Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Xenopus as a Model System for the Study of GOLPH2/GP73 Function: Xenopus golph2 Is Required for Pronephros Development

  • Leike Li,

    Affiliations State Key Laboratory of Respiratory Disease, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China, University of Science and Technology of China, Hefei, China

  • Luan Wen,

    Affiliations Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China, Section on Molecular Morphogenesis, Laboratory of Gene Regulation and Development, Program in Cellular Regulation and Metabolism, Eunice Kennedy Shriver National Institute Child Health and Human Development, National Institutes of Health, Bethesda, Maryland, United States of America

  • Yu Gong,

    Affiliation State Key Laboratory of Respiratory Disease, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China

  • Guoqiang Mei,

    Affiliations State Key Laboratory of Respiratory Disease, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China, University of Science and Technology of China, Hefei, China

  • Jinsong Liu,

    Affiliation State Key Laboratory of Respiratory Disease, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China

  • Yonglong Chen ,

    peng_tao@gibh.ac.cn (TP); chen_yonglong@gibh.ac.cn (YC)

    Affiliation Key Laboratory of Regenerative Biology, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China

  • Tao Peng

    peng_tao@gibh.ac.cn (TP); chen_yonglong@gibh.ac.cn (YC)

    Affiliations State Key Laboratory of Respiratory Disease, Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China, University of Science and Technology of China, Hefei, China

Abstract

GOLPH2 is a highly conserved protein. It is upregulated in a number of tumors and is being considered as an emerging biomarker for related diseases. However, the function of GOLPH2 remains unknown. The Xenopus model is used to study the function of human proteins. We describe the isolation and characterization of Xenopus golph2, which dimerizes and localizes to the Golgi in a manner similar to human GOLPH2. Xenopus golph2 is expressed in the pronephros during early development. The morpholino-mediated knockdown of golph2 results in edema formation. Additionally, Nephrin expression is enhanced in the glomus, and the expression of pronephric marker genes, such as atp1b1, ClC-K, NKCC2, and NBC1, is diminished in the tubules and duct. Expression patterns of the transcription factors WT1, Pax2, Pax8, Lim1, GATA3, and HNF1β are also examined in the golph2 knockdown embryos, the expression of WT1 is increased in the glomus and expanded laterally in the pronephric region. We conclude that the deletion of golph2 causes an increase in the expression of WT1, which may promote glomus formation and inhibit pronephric tubule differentiation.

Introduction

Human Golgi phosphoprotein 2 (GOLPH2, also termed GP73 and GOLM1) is a type II transmembrane protein that resides in the cis- and medial-Golgi cisternae and is primarily expressed in the epithelial cells of several different human tissues [1]. The upregulation of GOLPH2 expression has been correlated with many diseases and viral infections, including liver disease, prostate cancer, and renal cell cancer [2], [3], [4], [5], [6].

Despite its association with various diseases, little is known regarding the function of GOLPH2. Based on protein sequence analyses, GOLPH2 is conserved among different species, with all family members containing a short cytoplasmic N-terminus, a transmembrane domain (TMD) and a coiled-coil domain. Previous studies indicated that GOLPH2 has the following characteristics: first, human GOLPH2 exists as a dimer stabilized by two inter-protein disulfide bonds formed by two conserved cysteine residues in the coiled-coil domain [7]; second, Golgi localization of GOLPH2 is determined by the TMD and a single positively charged residue extending from the TMD on the cytoplasmic side; and third, human GOLPH2 is mainly expressed in epithelial cells [1].

To determine the possible cellular functions of GOLPH2, a transgenic mouse model that expressed a mouse GOLPH2 C-terminal truncation was generated [8]. This mouse displayed decreased survival and severe epithelial abnormalities in the kidneys, thereby suggesting that mouse GOLPH2 might play an important role in the formation and function of this organ.

