of culture grown on 7H10-OADC as described by van Soolingen et al. [49].
PCR-IS1245
A 427-bp fragment of the IS1245 element (sequence positions: 197 to 623 - accession number: L33879) was amplified using primers P1 (GCCGCCGAAACGATCTAC) and P2 (AGGTGGCGTCGAGGAAGAC), as described by Guerrero et al. [6].
PCR-IS6110
A 123-bp fragment of the IS6110 sequence (sequence positions: 762 to 883 - accession number: X17348) was amplified using primers IS1 (CCTGCGACGTAGGCGTCGG) and IS2 (CTCGTCCAGCGCCGCTTCGG) as described by Eisenach et al. [50].
PCR-pMA100
A 206-pb fragment of the sequenced region of pMA100 (sequence positions: 3029 to 3235 – accession number JN560941) was amplified with primers pMA100-1 (ACTCTCGGCTTCCTGTGTTG) and pMA100-2 (AGCGAAGTTCACCTTGGATG) with the same PCR conditions used to amplify a fragment of the IS1245 element.
Pulsed-field gel electrophoresis (PFGE)
High molecular weight DNA was prepared as described by Viana-Niero et al. [51] with some modifications. Bacteria were cultivated in 7H9-ADC at 37°C to an OD650 of 1–1.2. Cells were pelleted and frozen at −80°C for 1 h. After thawing, pellets were suspended in STE buffer (100 mM NaCl, 10 mM Tris-HCl, pH 8.0, 50 mM EDTA) with 0.1% Tween 80. The suspension was mixed with an equal volume of 1% low-melting preparative agarose (Bio-Rad Laboratories Inc., Hercules, CA) in 125 mM EDTA pre-warmed to 55°C, and the mixture was cast into plug molds. The plugs were treated overnight with 2 ml of 10 mg.ml−1 lysozyme in STE and incubated at 4°C for 1 h in 0.5 M EDTA plus 1% Sarkosyl. Proteinase K (RBC Bioscience Co., Taipei, Taiwan) was added at a final concentration of 2 mg.ml−1, and the plugs were incubated at 55°C for 24 h and then at 4°C for 1 h. Plugs were washed with 1X Tris-EDTA (TE: 10 mM Tris-HCl pH 8.0, 1 mM EDTA) and incubated in 1X TE containing 0.12 mg.ml−1 phenylmethylsulfonyl fluoride (Sigma-Aldrich Corp., St. Louis, MO) for 1 h at 55°C. Plugs were washed with 1X TE and stored in 0.5 M EDTA at 4°C until used. Plugs were washed in 0.05 M EDTA and loaded on 1% pulsed-field-certified agarose gels (Bio-Rad) in 0.5 X TBE buffer (45 mM Tris-HCl, 45 mM boric acid, 1 mM EDTA, pH 8.0). PFGE was carried out in a CHEF-DR III system (Bio-Rad) at 14°C for 24 h at 6 V.cm−1 with switch times of 1.6 to 21.3 s. Bacteriophage lambda ladder PFG marker (New England BioLabs, Ipswitch, MA) was used as molecular standard. For digestion, plugs were extensively washed in TE and incubated with DraI (Promega, Madison, WI) at 37°C overnight.
Southern blot hybridization
After PFGE, DNA was blotted onto nylon membranes (Hybond-N-plus; GE Healthcare, Little Chalfont, UK) and probed with an IS1245 complementary probe, prepared by PCR with primers P1/P2 with DNA from M. avium ATCC 25291T and purified with QIAquick PCR Purification kit (Qiagen, Valencia, CA), and labeled with [α−32P]dCTP with Ready-To-Go DNA Labeling Beads (GE Healthcare), according to manufacturers' instructions.
Characterization of pMA100
Experiments were carried out to determine if the pMA100 molecule was linear or circular. First, its migration in PFGE under three different switch times, 1.6 to 21.3 s, 1 to 30 s, and 10 to 50 s, was evaluated [52].
Besides that, the pMA100 band excised from PFGE agarose gels was treated in separate experiments with 30 U exonuclease III, 30 U exonuclease lambda or 30 U topoiosomerase I (all enzymes from New England BioLabs) for 3 h at 37°C, according to the manufacturer's protocols. The reactions were stopped by adding 50 mM EDTA and cooling to 4°C for 15 min, and the results were evaluated by PFGE.
