Construction of BmNPV–silkworm multigene expression system

Our BmNPV–silkworm multigene expression system consists of the modified recipient strain E. coli IBIDsw106MultiBmBac and three donor vectors including pCTdual, pRADM and pUCDMIG. All the donor plasmids contain the conditional replication R6kγ origin, the polh and p10 double promoters, and antibiotic resistance genes (Zeo^R, Gm^R and Cm^R) for screening, as well as some specific elements (homologous arms flanking I-Sce I sites, mini-Tn7 transposition arms and a P1-loxp site) for transferring expression cassettes into recipient MultiBmBacmid (Fig. 1).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. The flowchart of producing infective BmNPV expressing ten heterologous genes in silkworm larvae or pupae.

The target genes are cloned into the three donor vector (pCTdual, pRADM and pUCDMIG) using usual method. The first two genes carried by pCTdual are inserted into BmBacmid through I-Sce I linearization and red-gam homologous recombination. Four genes in pRADM and the other four genes in pUCDMIG are then introduced into BmBacmid via Tn7 transposition and cre-loxp recombination, respectively. As a result, ten foreign expression cassettes and three antibiotic screening markers, as well as a GFP illumination marker are introduced into BmBacmid. The invasive and DAP auxotrophic E. coli carrying recombinant BmBacmid are injected into silkworm larvae at an appropriate dose. Consequently, recombinant BmNPV will be produced and multiple foreign genes will be expressed in green B. mori larvae or pupae.

https://doi.org/10.1371/journal.pone.0032510.g001

E. coli IBIDsw106MultiBmBac is composed by the multiple functional host strain E. coli IBISW106Δasd and a modified BmBacmid named MultiBmBacmid. The invasive attTn7-blocked and DAP auxotrophic host strain contains the recombination genes red and gam under the control of a temperature sensitive repressor cI857, a tightly controlled arabinose-inducible cre gene and the I-Sce I expression cassette driven by pBAD promoter, as well as the Tn7 transposon helper plasmid pHelper (Tet^R) and the invasive plasmid pGB2Ωinv–hly (Spe^R). The modified BmBacmid has an attTn7 transposition recipient arms with the lacZ α fragment which replaces the original polyhedrin gene, a loxp site substituting the original chitin and v-cath genes, and a Gm^R cassette flanking two I-sec I sites which substitutes the original p10 and p74 genes (Fig. 1).

Resulting from the great capacity of foreign DNA fragment in BmNPV genome, up to ten heterologous genes can be easily incorporated into the BmBacmid and expressed at the same time with our multigene system. However, the first two genes in pCTdual must be integrated into MultiBmBacmid using homologous recombination to remove the Gm^R, whereas the other eight genes can be introduced into BmBacmid through cre-loxp and mini-Tn7 transposon methods simultaneously. The efficiency of transferring genes from pCTdual to BmBacmid is 99.8%, and it is sufficient to ensure the positive recombinant identification with almost 100% success when combining the Gm sensitive testing [6]. The background of transposition using pRADM and attTn7-blocked host is negligible, and the white colonies are sure to be positive at 100% efficacy when the blue-white screening is still preserved [7]. However, the pUCDM-derivative integration into Bacmid is relatively less efficient (about 93%) through cre-loxp site-specific recombination method [8]. To fix this weakness, we introduced the IRES-egfp fragment into pUCDM to construct a new donor vector pUCDMIG, which contains the 5′-UTR IRES sequence from Rhopalosiphum padi virus [14] and a positive GFP marker. As the translation efficiency of IRES is about 3-fold weaker than that of the cap-dependent translation, the target gene upstream IRES-EGFP controlled by the same polh promoter will be expressed more efficient than the EGFP, showing the small IRES-EGFP cassette (1.3 kb) is a ideal illumination marker for recombinant baculovirus identification.

Moreover, a transfectant-free method is also included in the mutligene expression system, through which producing recombinant BmNPV in silkworm becomes simple and rapid by intrahemocoelic injection with invasive diaminopimelate auxotrophic E. coli containing MultiBmBacmid [11].