The vertebrate kidney is a complex organ that maintains water and salt homeostasis and excretes waste products [9]. Three distinct kidneys develop in succession: the pronephros, mesonephros and metanephros. The pronephros is the functional embryonic kidney of amphibians. It is composed of a single nephron that contains the blood-filtering glomus, the proximal-distal tubules and the pronephric duct [10]. Each segment of the pronephros contains distinct domains, as evidenced by the differential expression of several membrane transporter genes. The pronephros is structurally and functionally similar to the nephron in the metanephric kidney [11], [12]. Studies in Xenopus and mice have suggested that Notch signaling pathways [13], [14], as well as the transcription factors Lim1, Pax2/Pax8, WT1, HNF1β and GATA3, are involved in the formation of the pronephros [15]. Most of the important regulatory molecular components that express during early embryonic development are conserved in vertebrates [16]. Due to its relatively simple organization and due to the ease with which it can be genetically manipulated, Xenopus has been used as a model system to study the biochemical pathways and conserved protein functions involved in the complex regulation of organogenesis, including early kidney development [17], [18].

The predicted amino acid sequences of Xenopus golph2 showed 57% similarity with human GOLPH2. The most conserved regions are the ones that contain the cytoplasmic tail, the TMD and the coiled-coil domain at the N-terminus of the protein (Fig. S1). Based on this observation, we hypothesized that protein function is conserved between golph2 and GOLPH2; therefore, with the goal of understanding the biological function of GOLPH2 and taking advantage of the Xenopus model system, we sought to determine whether we could observe any phenotypic changes following inhibition of golph2 expression during Xenopus development.

Here, using Xenopus as a model, we demonstrated that golph2 exhibits properties similar to those of GOLPH2, such as intracellular localization, epithelial specific cellular expression, and dimer formation, thereby indicating that the two homologs might also perform similar biological functions. Following the observation of the pronephric expression profiles of golph2 during early embryonic development, we analyzed the function of golph2 and its requirement for pronephros development. We demonstrated that the inhibition of golph2 translation expands the expression of a glomus marker and reduces the expression of pronephric markers in the tubules and duct. These results suggest that golph2 is required for the terminal differentiation of the pronephros.

Materials and Methods

Ethics Statement

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol (2011035) was approved by the IACUC committee of the Guangzhou Institute of Biomedicine and Health, Chinese Academy of Sciences.

Plasmids and RT-PCR

The complete open reading frame with 5′ UTR of golph2 (GenBank accession number JF79249) was amplified from the cDNA of stage 40 Xenopus laevis embryos and cloned into the pCS2+ vector (pCS2+-golph2). The following primers were used: forward, CTGCGGATCCACGGAAACAAGCTGTGTGGCCTTA; reverse, TGGCAGAACGTGCTCTAGATTATTTCTTAAGGAGTGGAATATGCTC. Mutations within the morpholino binding site were introduced by PCR-based site-directed mutagenesis into the vector pCS2+-golph2. The mutated plasmid was constructed for generation of golph2 rescue mRNA. The following primers were used: forward, CAAGGTTTGCACCTGATTGTGAGATGATGGGCTCGGGTAATGGTC, reverse, GACCATTACCCGAGCCCATCATCTCACAATCAGGTGCAAACCTTG. The ORF of human GOLPH2 was cloned into either the pCS2+ or pCR3.1 vector (containing a FLAG tag).

The probe for whole-mount in situ hybridization reactions was generated by amplifying a partial sequence of golph2 using the following PCR primers: forward, GCTGGTCGACAAAAGACTCAGAAACCCAAGA; reverse, GATTACGCATGCACTATACCCAGCAGAACAGAT. The resulting fragment was subcloned into the pGEM-T Easy vector (Promega, USA). All pronephric marker genes used in this study were also cloned into this vector (The primer sequences are listed in Table S1).

Xenopus golph2Δ1–34 (deletion of the first 34 N-terminal residues that include the TMD and cytoplasmic tail) was cloned into the pET22b (+) vector for expression.

Semi-quantitative RT-PCR was performed using the following primers: golph2: forward, TAAGAAATAAAGGCACGCACAT, reverse, CTCACTATACCCAGCAGAACAGA; ornithine decarboxylase (ODC): forward, GGAGCTGCAAGTTGGAGA, reverse, TCAGTTGCCAGTGTGGTC.