In separate experiments, proteinase K was omitted during preparation of the plugs to investigate whether pMA100 contained a covalently bound protein. DNA treated or not with proteinase K was subjected to PFGE or to sodium dodecyl sulfate (SDS)-PFGE, i.e., after adding SDS (final concentration 0.2%) to both buffer and agarose gel preparation.
Cloning and sequencing of KpnI restriction fragments containing the IS1245 element
DNA from M. kansasii colony 88.8 was digested with KpnI at 37°C for 2 h, and subjected to RFLP-IS1245, performed as described by van Soolingen et al. [49]. The sizes of fragments hybridizing with the IS1245 probe were calculated using the BioNumerics program version 5.1 (AppliedMaths, Sint-Martens-Latem, Belgium). Agarose gel slices containing the selected KpnI bands were excised from a second gel, and DNA purified using the Gel Extraction Kit (Qiagen), and ligated to pBluescript SK+ (Stratagene, Santa Clara, CA) digested with KpnI and dephosphorylated (CIAP; Life Technologies). Competent E. coli DH5α cells were transformed with the ligation products, and recombinant plasmids were selected on LB-agar plates containing 100 µg.ml−1 ampicillin, 0.25 mM IPTG and 1 mM X-Gal (Life Technologies). Colony lifts were carried out on Whatman 541 filters and were hybridized with the IS1245-derived probe, labeled with [α−32P]dCTP, according to the protocol described by Maas [53]. E. coli DH5α transformed with the plasmid pMA12, which contains the 427-bp fragment of IS1245, was used as the positive control of hybridization [49].
Recombinant plasmids were purified from positive colonies, identified after exposure to autoradiographic films, using Qiaprep Spin miniprep kit (Qiagen), and the inserts were sequenced using M13 primers and BigDye Terminator Cycle Sequencing Ready Reaction kit (Life Technologies) in an automated ABI Prism 377 sequencer (Life Technologies). Sequences were compared against the GenBank database using BLAST (http://www.ncbi.nlm.nih.gov/blast).
The obtained sequence was deposited under GenBank accession number JN560941.
Mating experiments
Mating experiments were performed using M. avium 88.3 from the M. avium-M. kansasii mixed culture, bearing pMA100, as donor. Three M. kansasii strains, colony 88.6 (isolated from the mixed culture), IEC 6805 and IAL 413, M. smegmatis mc2155, and M. bovis BCG Moreau were used as recipients. All recipient strains were negative for the presence of both IS1245 and pMA100, as assessed by PCR-IS1245 and Southern blot hybridization of pulsed-field gels with the IS1245 derived probe, respectively.
Mating experiments were carried out on 7H10 agar plates as described by Parsons et al. [54] with some modifications. Donor and recipient strains cultures in 7H9-ADC liquid medium were incubated on a shaker at 37°C until DO600∼1.2 was reached. Aliquots of 0.5 ml of each culture were centrifuged at 14,000×g for 2 min and pellets were suspended in 0.5 ml of 7H9-ADC. Each mating pair suspension was combined and filtered through sterile 0.45 µm membranes (Millipore, Billerica, MA). These filters were incubated on 7H10-OADC plates at 37°C or 30°C. After different mating periods, the filters were transferred to sterile containers and washed with 7H9-ADC. Bacteria were resuspended in 1 ml of 7H9-ADC, and the suspensions were diluted and plated on 7H10-OADC (when M. kansasii or M. bovis BCG was used as the recipient strain) or LB (when M. smegmatis was the recipient strain) agar plates to obtain isolated colonies.
No selective medium was used to screen transconjugants, because no selection marker has been identified so far in pMA100, and a mixture of donor, recipient and transconjugant colonies was recovered on the 7H10-OADC plates. Only isolated colonies showing the characteristics of the recipient strain were used for screening of transconjugants by PCR-IS1245. M. kansasii colonies were identified by the production of yellow pigment after exposure to light. M. bovis BCG colonies were identified by PCR-IS6110. When M. smegmatis was used as recipient, the mating mixture was plated on LB agar, where M. avium cannot grow, and only M. smegmatis colonies were recovered.
Recipient colonies that generated IS1245 amplicons after the mating experiments were assumed to be transconjugants.
The presence of plasmid pMA100 and IS1245 in transconjugants was confirmed by PFGE and hybridization with the IS1245-derived probe and with a probe derived from the pMA100 sequenced region, labeled with [α−32P]dCTP. Each transconjugant was compared to the corresponding wild type strain by PFGE with DraI digested DNA.
