Ethics Statement

Written informed consent was obtained from all healthy voluntary donors involved in the study (commissioned by the local ethic committee of the Friedrich-Alexander Universität Erlangen-Nürnberg, Ethics proposal 2247, 10.07.2000). All data were analyzed anonymously.

Cells

Primary human mononuclear cells (MNCs) were obtained from blood of healthy voluntary donors (commissioned by the local ethic committees) by density gradient centrifugation using endotoxin-free Ficoll-Paque-PLUS® (Amersham Pharmacia Biotech AB, Uppsala, Sweden). CD8^pos and CD4^pos T cells were isolated from MNCs by negative magnetic selection using microbeads (Miltenyi Biotec, Bergisch-Gladbach, Germany). T cells were cultured in R10-IL2 medium consisting of RPMI 1640 supplemented with 10% FBS and 100 U/ml IL-2 (Millipore, Billerica, MA). 293T cells and the myeloid cell lines MONO-MAC-6, U-937, HL-60, NB-4, OCI-AML5, MV4-11, KG-1a, and THP-1 were obtained from the German Resource Center for Biologic Material (DSMZ, Braunschweig, Germany), the glioblastoma cell line U-373 was obtained from ATCC. The ESFT cell lines STA-ET-1, -2, -3, -6, -8.2, -10, -11, ER-ESFT-1 were generated in house [18], [19], CADO-ES1, TC-71, WE-68, VH-64 were provided by Frans van Valen [20]. All ESFT cell lines were maintained in culture dishes, which were pre-coated for 2 hours at RT with a 0.1% gelatin solution in PBS. Murine cell lines stably, expressing either human ULBP2 or MICA, were generated by transduction of Ba/F3 pre-B cells with a pMX-pie based retroviral expression vector [21]. All cell lines were maintained in RPMI 1640 supplemented with 10% FBS and IFN-γ when indicated.

Generation of chNKG2D

The extracellular portion of human NKG2D (aa82–216) was amplified by PCR from a plasmid containing the NKG2D cDNA sequence by using the primers 5′-cgaatagtccatggaagcttagccaccatgccgctgctgctactgctgcccctgctgtgggcaggggccctggctatgggtacctctagattattcaaccaagaagttcaaattccc-3′ containing a Kozak-sequence (bold), CD33 signal peptide sequence (underlined), restriction sites (italic) of NcoI and HindIII downstream; 5′-gatgtcacggatccccgccaccgcccgatccaccacctcctgaca-cagtcctttgcatgcagatg-3′ with a BamHI-site (bold) and the Gly4Ser-Gly4Asp-linker (underlined). The PCR product was cloned by NcoI×BamHI restriction into the retroviral vector pBullet 607 containing the IgG1-Fc/CD28/CD3ζ backbone [22]. For in vitro transcription, the NKG2D portion was recloned from the pB607/NKG2D vector into the pGEM4Z-CEA vector, also containing the IgG1-Fc/CD28/CD3ζ backbone, by NcoI×BamHI restriction. The NKG2D portion was additionally recloned from the pB607/NKG2D vector into a derivate of the vector pST1 (provided by U. Sahin) for transcription of “RNA #2”. The scFv-portion of a Cytomegalovirus glycoprotein gB (CMV-gB)-specific IgG1-Fc/CD28/CD3ζ-CAR-construct [23] was replaced by HindIII×BamHI restriction. After recloning, the polyA tail was found to be shortened from 120 to approximately 100 A nucleotides as estimated by Eco53KI restriction. This vector was linearized for in vitro transcription with LguI to produce a polyA-tail devoid of non-A nucleotides. For lentiviral expression NKG2D/IgG1-Fc/CD28/CD3ζ was excised from pB607/NKG2D by HindIII×BspEI restriction and cloned into the PmeI site of the lentiviral plasmid pWPI (D. Trono, Geneva).