Production of infective recombinant BmNPV expressing multiple foreign genes in B. mori larvae

The invasive DAP auxotrophic E. coli, which contains recombinant MultiBmBacmids carrying six foreign genes including egfp, dsRed, eyfp, vp2, vp6 and vp7, was injected into silkworm larval hemocoel with 15 µl overnight cultures at a 10 fold dilution (OD₆₀₀≈2.0, total cell number≈10⁸) per larvae. Most of the injected larvae (90%) turned red in sunlight six days post injection, which also displayed red when observed with the gel imaging system (Fig. 2a). The hemocytes were found to be expressing GFP, DsRed and YFP simultaneously when observed under a laser confocal microscope (Fig. 2b). It indicated that infective recombinant BmNPV has been generated and the three fluorescence proteins were also expressed successfully in B. mori larvae. The injected silkworm larvae displaying red as their major color due to the tetramers formed by DsRed fluorescence proteins expressed in the B. mori larvae.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Multiple genes expression and rotavirus-VLPs production in silkworm.

(a) The larvae of six days post injection were observed using the fluorescence detection device. 1: the mock injected larvae; 2&3: the larvae injected with invasive and DAP auxotrophic E. coli carrying BmBacmid with six genes including egfp, dsRed, eyfp, vp2, vp6 and vp7 at a dose of 8.0×10⁸ cells per larva. (b) The hemolymph from a red larva was observed using laser confocal microscope. The images of hemocytes were taken at the bright (trans) channel (I), GFP (515 nm) detection channel (II), DsRed (590 nm) channel (III) and YFP (530 nm) channel (IV). (c) Western blot analysis of the hemolymph from the red larvae using anti-VP2, anti-VP6 and anti-VP7 rabbit antiserums. (d) The EM image of hemocytes collected from red larvae. R: the round Rotavirus-VLPs; B: the rod shape baculovirus particle, bar = 100 nm.

https://doi.org/10.1371/journal.pone.0032510.g002

Production of rotavirus-VLPs in silkworm larvae

In addition to the three fluorescence proteins, the three structural proteins (VP2, VP6 and VP7) of rotavirus were also successfully expressed in silkworm larvae according to the western blotting experiment (Fig. 2c). Furthermore, the round virus like particles were found in the EM specimen, which meaned VP2, VP6 and VP7 were coexpressed in silkworm larvae and had self-assembled into VLPs (Fig. 2d). The results above indicated multiple genes were able to be co-expressed in silkworm simultaneously using our new BmMutiBac expression system.

About 150 ml hemolymph was collected from 500 red larvae. The rotavirus VLPs were purified from the larval hemolymph by traditional ultracentrifugation using CsCl gradients. Two major bands were recovered for VLPs detection by TEM. One band was composed of baculoviral particles in rod shape, the other was made of round rotavirus VLPs. The result of SDS-PAGE proved the VLPs were constructed by three viral coat proteins including VP2, VP6 and VP7 as expected (Fig. 3). The total protein content in the purified VLPs from the hemolymph collected from 500 larvae was 6.35 mg, which meaned the yield of VLPs was 12.7 µg per larval hemolymph. Obviously this BmNPV-silkworm multigene expression system provides an economic and efficient solution for producing antiviral vaccine derived from VLPs.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. SDS-PAGE analysis of purified VLPs of rotavirus from silkworm.

5 µg VLPs was loaded on 12% SDS-PAGE gel. Lane Marker: standard protein marker. lane VLPs: purified VLPs from silkworm hemolymph. The three bands VP2, VP6 and VP7 were labelled.

https://doi.org/10.1371/journal.pone.0032510.g003

Bacterial strains, plasmids, viral Bacmid, reagents and larvae

E. coli DH10B, BW23474 and TOP10 were used for the propagation of BmBacmid, R6kγ origin derived plasmids and other pUC derived plasmids, respectively. E. coli SW106 was provided by Prof. Copeland [16]. Plasmids pML291, pcp15 and pcp20 were gifts from Dr. Li [17], and spectinomycin (spe)-resistance plasmid pGB2Ωinv–hly (containing both hly and inv genes) was provided by Prof. Courvalin [18]. Plasmids pBlock, pRCDM and pCTdual, as well as the modified BmBacmid with gentamycin resistance gene between two I-sce I sites were constructed at our previous study [6], [7]. Plasmids pUCDM and pFBDM were from Prof. Richmond [8]. Plasmid pBac-IR-GFP containing the 5′-UTR internal ribosome entry site (IRES) sequence of Rhopalosiphum padi virus was provided by Prof. Wu [14].