Acknowledgments
We thank Erica Chimara and Maria Luiza Lopes for providing M. kansasii clinical strains and Cristina Viana-Niero, Mônica Vieira Midoli, Ana Carolina de Mello Santos, and Jesus Yubero for excellent technical assistance. Dr. A. Leyva helped with English editing of the manuscript.
Author Contributions
Conceived and designed the experiments: SCL RMS MJG. Performed the experiments: MCdSR RSdO CKM. Analyzed the data: LGPdA MCM. Contributed reagents/materials/analysis tools: RSO LGPdA MJG SCL. Wrote the paper: MCdSR SCL.
References
- 1. Mahillon J, Chandler M (1998) Insertion sequences. Microbiol Mol Biol Rev 62: 725–774.
- 2.
Guilhot C, Jackson M, Gicquel B (1999) Mobile genetic elements and plasmids: tools for genetic studies. In: Ratledge C, Dale J, editors. Mycobacteria: molecular biology and virulence. Oxford: Blackwell Science Ltd. pp. 17–37.
- 3. Tortoli E, Rindi L, Garcia MJ, Chiaradonna P, Dei R, et al. (2004) Proposal to elevate the genetic variant MAC-A, included in the Mycobacterium avium complex, to species rank as Mycobacterium chimaera sp. nov. Int J Syst Evol Microbiol 54: 1277–1285.
- 4. Murcia MI, Tortoli E, Menendez MC, Palenque E, Garcia MJ (2006) Mycobacterium colombiense sp. nov., a novel member of the Mycobacterium avium complex and description of MAC-X as a new ITS genetic variant. Int J Syst Evol Microbiol 56: 2049–2054.
- 5. Inderlied CB, Kemper CA, Bermudez LE (1993) The Mycobacterium avium complex. Clin Microbiol Rev 6: 266–310.
- 6. Guerrero C, Bernasconi C, Burki D, Bodmer T, Telenti A (1995) A novel insertion element from Mycobacterium avium, IS1245, is a specific target for analysis of strain relatedness. J Clin Microbiol 33: 304–307.
- 7. Mijs W, de Haas P, Rossau R, Van der Laan T, Rigouts L, et al. (2002) Molecular evidence to support a proposal to reserve the designation Mycobacterium avium subsp. avium for bird-type isolates and 'M. avium subsp. hominissuis' for the human/porcine type of M. avium. Int J Syst Evol Microbiol 52: 1505–1518.
- 8. Oliveira RS, Sircili MP, Oliveira EMD, Balian SC, Ferreira-Neto JS, et al. (2003) Identification of Mycobacterium avium genotypes with distinctive traits by combination of IS1245-RFLP and restriction analysis of hsp65. J Clin Microbiol 41: 44–49.
- 9. Pestel-Caron M, Arbeit RD (1998) Characterization of IS1245 for strain typing of Mycobacterium avium. J Clin Microbiol 36: 1859–1863.
- 10. Ritacco V, Kremer K, van der Laan T, Pijnenburg JE, de Haas PE, et al. (1998) Use of IS901 and IS1245 in RFLP typing of Mycobacterium avium complex: relatedness among serovar reference strains, human and animal isolates. Int J Tuberc Lung Dis 2: 242–251.
- 11. Keller AP, Beggs ML, Amthor B, Bruns F, Meissner P, et al. (2002) Evidence of the presence of IS1245 and IS1311 or closely related insertion elements in nontuberculous mycobacteria outside of the Mycobacterium avium complex. J Clin Microbiol 40: 1869–1872.
- 12. da Silva Rabello MC, de Oliveira RS, Silva RM, Leao SC (2010) Natural occurrence of horizontal transfer of Mycobacterium avium- specific insertion sequence IS1245 to Mycobacterium kansasii. J Clin Microbiol 48: 2257–2259.
- 13. Gutierrez MC, Brisse S, Brosch R, Fabre M, Omais B, et al. (2005) Ancient origin and gene mosaicism of the progenitor of Mycobacterium tuberculosis. PLoS pathogens 1: e5.
- 14.
Hatfull GF, Jacobs WR Jr (1994) Mycobacteriophages: cornerstones of mycobacterial research. In: Boloom BR, editor. Tuberculosis: Pathogenesis, Protection and Control. Washington, DC: ASM Press. pp. 165–183.
- 15. Le Dantec C, Winter N, Gicquel B, Vincent V, Picardeau M (2001) Genomic sequence and transcriptional analysis of a 23-kilobase mycobacterial linear plasmid: evidence for horizontal transfer and identification of plasmid maintenance systems. J Bacteriol 183: 2157–2164.