In vitro transcription and RNA-electroporation

In vitro transcription and electroporation was performed as previously described [24]. Briefly, in vitro transcription was performed with linearized pGEM4Z-NKG2D or pST1-NKG2D using the mMESSAGE-mMACHINE-T7 Ultra kit (Applied Biosystems/Ambion) followed by polyadenylation. The vector pST1 was developed by Holtkamp et al. [25] to allow in vitro transcription of a more stable mRNA and the kit used for in vitro transcription was optimized for a more efficient translation initiation by using the modified anti-reverse cap analog (ARCA, 7-methyl(3′-O-methyl)GpppG)m7G(5′)ppp(5′)G). RNA from a cognate CMV-gH-specific IgG1-Fc/CD28/CD3ζ-CAR (Goetz G., unpublished) served as control. Electroporation was performed with 10 µg RNA/100 µl Opti-MEM containing ≤6×10⁶ CD8^pos or CD4^pos T cells either immediately after isolation or 12 days after activation with an anti-CD3-antibody (clone OKT3). Anti-CD3-activation was performed by plating 0.2×10⁶ T cells/ml on wells pre-coated with 10 µg/ml of anti-CD3-antibody in R10-IL2 medium. After two days the cells were transferred to fresh wells without anti-CD3-antibody. Half of the medium was replaced twice a week. Electroporated T cells were further cultured in R10-IL2 medium and used for functional analysis one day after RNA transfection.

Production of lentivirus and transduction of T cells

293T cells were seeded in 75 cm² flasks and transfected using Lipofectamine 2000 (Invitrogen Corporation, Bethesda, MD) according to manufacturer's instructions. The pWPI vector plasmid containing the chNKG2D was cotransfected together with psPAX2 (packaging) and pMD2.G (VSV-G, envelope) in a ratio of 4∶3∶1 (total 15 µg plasmid) with 12.5 µl Lipofectamine 2000 per flask. The supernatants were collected 48 hours after transfection by centrifugation (10 min, 2000 rpm) to remove cell debris, and were stored at −80°C until further usage. Prior to transduction primary human cells were activated over night by 2.4 µg/ml PHA in R10-IL2 medium. Transduction was performed by spinoculation of 0.5–1×10⁶ cells with 0.5 ml of virus containing supernatant (minimum 0.5 µg p24; quantified by ELISA), supplemented with 5 µg/ml Polybrene (Sigma), at 1500×g for 4 hours at 33°C. After an additional incubation over night at 37°C the cells were washed twice and further maintained in R10-IL2 medium. For enrichment of chNKG2D^pos cells irradiated ULBP2 expressing murine Ba/F3 cells were added 1∶1 in weekly intervals. Control T cells transduced with a pWPI vector containing a cognate CMV-gB-specific CAR [23] were enriched by co-culture with irradiated murine IIA1.6 cells stably expressing CD64 (provided by Jan van de Winkel; University Medical Center Utrecht, The Netherlands). The immunophenotype of transduced T cells was controlled by flow cytometry before functional analysis (data not shown). Only pure CD3^pos TCRα/β^pos cultures not containing NK cells were used in functional assays seven to ten days after the last stimulation with ligand^pos target cells.

Flow cytometry

Human cells were analyzed by anti-CD3 (clone S4.1), anti-CD4 (clone SK3), anti-CD8 (clone SK1), anti-CD56 (clone NCSM16.2), anti-pan TCR-alpha/beta (clone BMA031), anti-MHC-class-I (clone Tü149), and appropriately labeled IgG1 and IgG2b isotype controls. Expression of chNKG2D was detected either by anti-CD314 (clone 1D11) or via its human IgG1-Fc portion using biotinylated anti-human-Fc (clone JDC-10) and streptavidin-PE. NKG2D-Ls were analyzed with anti-MICA (clone AMO1), anti-MICB (clone BMO2), anti-ULBP1 (clone AUMO2), anti-ULBP2 (clone BUMO1), anti-ULBP3 (clone CUMO3) (all from Axxora Life Sciences Inc., San Diego, CA) and an APC-labeled goat-anti-mouse-IgG used as secondary antibody.

ELISA

50 000 activated T cells were co-cultured with 100 000 target cells in 0.5 ml of R10-IL2 medium supplemented with 0.3% Sandoglobulin® (CSL Behring, King of Prussia, PA). Co-culture with ESFT cells was performed in gelatin coated wells. Supernatants were harvested after 20 hours and TNF, FasL, and TRAIL were determined by using ELISA kits from Mabtech, Diaclone, and BD Biosciences, respectively, according to the manufacturer's instructions. The figures show total cytokine levels without background subtraction.