PfuTaq, restriction enzymes and T4 DNA ligase were purchased from NEB (New England Biotechnologh, England), while DL-α-ε Diaminopimelic acid (DAP) was bought from Sigma (cat. D1377, USA). Low salt (LS) medium (10 g of tryptone, 5 g of NaCl and 5 g of yeast extract in 1 liter of broth, pH7.5) was used for cloning and growing the plasmids containing zeocin resistance gene. Silkworm variety named Chinese Ming-zhu from Yunyang Silkworm Breeding Farm (Nanyang City, China) was fed with mulberry leaves.

Generation of multifunctional strain E. coli IBISW106Δasd

The original E. coli strain SW106 (mcrA Δ(mrr-hsdRMS-mcrBC) ΔlacX74 deoR endA1 araD139 Δ(ara, leu) 7697 rpsL recA1 nupG φ80dlacZΔM15 [λc1857 (cro-bioA)<>Tet] (cro-bioA)<>araC-PBAD Cre ΔgalK) carries a tightly controlled arabinose-inducible cre gene and the recombination genes red and gam under the control of a temperature sensitive repressor cI857. The asd gene of E. coli encodes aspartic semialdehyde dehydrogenase, an enzyme involved in lysine, threonine and methionine biosynthesis [19]. Deletion of asd gene from E. coli genome will result in DAP auxotrophy and defective cell wall synthesis. The asd gene was deleted from SW106 genome by homologous recombination as described previously [10].

A 1.6 kb kanamycin cassette flanking FRT sequences and 50 bp asd gene homologous recombination arms was amplified from pcp15 with the primers asd50F: GAG ACC GGC ACATTT ATA CAG CAC ACA TCT TTG CAG GAA AAA AACGCT TA GAATTC GAGCTC GGTACC C GGG and asd50R: CTCCTG TAT TAC GCA CTA ACA GGG GCG GCA TCG CGCCCC AGA TTT AAT GA CTT A AGCTTAAAA GCGCTCTGAA (50 bp homologous sequences underlined). The PCR product was firstly digested with Dpn I to remove the possible plasmid template, and then was electroporated into the 42°C induced electro-competent E. coli SW106 prepared according to previous work [16]. The transformed cells were spread on agar plate supplemented with 50 µg/ml kanamycin and 0.5 mM DAP and cultured at 32°C overnight. The positive colonies grown on the kan/DAP plate were picked and identified by PCR. Then the kanamycin cassette was removed from the E. coli genome by Flp-mediated excision in vivo using plasmid pcp20 [20]. The target DAP auxotrophic strain was named as E. coli SW106Δasd.

The I-Sce I expression cassette driven by pBAD promoter was introduced into the E. coli SW106Δasd genome through Tn7 transposition. Briefly, the EcoR I-Kpn I (filled in) fragment from pML291 containing ParaBAD-I-SceI-FRT-npt-FRT was cloned into the Sac II and BamH I sites (filled in) of pBlock to replace the FRT–zeocin-FRT fragment. The target recombinant plasmid was transformed into E. coli SW106Δasd containing transposition helper plasmid pHelper to block the attTn7 site in E. coli genome as described previously [7], [10]. The kanamycin cassette (npt) was removed by Flp-mediated excision in vivo using plasmid pcp20. As a result, the I-Sce I expression cassette was introduced, while the attTn7 site of SW106 genome was blocked simultaneously. Plasmid pGB2Ωinv–hly which contains inv and hly expression cassettes was transformed into the modified E. coli strain to generate the invasive, attTn7 blocked, DAP auxotrophic, I-Sce I homing endonuclease and cre recombinase expressing E. coli IBISW106Δasd.