- 16. Stinear TP, Pryor MJ, Porter JL, Cole ST (2005) Functional analysis and annotation of the virulence plasmid pMUM001 from Mycobacterium ulcerans. Microbiology 151: 683–692.
- 17. Coleman NV, Spain JC (2003) Distribution of the coenzyme M pathway of epoxide metabolism among ethene- and vinyl chloride-degrading Mycobacterium strains. Appl Environ Microbiol 69: 6041–6046.
- 18. Picardeau M, Vincent V (1997) Characterization of large linear plasmids in mycobacteria. J Bacteriol 179: 2753–2756.
- 19. Picardeau M, Vincent V (1998) Mycobacterial linear plasmids have an invertron-like structure related to other linear replicons in actinomycetes. Microbiology 144 ( Pt7): 1981–1988.
- 20. Bauer J, Andersen AB (1999) Stability of insertion sequence IS1245, a marker for differentiation of Mycobacterium avium strains. J Clin Microbiol 37: 442–444.
- 21. Sakaguchi K (1990) Invertrons, a class of structurally and functionally related genetic elements that includes linear DNA plasmids, transposable elements, and genomes of adeno-type viruses. Microbiol Rev 54: 66–74.
- 22. Chen CW, Yu TW, Lin YS, Kieser HM, Hopwood DA (1993) The conjugative plasmid SLP2 of Streptomyces lividans is a 50 kb linear molecule. Mol Microbiol 7: 925–932.
- 23. Hosted TJ, Wang T, Horan AC (2004) Characterization of the Streptomyces lavendulae IMRU 3455 linear plasmid pSLV45. Microbiology 150: 1819–1827.
- 24. Kersulyte D, Mukhopadhyay AK, Shirai M, Nakazawa T, Berg DE (2000) Functional organization and insertion specificity of IS607, a chimeric element of Helicobacter pylori. J Bacteriol 182: 5300–5308.
- 25. Fang Z, Doig C, Morrison N, Watt B, Forbes KJ (1999) Characterization of IS1547, a new member of the IS900 family in the Mycobacterium tuberculosis complex, and its association with IS6110. J Bacteriol 181: 1021–1024.
- 26. Soby S, Kirkpatrick B, Kosuge T (1993) Characterization of an insertion sequence (IS53) located within IS51 on the iaa-containing plasmid of Pseudomonas syringae pv. savastanoi. Plasmid 29: 135–141.
- 27. Laberge S, Middleton AT, Wheatcroft R (1995) Characterization, nucleotide sequence, and conserved genomic locations of insertion sequence ISRm5 in Rhizobium meliloti. J Bacteriol 177: 3133–3142.
- 28. Blattner FR, Plunkett G 3rd, Bloch CA, Perna NT, Burland V, et al. (1997) The complete genome sequence of Escherichia coli K-12. Science 277: 1453–1462.
- 29. Murcia MI, Garcia MJ, Otal I, Gomez AB, Menendez MC (2007) Molecular features of Mycobacterium avium human isolates carrying a single copy of IS1245 and IS1311 per genome. FEMS Microbiol Letters 272: 229–237.
- 30. Gamieldien J, Ptitsyn A, Hide W (2002) Eukaryotic genes in Mycobacterium tuberculosis could have a role in pathogenesis and immunomodulation. Trends Genet 18: 5–8.
- 31. Kinsella RJ, McInerney JO (2003) Eukaryotic genes in Mycobacterium tuberculosis? Possible alternative explanations. Trends Genet 19: 687–689.
- 32. Poelarends GJ, Kulakov LA, Larkin MJ, van Hylckama Vlieg JE, Janssen DB (2000) Roles of horizontal gene transfer and gene integration in evolution of 1,3-dichloropropene- and 1,2-dibromoethane-degradative pathways. J Bacteriol 182: 2191–2199.
- 33. Becq J, Gutierrez MC, Rosas-Magallanes V, Rauzier J, Gicquel B, et al. (2007) Contribution of horizontally acquired genomic islands to the evolution of the tubercle bacilli. Mol Biol Evol 24: 1861–1871.
- 34. Rosas-Magallanes V, Deschavanne P, Quintana-Murci L, Brosch R, Gicquel B, et al. (2006) Horizontal transfer of a virulence operon to the ancestor of Mycobacterium tuberculosis. Mol Biol Evol 23: 1129–1135.