Cytotoxicity assay

The cytoxic activity was analyzed either by determining target cell lysis using a non-radioactive Europium (Eu)-based assay or, if Eu-labeling of target cells was inefficient, by determining apoptosis induction in target cells by flow cytometry. Europium assay: ESFT cells were harvested by trypsin/EDTA treatment and labeled with Eu as previously described [26]. Eu released from 1000 labeled target cells was determined in the supernatants after 4 hours of co-culture. Specific lysis was calculated by the formula: % lysis = (experimental counts minus spontaneous release)×100/(maximum release minus spontaneous release). Annexin V apoptosis assay: Target cells were harvested, washed in PBS and labeled by incubation with 2 µM SNARF-1 carboxylic acid, acetate succimidyl ester (Invitrogen) in PBS for 15 minutes at 37°C. Labeled cells (5000) were preincubated with 1% Sandoglobulin® for 20 minutes and then co-cultured with effector T cells at the indicated ratios in 200 µl R10-IL2 medium in a 96 well round bottom plate. After 5 hours, the cells were harvested by trypsin/EDTA and then supplemented with 1% FBS, 2 mM CaCl₂, and Annexin V-FITC. The fraction of Annexin V^pos cells of SNARF-labeled target cells was determined by flow cytometry (measured in FL4). The percentage of spontaneous Annexin V^pos target cells (in absence of T cells) was subtracted as unspecific background and the fraction of “specific” Annexin V^pos targets actually induced by T cells was calculated by the formula: % Annexin V^pos = (Annxin V^pos of co-culture minus spontaneous Annexin V^pos)×100/(100 minus spontaneous Annexin V^pos). The fraction of spontaneous Annexin V^pos and maximum possible Annexin V^pos (100%) cells were corrected by the fraction of actually ligand expressing cells of the stably transfected cell line Ba/F3 (70–90%).

Statistical analysis

Statistical significance was estimated with the paired two-tailed Student's t test (*** = P<0.001, ** = P<0.01, * = P<0.05, ns = P>0.05).

Expression of NKG2D-ligands in ESFT

The expression of different NKG2D-Ls has been reported previously for several ESFT cell lines [4]. Here, we screened 14 ESFT cell lines for the expression of MICA, MICB, and ULBP1, ULBP2, and ULBP3 by flow cytometry. The results emphasize that NKG2D-Ls appear to be broadly expressed by ESFT cell lines, although some (STA-ET-1, -6, -8.2, -10, -11) displayed only fairly low ligand expression (Fig. 1). Most cell lines expressed MICA and frequently also ULBP1 and/or ULBP2. MICB was only weakly expressed in some cell lines and ULBP3 was consistently absent. From the data we concluded that NKG2D-Ls might allow targeting of a broad range of ESFT cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Expression of NKG2D-Ls in ESFT.

The histograms show the surface expression of the respective NKG2D-Ls recognized by specific monoclonal antibodies and analyzed by flow cytometry (filled histograms = specific antibodies; open histograms = isotype controls). The two stably transfected murine B cell lines (Ba/F3) expressing either human MICA or ULBP2 are displayed for comparison.