The stalk region of Golgi protein galactosyl-N-acetyltransferase (GalNAcT2) was fused to the N-terminus of EGFP [19]. A 342 bp fragment (amino acids, 1–114) from human hGalNAcT2 cDNA (NCBI accession number X85019), and a 310 bp fragment (amino acids, 1–103) from Xenopus xGalNAcT2 cDNA (NCBI accession number JX014219) were generated by PCR. The following primers were used: hGalNAcT2: forward, ATCCGCTCGAGATGCGGCGGCGCTCGCGGATG, reverse, GGATGGGAATTCCCATTCGAAGCTTATCACTCTCCAC; xGalNAcT2: forward, TATCGCAGATCTGGTCAGGGAGCCCAGGAGAGAAACAATG, reverse, CGTGTCAGGAACACGAATTCCCATCAGGAGTTTATCACTTTCAACT. The resulting fragments were cloned into pEGFP-N1 vector. Then the fusion fragments containing stalk region and EGFP were subcloned into pCS2+ vector.

Protein Expression and Purification

The golph2Δ1–34 fusion protein was expressed in Escherichia coli strain BL21 (DE3). The soluble protein was purified by Ni-NTA affinity chromatography (Qiagen, USA) and ion-exchange chromatography (SOURCE 15Q, GE Healthcare, USA). The purified protein was used as an antigen to produce a mouse monoclonal antibody (10F12), which was used for Western blotting, immunoprecipitation and immunofluoresence analysis of golph2 in this study. The antibody for Xenopus golph2 does not cross-react with human GOLPH2.

To detect endogenous golph2 proteins, embryos at different stages were homogenized in RIPA buffer (50 mM Tris, pH 7.4; 1% Triton X-100; 1% sodium deoxycholate; 0.1% SDS; 2 mM EDTA; 1 mM Na3VO4; 100 mM NaF; 1 mM PMSF; and phosphatase inhibitor cocktail). The lysates were centrifuged at 15,000×g for 20 min, 4°C and the supernatant was heated in loading buffer containing 140 mM 2-mercaptoethanol. One embryo per lane was separated by SDS-PAGE and detected by Western blotting with anti-golph2 antibody 10F12, human GOLPH2 was detected with antibody 5B12 (from our lab) [20]. For nonreducing SDS-PAGE, samples were heated in loading buffer without 2-mercaptoethanol.

Immunoprecipitation, Immunofluorescence and Immunocytochemistry

The immunoprecipitation experiment was performed as previously described [7]. Briefly, both pCS2+-golph2 and pCR3.1-GOLPH2-FLAG were co-transfected and expressed in 293 T cell lines. Total cell lysates were prepared at 36 hours post-transfection. Purified mouse anti-golph2 antibody 10F12 and protein G Plus/Protein A agarose (Calbiochem, USA) were used to immunoprecipitate golph2 from the lysates. Immunoprecipitates were resolved by SDS-PAGE and immunoblotted with anti-FLAG antibody M2 (Sigma, USA) to detect human GOLPH2.

Stage 46/47 embryos were fixed in MEMFA (0.1 M MOPS, pH 7.4; 2 mM EGTA; 1 mM MgSO4 and 3.7% formaldehyde) for one hour at room temperature, embedded in paraffin, and sectioned at a thickness of 3 µm. The sections were boiled in 1 mM EDTA (pH 8.0) to unmask antigenic sites. Endogenous golph2 was localized using the antibody 10F12 followed by incubation with a Cy3-conjugated secondary antibody (Chemicon, USA) or HRP-conjugated secondary antibody (Zhongshan Golden Bridge, China).

For the animal cap assay, the mRNA of hGalNAcT2-EGFP or xGalNAcT2-EGFP was injected into the animal pole of the fertilized eggs. Animal caps were dissected from stage 9 embryos, cultured in 0.8×MBS, and fixed at stage 21 with Dent’s Fixative overnight at -20°C. Animal caps were permeabilized with PBS containing 0.3% Triton X-100 for 30 min at room temperature. Endogenous golph2 was stained with the antibody 10F12 followed by incubation with a Cy3-conjugated secondary antibody (Chemicon, USA). Nuclei were counterstained with 4, 6-diamidino-2-phenylindole (DAPI; KPL, USA). Both the sections and cells were visualized using a confocal microscope (LSM 710; Zeiss, Germany).