Construction of the recipient MultiBmBacmid

BmBacmid-Gm, constructed previously by introducing a Gm^R cassette flanking two I-Sce I sites into the p10 and p74 locus of the original BmNPV-Bacmid through homologous recombination, was transformed into E. coli SW106 [6]. After the induction of lambda red-gam recombinase at 42°C for 15 minutes, the electro-competent cells of SW106 containing BmBacmid-Gm were prepared and stored as previous description [16]. A 2.6 kb fragment containing both chitA (accession number NC001962; GeneID: 1724489) and v-cath (accession number NC001962;GeneID:1724490) was amplified from BmBacmid using the primers chitAF (AGTATACGCGTTGAGCAAGTCGCCGTTATCGG) and vcathR (AGTATACCCTGAAAAATCCGTCCTCTCCCC, BstZ17I underlined). The PCR product was cloned into pMD18-simpleT vector (TaKaRa, Japan) to get pST-chita-vcath, then the recombinant plasmid was digested with BstB I and Sac II to remove the 1.9 kb fragment which contains 1.4 kb coding sequence of chitA and 0.5 kb coding sequence of v-cath. The blasticidin resistance cassette (Bsd, accession number BAF91001 ) flanking loxp sequence was amplified from pIBV5His (Invitrogen) using the primers BsdloxpF (TTCGAATAACTTCGTATAGCATACATTATACGAAGTTATGCAGCACGTGTTGACAATT, BstB I underlined, loxp site italics) and BsdloxpR (CCGCGGATAACTTCGTATAATGTATGCTATACGAAGTTATGTCAGTCCTGCTCCTCGG, Sac II underlined). The PCR product was first cloned into pMD18-simple T vector for sequencing, and then the plasmid was digested with Sac II and BstB I. The released loxp-Blastidin-loxp fragment was ligated into the Sac II/BstB I-digested pST-chita-vcath described above. The resultant plasmid was digested with BstZ17 I and the released target fragment containing the Bsd cassette flanking loxp sequence and homologous arms was transformed into the 42°C -induced electro-competent cells of E. coli SW106/BmBacmid-Gm prepared according to previous report [13].

The positive candidates grown on kanamycin/blasticidin LS agar plate were further confirmed by colony PCR using the primers chitAF and vcathR. Following that, the blasticidin cassette was removed from BmBacmid-Gm by cre-loxp recombination induced by L-arabinose, therefore only one loxp site was left in the BmBacmid-Gm. The resultant BmBacmid-Gm-loxp was named MultiBmBacmid, which contains an attTn7 transposition site, a loxp site and a homologous recombination site. The MultiBmBacmid was transformed into the multifunctional E. coli IBISW106Δasd to generate target strain E. coli IBIDsw106MultiBmBac.

Construction of donor vectors

The ampicillin resistance gene (Amp^R) was amplified from pFBDM (accession number DJ417502) using the primers AmpF (AAATTCGAA TTTCAGGTGGCACTTTTCGG, BstB I underline) and AmpR (AAATTCGAA TTTCTACGGGGTCTGACGCT). The 1.1 kb PCR product was first digested with BstB I, and then cloned into the same site of pBlock to replace the chloramphenicol resistance gene (Cm^R) for constructing pBlockA. The gentamycin resistance gene (Gm^R) and the two promoters (polh and p10) were obtained from Sac II/Avr II-digested pFBDM. The target Sac II/Avr II fragment was cloned into the same sites of pBlockA to replace the zeoFRT fragment, forming the Tn7 transposon donor vector pRADM (Fig. 1; accession number : JN596961). IRES fragment (accession number AX376819)was amplified from pBac-IR-GFP using the primers iresF (AAATTCGAAGATAAAAGAACCTATAATCC, BstB I underlined) and iresR (AAATCTAGATATAAATAGATAAAGCTAA, Xba I underlined). The 580 bp PCR product was digested with Xba I and BstB I, and then cloned into the same sites of pUCDM (accession number DJ417503 ) to produce pUCDM-IRES. Egfp cDNA was amplified from pEGFP-1 (Clontech; accession number U55761) using the primers egfpspeI (AAACTAGTAACATGGTGAGCAAGGGCGAG, Spe I underlined) and egfppstI (AAACTGCAGTTACTTGTACAGCTCGTC, Pst I underlined). The 0.7 kb PCR product was finally cloned into pUCDM-IRES via Xba I and Pst I to create pUCDMIG (accession number : JN596960) containing the IRES-EGFP fragment (Fig. 1).