https://doi.org/10.1371/journal.pone.0031210.g001

Construction of the chNKG2D

Existing signaling platforms of CARs are derived from type I transmembrane proteins with extra-cellular N- and intra-cellular C-terminus. NKG2D, contrary to most transmembrane proteins, however, is a type II receptor with inverse orientation. Fusion of NKG2D with the existing signaling platforms therefore could alter their configuration and function. To avoid this and to allow future improvements of signaling we tested the option of constructing a chNKG2D with type I orientation. The ectodomain of wildtype NKG2D forms non-covalent homo-dimers and is linked to the transmembrane domain via a 21 amino acid residues (aa) long highly flexible anchor (aa75–95). Analyzing the published crystal structure (Protein Data Bank; accession code 1HYR) revealed that the C-terminal end of NKG2D protrudes from the globular ectodomain in close proximity to the entry site of the membrane anchor (Fig. 2A) [16]. Thus, we hypothesized that the NKG2D ectodomain could be alternatively anchored via a C-terminal linkage without disturbing its relative positioning. This should allow its integration into a CAR composed of a well established IgG1-Fc/CD28/CD3ζ signaling platform with type I orientation [22]. We chose to truncate the NKG2D ectodomain within its native membrane anchor at aa81 thereby removing the transmembrane and intracellular portion of NKG2D and to fuse its C-terminal end (aa216) via an artificial flexible Gly/Ser-linker to the N-terminus of the IgG1-Fc/CD28/CD3ζ molecule. The flexible upper hinge residues (DKTHT) followed by the hinge core residues (CPPC) containing the inter-chain disulfide bonds of IgG1-Fc served as N-terminal acceptor site of the signaling platform [27]. We calculated that a linker consisting of two Gly/Ser-repeats (GGGGSGGGGD; last serine replaced by hydrophilic aspartic acid) would by appropriate to allow sufficient flexibility for homo-dimeric pairing of the extra-cellular NGK2D portions but not to provoke sensitivity to proteolytic degradation. Wildtype NKG2D after translation into the endoplasmatic reticulum is directed to the cell surface via an uncleaved type II transmembrane signal anchor. This anchor was replaced in the chimeric receptor by the type I transmembrane signal anchor of CD28. Furthermore, as type I membrane proteins require also cleavable N-terminal signals for appropriate insertion into the cell membrane, we introduced the cleavable N-terminal signal peptide of CD33, which is removed in the mature protein. Figure 2A displays a scheme of the final mature fusion protein.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Construction and characterization of the chNKG2D.

A, The figure schematically illustrates the domain architecture of wildtype NKG2D and chNKG2D (N = N-terminus, C = C-terminus, CM = cytoplasma membrane). The N-terminal truncation of the extracellular NKG2D domain at aa81 is indicated by a bold bar. The native C-terminal end of NKG2D was fused to the N-terminus of the IgG1-Fc/CD28/CD3ζ transmembrane signaling platform creating a transmembrane receptor of type I orientation in which the relative orientation and positioning of the NKG2D ectodomain has not been changed. B, efficient transfection and strong surface expression of chNKG2D by electroporation of mRNA into primary T cells. The histograms show the surface expression of chNKG2D 24 hours after electroporation of quiescent or anti-CD3-activated human T cells (thick line, open histogram). Analysis was performed by flow cytometry using an anti-CD314 antibody. The expression of endogenous wildtype NKG2D in T transfected with a CMV-gH-specific CAR is shown for comparison (thin line, open histograms; filled histograms = isotype controls). C, chNKG2D triggers cytotoxicity of activated T cells. Quiescent or anti-CD3-activated CD8^pos or CD4^pos T cells were transfected with RNA encoding either the chNKG2D or a CMV-gH-specific control receptor. One day after transfection, the T cells were co-cultured with dye-labeled murine B cells (Ba/F3-MICA) stably expressing the human NKG2D-L MICA. The diagram shows the percentage of Annexin V^pos murine target cells after 5 hours of co-culture at the indicated E∶T ratios (data pooled from three independent experiments using different cell donors; mean ± S.D.). Statistical significance was calculated for the effects of activated T cells expressing the chNKG2D versus T cells expressing the control receptor.

https://doi.org/10.1371/journal.pone.0031210.g002

Transfer of chNKG2D into different T cell populations by electroporation of mRNA

T-cell activation might be required for triggering effector functions also in the CD45RO^pos T cell subpopulation [28], however, induced proliferation might accelerate the loss of chNKG2D expression due to dilution of transfected mRNA. Thus, we compared resting and activated T cells. CD8^pos and CD4^pos T cells were purified from peripheral blood and electroporated either directly or 12 days after activation via CD3, when proliferation had declined again. Figure 2B shows the expression of chNKG2D one day after transfection. Detection was done by an anti-NKG2D(CD314)-antibody, which also detects endogenous NKG2D expressed in CD8^pos T cells. T cells transfected with a CMV-gH-specific control CAR [23] were thus included in Figure 2B for comparison. ChNKG2D-mRNA-transfected T cells displayed strongly increased anti-NKG2D-staining compared to CMV-gH-CAR controls. Based on peak channel numbers from three independent experiments using cells from different donors, we calculated a 5–9-fold increased chNKG2D expression density in chNKG2D-RNA-transfected activated CD8^pos T cells compared to endogenous NKG2D (Fig. 2B and data not shown). The expression of chNKG2D was homogeneous and augmented following cell activation both in CD4^pos and CD8^pos T cells compared to the resting cells.