Embryo Manipulations, Synthetic MRNA, and in Situ Hybridization

Xenopus laevis embryos were obtained by in vitro fertilization as previously described [21] and staged according to Nieuwkoop and Faber [22]. Capped mRNAs were synthesized in vitro from NotI linearized plasmids using the mMESSAGE Machine SP6 Kit (Ambion, USA). The following plasmids were used: pCS2+-golph2, pCS2+-golph2-allele, pCS2+-golph2-rescue, pCS2+-GOLPH2, pCS2+-hGalNAcT2-EGFP and pCS2+-xGalNAcT2-EGFP. To generate digoxigenin-labeled antisense probes, pGEM-T Easy-golph2 was linearized with SalI and transcribed with T7 RNA polymerase (Promega, USA). The following probes for marker genes were cloned into the pGEM-T Easy vector: Nephrin [23], atp1b1 [18], SGLT-1K [11], ClC-K [24], NKCC2 [11], NBC1 [11], WT1 [25], Lim1 [26], Pax2 [26], Pax8 [26], HNF1β [27], and GATA3 [18]. Whole-mount in situ hybridization was performed as previously described [28]. The images were taken using a stereomicroscope (SZX16; Olympus, Japan) equipped with a CCD camera (DP72; Olympus, Japan). Gelatin/albumin sections (30 µm) were prepared using a vibratome as previously described (VT1000S; Leica, Germany) [29].

Morpholino Oligonucleotides and Microinjection

Morpholino against golph2, 5′-CCTGATCCCATCATTCTGCAGCAGC-3′, was designed to target the translation start site, golph2-MO and the standard Control-MO oligos, 5′-CCTCTTACCTCAGTTACAATTTATA-3′, were suspended in sterile water to a concentration of 1 mM (Gene Tools, USA). For the marker genes analysis, 32 ng of golph2-MO was injected into the marginal zone of one ventral blastomere at the 4-cell stage along with 10 KD fluorescein-dextran (Molecular Probes, USA) as a lineage tracer. The embryos were cultured and fixed at various stages.

Results

1. Similar to GOLPH2, Xenopus Golph2 is a Golgi-localized Dimer and Expressed in Epithelial Cells

It has been shown that human GOLPH2 is a dimer [7]. To determine whether golph2 also exists as a disulfide bond-linked dimer, endogenous golph2 from stage 22 embryos was analyzed using nonreducing SDS-PAGE and detected by Western blotting. As shown in Fig. 1A, golph2 has the same migration pattern as the human GOLPH2 protein. Furthermore, the Golgi segment of Xenopus golph2 was expressed and purified (from 117 to the C terminal of the protein). The molecular mass is around 70 KD, determined by size fractionation column (data not shown). The theoretical molecular mass for monomer is 32.4 KD. It suggests that golph2 is a dimer. Because the dimerization of GOLPH2 is mediated via an interaction between the conserved coiled-coil domains, we sought to determine whether golph2 could interact with GOLPH2 when the two proteins are co-expressed. The plasmids expressing GOLPH2-FLAG and golph2 were transiently transfected in 293 T cells. As shown in Fig. 1B, GOLPH2-FLAG co-precipitated with golph2 (compare lane 2 with lanes 1 and 3), thus indicating that golph2 is capable of forming a hetero-complex with GOLPH2.

thumbnail
Figure 1. Xenopus golph2 forms a disulfide bond-linked dimer and interacts with human GOLPH2. A.

Whole lysates were prepared from stage 22 embryos of Xenopus and 293 T cell lines; the supernatant was boiled with loading buffer with (lines 1 and 3) or without (lines 2 and 4) 140 mM 2-mercaptoethanol. Samples were resolved on a 12% SDS-PAGE gel and analyzed by Western blotting with anti-golph2, 10F12, (lines 1 and 2) and anti-GOLPH2, 5B12 (lanes 3 and 4). B. The 293 T cell line was co-transfected with pCS2+-golph2 and pCR3.1-GOLPH2-FLAG (line 2) or a single construct with the empty vectors (lines 1 and 3). Cell lysates were prepared at 36 hours post-transfection (Input). The supernatant was immunoprecipitated (IP) with an anti-golph2 antibody, 10F12, and the captured proteins were immunoblotted (IB) with an anti-FLAG antibody.

https://doi.org/10.1371/journal.pone.0038939.g001

thumbnail
Figure 2. Xenopus golph2 localizes to the Golgi. A.