- 35. Stinear TP, Jenkin GA, Johnson PD, Davies JK (2000) Comparative genetic analysis of Mycobacterium ulcerans and Mycobacterium marinum reveals evidence of recent divergence. J Bacteriol 182: 6322–6330.
- 36. Ripoll F, Pasek S, Schenowitz C, Dossat C, Barbe V, et al. (2009) Non mycobacterial virulence genes in the genome of the emerging pathogen Mycobacterium abscessus. PloS one 4: e5660.
- 37. Jucker MT, Falkinham JO 3rd (1990) Epidemiology of infection by nontuberculous mycobacteria IX. Evidence for two DNA homology groups among small plasmids in Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium scrofulaceum. Am Rev Respir Dis 142: 858–862.
- 38. Kirby C, Waring A, Griffin TJ, Falkinham JO 3rd, Grindley ND, et al. (2002) Cryptic plasmids of Mycobacterium avium: Tn552 to the rescue. Mol Microbiol 43: 173–186.
- 39. Gormley EP, Davies J (1991) Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. J Bacteriol 173: 6705–6708.
- 40. Wang J, Parsons LM, Derbyshire KM (2003) Unconventional conjugal DNA transfer in mycobacteria. Nat Genet 34: 80–84.
- 41. Bhatt A, Kieser HM, Melton RE, Kieser T (2002) Plasmid transfer from Streptomyces to Mycobacterium smegmatis by spontaneous transformation. Mol Microbiol 43: 135–146.
- 42. Shimizu S, Kobayashi H, Masai E, Fukuda M (2001) Characterization of the 450-kb linear plasmid in a polychlorinated biphenyl degrader, Rhodococcus sp. strain RHA1. Applied and Environmental Microbiology 67: 2021–2028.
- 43. Dabrock B, Kesseler M, Averhoff B, Gottschalk G (1994) Identification and characterization of a transmissible linear plasmid from Rhodococcus erythropolis BD2 that encodes isopropylbenzene and trichloroethene catabolism. Applied and Environmental Microbiology 60: 853–860.
- 44. Crespi M, Vereecke D, Temmerman W, Van Montagu M, Desomer J (1994) The fas operon of Rhodococcus fascians encodes new genes required for efficient fasciation of host plants. Journal of bacteriology 176: 2492–2501.
- 45. Chen CW, Yu TW, Lin YS, Kieser HM, Hopwood DA (1993) The conjugative plasmid SLP2 of Streptomyces lividans is a 50 kb linear molecule. Molecular microbiology 7: 925–932.
- 46. Zotchev SB, Soldatova LI, Orekhov AV, Schrempf H (1992) Characterization of a linear extrachromosomal DNA element (pBL1) isolated after interspecific mating between Streptomyces bambergiensis and S. lividans. Research in microbiology 143: 839–845.
- 47. Roth A, Reischl U, Streubel A, Naumann L, Kroppenstedt RM, et al. (2000) Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases. J Clin Microbiol 38: 1094–1104.
- 48.
Sambrook J, Russell D (2001) Molecular Cloning:a Laboratory Manual. New York: Cold Spring Harbor Laboratory Press.
- 49. van Soolingen D, Bauer J, Ritacco V, Leao SC, Pavlik I, et al. (1998) IS1245 restriction fragment length polymorphism typing of Mycobacterium avium isolates: proposal for standardization. J Clin Microbiol 36: 3051–3054.
- 50. Eisenach KD, Cave MD, Bates JH, Crawford JT (1990) Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J Infect Dis 161: 977–981.
- 51. Viana-Niero C, Lima KV, Lopes ML, da Silva Rabello MC, Marsola LR, et al. (2008) Molecular characterization of Mycobacterium massiliense and Mycobacterium bolletii in isolates collected from outbreaks of infections after laparoscopic surgeries and cosmetic procedures. J Clin Microbiol 46: 850–855.
- 52. Picardeau M, Prod'Hom G, Raskine L, LePennec MP, Vincent V (1997) Genotypic characterization of five subspecies of Mycobacterium kansasii. J Clin Microbiol 35: 25–32.
- 53. Maas R (1983) An improved colony hybridization method with significantly increased sensitivity for detection of single genes. Plasmid 10: 296–298.
- 54. Parsons LM, Jankowski CS, Derbyshire KM (1998) Conjugal transfer of chromosomal DNA in Mycobacterium smegmatis. Mol Microbiol 28: 571–582.