NKG2D-Ls are monomeric and are recognized only by the homo-dimerized native NKG2D receptor by asymmetric binding of the α1- and the α2-epitopes of the ligands [16]. Here, we evaluated the functional activity of the novel chNGK2D type. Figure 2C shows that chNKG2D^pos T cells can induce apoptosis in a murine cell line stably expressing the NKG2D-ligand MICA (Fig. 1). This experiment also illustrates that resting chNKG2D^pos T cells were clearly inferior to CD3-activated chNKG2D^pos T cells, which killed their target cells even at an effector∶target (E∶T) ratio of only 1∶1. Importantly, apoptosis in MICA^pos targets was induced both by chNKG2D-expressing CD8^pos as well as CD4^pos T cells. The data so far confirmed that the novel recombinant chNKG2D is functional and that RNA transfection allows high level expression on the surface of primary T cells.

ESFT cells are killed by T cells transfected with chNKG2D mRNA

In the following experiments we tested the capacity of RNA transfected activated T cells to recognize ESFT cells with varying and partially low ligand density (Fig. 1). Figure 3A illustrates the lysis of ESFT cells by T cells expressing either chNGK2D or an irrelevant CMV-specific control receptor. ESFT cells were specifically lysed by chNKG2D^pos T cells. Notably, chNKG2D^pos CD4^pos T cells lysed over 20% of ESFT cells at an E∶T ratio of only 4∶1 and even targets with low-level ligand density such as STA-ET-8.2 and -11. Figures 3B and 3C demonstrate that chNKG2D also mediated specific cytokine release in mRNA transfected CD4^pos T cells, as shown by detection of TNF and soluble FasL. Together, these results confirm that chNKG2D-RNA transfected T cells specifically recognize ESFT cells even with low ligand density. Furthermore, the data suggest that also the CD4^pos subset of T cells could mediate an efficient anti-ESFT response.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Targeting ESFT cells by chNKG2D-mRNA transfected T cells.

A, Lysis of ESFT cells. The diagram shows the lytic activity of anti-CD3-activated CD8^pos and CD4^pos T cells transfected with mRNA encoding either chNKG2D or a similar chimeric CMV-gH-specific control receptor (αCMV-gH-CAR) in response to ESFT cells with different ligand expression (stated in brackets). Displayed is the specific lysis of the indicated ESFT cell lines at the indicated E∶T ratio (measured by Eu-release; mean ± S.D. of triplicates). Statistical significance was calculated for the effects of T cells expressing the chNKG2D versus T cells expressing the control receptor where indicated. B and C, Cytokine secretion of chNKG2D-mRNA transfected CD4^pos T cells in response to ESFT cells. The diagrams show TNF and FasL secretion by CD4^pos T cells transfected with RNA encoding chNKG2D or a CMV-gB-specific control receptor in response to the indicated cell lines or only medium as control (measured by ELISA; mean of duplicates).

https://doi.org/10.1371/journal.pone.0031210.g003

Lentiviral expression of chNKG2D

For lentiviral expression we cloned chNKG2D into the bicistronic vector pWPI, which was previously optimized for high-level transgene expression in hematopoietic cells [29]. Transduction of PHA-activated T cells yielded expression of chNKG2D in different cell types at similar proportions (16.1% of chNKG2D^pos CD8^neg cells and 19.3% of chNKG2D^pos CD8^pos cells in a representative experiment, data not shown). After removal of PHA but in the continued presence of IL-2 chNKG2D^pos cells enriched during prolonged culture (data not shown), suggesting an auto-stimulatory effect possibly through endogenous expression of NKG2D-Ls induced by PHA stimulation [30]. Accelerated enrichment and expansion was achieved by restimulation with an ULBP2^pos murine Ba/F3 cell line (Fig. 4A). Repeated restimulation in IL-2 supplemented medium resulted in highly enriched (>80%) chNKG2D^pos CD8^pos and CD4^pos T cells that could be expanded for at least three months. Expression of the receptor was stable during the whole period of restimulation, and waned only gradually over a time period of few weeks after cessation of periodical restimulation (data not shown). Figure 4B shows the specific TNF production of enriched chNKG2D^pos CD4^pos T cells in response to different NKG2D-L^pos tumor cells. Finally, we directly compared the lytic activity of CD8^pos T cells modified with chNKG2D either by lentiviral gene transfer or by mRNA electroporation. As shown in Figure 4C, both transfer methods conferred lytic capacity to a comparable extent against ULBP2 expressing target cells but not against ligand negative control cells. Not surprisingly, we observed also weak lysis of ULBP2^pos target cells, but not of ULBP2^neg control cells, when co-cultured with receptor unmodified CD8^pos effector cells, which we ascribe to endogenous expression of (costimulatory) CD314 (NKG2D).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Lentiviral transduction for transfer of chNKG2D.