DsRed (accession number ACJ05619) from pDsRed2-1 was cloned into pCTdual (accession number : JN596959) via Sma I and Xho I to generate pCTdual-Red, in which DsRed was driven by p10 promoter. The vp2 gene of human rotavirus (accession number AB022766 ) was amplified from the viral RNA by RT-PCR using the primers vp2F (AAAGGATCCACCATGGCGTACAGGAAGCGCGGA, BamH I underlined) and vp2R (AAAGTCGACTCCACAGTGGGGTTGGCGTTTACA, Sal I underlined). The 2.7 kb PCR product was then cloned into pCTdual-Red through BamH I and Sal I to form pCTdual-Red-vp2, in which the vp2 gene was driven by polh promoter while DsRed was controlled by p10 promoter. Eyfp (accession number AAV97917)from pEYFP-1 was cloned into the Sma I and Xho I sites of pRADM to get pRADM-YFP. The vp6 gene of human rotavirus (accession number AB022768 )was amplified from the viral RNA using the primers vp6F (AAAGGATCCACCATGGAGGTTCTGTACTC) and vp6R (AAAGTCGACTCACTTAATCAACATGCTTC). The 1.2 kb PCR product was cloned into pRADM-YFP via BamH I and Sal I to generate pUCDM-YFP-vp6, in which the vp6 and eyfp were driven by polh and p10 promoter, respectively. The 1.0 kb vp7 gene of human rotavirus (accession number AB018697) was amplified using the primers VP7F (AAAGGATCCACCATGGGCTATGGTATTGAATATAC) and VP7R (AAAGTCGACCTATACTCTGTAGTAAAA), and the RT-PCR product was cloned into pUCDMIG via BamH I and Sal I to form pUCDMIG-vp7, in which the vp7 and egfp were controlled by the same polh promoter but the translation of egfp was medicated by IRES element.

Introduction of multiple genes into BmBacmid

Both vp2 and DsRed genes were introduced into MultiBmBacmid through homologous recombination according to previous study [5]. In practice, the plasmid pCTdual-Red-vp2 was transformed into the 42°C and L-arabinose induced electro-competent cells of E. coli IBIDsw106MultiBmBac. The colonies grown on Zeocin/Kan/Tet/spe/DAP were picked for further Gm susceptive detection. The positive zeocin resistant and Gm susceptive strain was named E. coli SW106BmMutiBac-Red-VP2. The vp6 and eyfp were introduced from pUCDM-YFP-vp6 into BmBacmid (BmMutiBac-Red-VP2) by Tn7 transposition as described previously [6]. Furthermore, the vp7 and IERS-egfp were introduced from pUCDMIG-vp7 into BmBacmid (BmMutiBac-Red-VP2-YFP-VP6) through cre-loxp site specific recombination according to previous report [8].

Finally, the target DAP auxotrophic E. coli containing the recombinant BmBacmid carrying six foreign genes (BmBacmid-gry267) and the invasive plasmid pGB2Ωinv–hly was injected into 5^th instar B. mori larvae at a dose of 10⁸ cells per larva according to our previous procedure [11] . The injected larvae were monitored until they turned green, red or yellow.

Production of VP2, VP6 and VP7 antiserum

For preparation of antiserum, truncated VP2, VP6 and VP7 proteins were expressed and purified from E. coli. Partial sequences of vp2 (from start codon ATG +1–465), vp6 (+1–510) and vp7 (+1–496) were respectively amplified from the plasmids pCTdual-Red-vp2, pUCDM-YFP-vp6 and pUCDMIG-vp7 using the following primers: SVP2F (CCGGAATTCATGGCGTACAGGAAGCGCG, EcoR I underlined), SVP2R (CCGCTCGAGATTTGCTCGGTAGATTGG, Xho I underlined), SVP6F (CCGGAATTCATGGAGGTTCTGTACT), SVP6R (CGCTCGAGTTGTGATCTGTTCAGTGT), SVP7F (CCGGAATTCATGGGCTATGGTATTG) and SVP7R (CCGCTCGAGGCACAGCCATTCGTTCAG). The PCR products were respectively cloned into the EcoR I and Xho I sites of pET32a (Novagen) in frame with the His tag at N-terminus to form three recombinant pET32a expression vectors, which were transformed into E. coli BL21 (DE3) competent cells later.