A, antigen-specific enrichment of lentivirally transduced chNKG2D^pos MNCs. On day 13 after transduction the cells were co-cultured either with Ba/F3, ULBP2^pos Ba/F3 or without target cells. FACS analysis was performed 6 days later (open histogram, bold line: co-culture with the ULBP2^pos Ba/F3, 86.7% chNKG2D^pos T cells; filled histogram, dotted line: co-culture with Ba/F3, 60.7% chNKG2D^pos T cells; thin line: cells cultured without target cells, 54.1% chNKG2D^pos T cells; open histogram, dotted line = secondary antibody only). B, cytokine production. The diagram shows TNF secretion of purified CD4^pos T cells lentivirally transduced with either chNKG2D (enriched to 83–92% positive cells) or a similar chimeric CMV-specific control receptor (enriched to 69–81%) in response to the indicated cell lines or only medium as control (measured by ELISA; mean of duplicates). Ba/F3 or ULBP2^pos Ba/F3 cells were used for negative and positive control. Statistical significance was calculated for the effects of T cells expressing the chNKG2D versus T cells expressing the control receptor. C, Comparison of the cytotoxic response triggered by chNKG2D either stably or transiently transferred. CD8^pos T cells either unmodified (“without chNKG2D”) or expressing chNKG2D by lentiviral transduction (“LV”; enriched for chNKG2D^pos >90%) or mRNA transfection (“mRNA”; 20 hours after electroporation) were co-cultured with dye-labeled murine Ba/F3 cells expressing human ULBP2 (ULBP2-Ba/F3) or not (CTRL-Ba/F3). The diagram shows the percentage of Annexin V^pos Ba/F3 target cells after 4 hours of co-culture at the indicated E∶T ratios (mean ± S.D. of triplicates).

https://doi.org/10.1371/journal.pone.0031210.g004

Together the data demonstrate that lentiviral transduction allowed ligand induced long-term proliferation and the generation of highly enriched chNKG2D^pos T cells, which were characterized by a strong NKG2D-L specific responsiveness comparable to that observed with mRNA modified T cells.

Stability of chNKG2D surface expression upon target cell recognition

Our data so far confirmed that both mRNA transfection and lentiviral transduction mediated high level expression of the chNKG2D in T cells. However, ligand-induced receptor internalization, which is known for T cell receptors (TCRs) and has been reported also for CARs, could result in a significant loss of receptor molecules from the cell surface upon target cell recognition [31]. For this purpose, we compared the stability of chNKG2D surface expression obtained by either RNA electroporation or by lentiviral transduction, after co-culture with MICA^pos/ULBP2^pos STA-ET-3 target cells (Fig. 5A). Co-culture of the RNA-modified cells one day after electroporation with a 2.7 fold excess of STA-ET-3 target cells for 24 hours led to a reduction of the surface expression of chNKG2D by more than 90% compared to the expression observed in T cells without co-culture, as estimated by peak channel numbers (without co-culture: 1762; with co-culture: 87). This was in contrast to lentivirally modified T cells, in which chNKG2D expression even slightly increased during co-culture. As the extent of CAR internalization is strongly determined by the target antigen density [31], [32], we investigated the effect of interaction with ESFT cell lines characterized by different levels of NKG2D-L expression. Figure 5B illustrates that chNKG2D down-modulation in mRNA transfected cells indeed correlated with ligand density on ESFT cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Stability of receptor surface expression upon target-cell encounter.

The histograms show the flow cytometric analysis of chNKG2D expression (detected in CD4^pos T cells by an anti-CD314 antibody or in CD8^pos T cells by an anti-human-IgG1-Fc antibody; log scale in all histograms; note: amplification voltage in flow cytometric analysis was lowered for lentivirally transduced T cells due to the strong expression of the receptor). A, comparison of lentivirally transduced and mRNA transfected T cells. 75,000 chNKG2D^pos CD4^pos T cells were cultured 24 hours after electroporation for further 24 hours in presence or absence of 200,000 STA-ET-3 cells (filled grey histograms = presence of STA-ET-3, open histograms bold line = absence of STA-ET-3, open histograms dotted line = T cells not transfected). Shown is one representative experiment out of three independent repetitions. B, chNKG2D down-regulation in response to different ESFT cell lines. 100,000 chNKG2D^pos CD8^pos T cells were co-cultured 50 hours after mRNA electroporation for further 24 hours with 100,000 cells of different ESFT cell lines as indicated (unmodified T cells = “without chNKG2D”; without co-culture = “without target cells”). C, kinetics of chNKG2D down-regulation upon target-cell encounter at different times after transfection. 20,000 chNKG2D^pos CD4^pos T cells were co-cultured with 60,000 STA-ET-3 target cells for different times (1, 4, or 48 hours) before chNKG2D expression was determined (6, 30, or 74 hours after transfection) (one experiment). D, comparison of differentially stabilized mRNA species. ChNKG2D^pos CD4^pos T cells were co-cultured with STA-ET-3 target cells at different effector∶target ratios and at different times after transfection. Target cells were added at the indicated ratios either two or 26 hours after transfection and chNKG2D expression was determined by flow cytometry 6, 30, 50, or 74 hours after transfection. Shown is one out of three experiments. E, effect of patient serum containing soluble NKG2D-Ls. 15,000 chNKG2D^pos CD4^pos T cells were cultured 24 hours after electroporation for further 24 hours with or without serum of two different neuroblastoma patients (final serum concentration 33%).

https://doi.org/10.1371/journal.pone.0031210.g005

In the following experiments we investigated the influence of the ESFT cell line STA-ET-3, most effective in CAR down-modulation with mRNA transfected T cells, in more detail. Figure 5C illustrates, that the capacity of mRNA-electroporated T cells to compensate for ligation induced chNKG2D down-regulation strongly decreased already early after transfection. Target-cell encounter three days after transfection almost completely down-modulated chNKG2D from the cell surface within only 4 hours of contact at an E∶T ratio of 1∶3. Finally, we compared two differentially engineered RNA species encoding chNKG2D for their capacity to compensate receptor down-modulation by lower number but prolonged presence of target cells (Fig. 5D). RNA #1 refers to the RNA used in all experiments described above and RNA #2 was modified according to Holtkamp et al. with RNA stabilizing elements [25]. The figure illustrates the comparably slow decline of chNKG2D expression over a time period of 6, 30, 50, and 74 hours after mRNA transfection, when T cells were cultured without target cells (open histograms, bold line). A markedly accelerated decline occurred, when target cells were added 2 or 26 hours after transfection. The receptor was strongly down-regulated at time point 30 hours after transfection, when tumor cells were added 2 hours after transfection at an E∶T ratio of 1∶1 (filled histograms). Addition of tumor cells at later time points (26 hours after transfection) resulted in more pronounced chNKG2D down-regulation at time point 50 hours after transfection. Then, even lower amounts of tumor cells (E∶T 1∶0.33; open histograms, thin line) resulted in marked down-regulation, which after an additional day of co-culture (FACS analysis 74 hours after transfection) was very similar to cultures with an E∶T of 1∶1. Importantly, almost identical effects were observed with both types of mRNA, although RNA #2 slightly mitigated the ligation induced down-modulation (visible at E∶T 1∶0.33). Together, these experiments had shown that the extent of down-modulation correlates with target cell numbers and increases with time following transfection.

It has been reported that endogenously expressed NKG2D is down-regulated by cell-bound ligands but not by soluble ligands [33], [34]. In view of the observed reduction of chNKG2D cell surface density in mRNA-transfected T cells, we wanted to investigate this issue with sera from tumor patients, which are known to frequently contain high levels of a soluble fraction of different NKG2D-Ls and thereby could inactivate injected T cells. Thus, we co-cultured RNA-modified CD4^pos T cells with two sera of neuroblastoma patients containing high detectable levels of MICA (171 and 494 pg/ml; “NB1” and “NB2” respectively). In these experiments, however, we did not observe any reduction of chNKG2D surface density (Fig. 5E).