The three truncated VP2,VP6 and VP7 proteins were expressed, isolated and affinity-purified following the instructions in the His-tag fusion protein purification manual (FPLC of GE Health). New Zealand white rabbits were inoculated with the purified proteins to produce polyclonal antibodies using the standard procedures [21].

Fluorescence microscopy

The silkworm larvae injected with E. coli containing recombinant BmBacmid–gry267 were observed using Landun 652 visible light gel imaging system. In this system, the blue filter is used to generate blue light (about 490 nm wavelength) for excitation, and the orange filter is used to observe green, yellow and red fluorescence simultaneously. The hemolymph was collected from the larvae injected with E. coli, and observed under a Nikon laser scanning confocal microscope. The excitation wavelengths used to excite EGFP, EYFP and DsRed were 488 nm, 514 nm and 543 nm, respectively. Correspondingly, the 515 nm, 530 nm and 590 nm channel were used to detect the green, yellow and red fluorescent proteins, respectively.

Western blot analysis and electron microscopy

The hemolymph of the red silkworm larva was collected, into which 5 mM phenyl-thiourea was added to prevent melanization. The hemocytes were harvested by centrifugation, and then lysed by incubation with lysis buffer (1% Triton-X 100 in 10 mM Tris-Cl, pH 7.4) on ice for 30 minutes. The cell lysates were separated in 10% SDS-PAGE, followed by western blot analysis with anti-VP2, anti-VP6 and anti-VP7 rabbit antiserums (diluted 2000×), as well as appropriate secondary antibody (alkaline phosphatase-conjugated goat anti-rabbit IgG, GE Health) according to the manufacturer's protocol.

The harvested hemocytes pellets were fixed in 4°C PBS buffer (pH 7.2) containing 2.5% glutaraldehyde for 2 h. After rinsing with PBS buffer, the samples were fixed in 1% osmium, and dehydrated through a series of graded ethanol baths. Then the dehydrated samples were transferred to propylene oxide for 20 min, and embedded in Epon812 for ultrathin sectioning. Ultrathin sections were stained with 2% uranyl acetate and 1% lead citrate, and then they were examined under a JEM-100SX transmission electron microscope (TEM). For purified VLPs observation, a drop (3 µl) of VLPs sample recovered from the band was applied onto carbon coated 400 mesh copper grid and negatively stained with 2% uranyl acetate. Finally, the dried grins were examined using the transmission electron microscope JEM-100SX.

VLPs purification and quantification

The hemolymph of 500 red larvae infected with recombiant virus BmBacmid-gry267 was collected, into which 5 mM phenyl-thiourea was added to prevent melanization and 50 µl of Protease Inhibitor Cocktail (Sigma P8849) was added to inhibit the proteinases. The collected hemolymph was then treated by sonication for 3 min (periods of 10 s, separated by pauses 5 s). The cell debris were removed by centrifugation at 8,000 rpm (Beckman, Rotor JA-25.50) for 10 min at 4°C. The supernatant was then ultra-centrifugated upon a 20% sucrose cushion at 2,4000 rpm (Beckman, Rotor JA-25.50) for 1 h at 4°C.The pellet was resuspended in 10 ml D-PBS. Following, 4 g of CsCl was added for the preparation of a CsCl gradient. The suspension was then ultra-centrifuged at 3,5000 rpm (Beckman, Rotor SW41)for 18 h at 4°C. The bands were recovered separately and a drop of which was examined by electro microscope as described above, as well as western blot was performed for analysis of the VLPs construction. The total protein content in purified VLPs was determined by using BCA protein kit from Pierce, followed by running a SDS-PAGE gel.