Perinuclear localization of endogenous golph2 in the pronephros of stage 46/47 embryos. B. Pronephric tubule. C–E. Endogenous golph2 co-localizes with hGalNAcT2-EGFP in animal cap cells. The mRNA of hGalNAcT2-EGFP was injected into the animal pole of the fertilized eggs (C, green); golph2 was detected using the antibody 10F12 followed by Cy3-conjugated secondary antibody (D, red); merge (E). F–H. Endogenous golph2 co-localizes with xGalNAcT2-EGFP in animal cap cells. xGalNAcT2-EGFP (F, green); golph2 (G, red); merge (H). Bar = 10 µm.

https://doi.org/10.1371/journal.pone.0038939.g002

Previously, we demonstrated that the Golgi retention of GOLPH2 is determined by the TMD [7]. The TMD of golph2 is highly conserved with GOLPH2, thereby suggesting that golph2 may localize to the Golgi. As shown in Fig. 2A, perinuclear localization of endogenous golph2 was observed in stage 46/47 embryonic pronephros. It has been shown that N-terminal of human hGalNACT2 localized in the Golgi of Xenopus A6 cell lines [19]. We use the EGPF-fusion protein of hGalNACT2 and the Xenopus xGalNACT2 as Golgi markers. We detected that endogenous golph2 co-localized with both of the markers in Xenopus animal cap cells (Fig. 2C–2H).

Human GOLPH2 is expressed in epithelial cells [1]. To determine whether golph2 displays a similar cell type-specific expression, an immunocytochemistry analysis was performed on cross sections of stage 46/47 embryos. As shown in Fig. 3, high levels of golph2 were observed in the epithelial cells of the pronephric tubules, esophagus, stomach, intestine and skin.

thumbnail
Figure 3. Xenopus golph2 is expressed in epithelial cells.

Stage 46/47 embryos were fixed, embedded in paraffin, sectioned to a thickness of 3 µm. Endogenous golph2 was labeled with the primary antibody 10F12, followed by anti-mouse HRP-conjugated secondary antibody and stained with DAB solution; hematoxylin nuclear counterstaining. nt, neural tube; so, somites; pn, pronephros; oe, esophagus; lu, lung; lv, liver; pa, pancreas; st, stomach; i, intestine; s, skin.

https://doi.org/10.1371/journal.pone.0038939.g003

These results showed that golph2 localizes to the Golgi, is highly expressed in epithelial cells and can form a complex with GOLPH2. Together, these results suggest that in addition to the similarity in amino acid sequence and predicted secondary structure of golph2 and GOLPH2, these two proteins may also have similar biological functions.

2. Xenopus Golph2 is Expressed in the Pronephros

The temporal expression profile of golph2 mRNA and protein during Xenopus early embryogenesis was analyzed by RT-PCR and Western blotting, respectively (Fig. 4A and 4B). The golph2 transcripts were first weakly detected at the onset of gastrualiton, increased during gastrulation, and reached to a stable level at neurula and tailbud stages analyzed (Fig. 4A). In contrast, the first signal of golph2 protein was detected at midgastrulae and the expression level kept increasing during late stages analyzed (Fig. 4B).

thumbnail
Figure 4. The expression pattern of golph2 during early development. A.

RT-PCR analysis of the temporal expression pattern of golph2. UE, unfertilized egg. RT(-), negative control of reverse transcription. Ornithine decarboxylase (ODC) was used as the RNA loading control. B. Western blotting analysis of golph2 expression during Xenopus embryogenesis. Beta-actin served as a protein loading control. C–J. Whole-mount in situ hybridization was conducted using a digoxigenin-labeled antisense probe for golph2. C–F. Embryos bisected prior to in situ hybridization. Orientation: animal top, dorsal right (C, D); dorsal top, ventral bottom (E, F), stages as indicated. The expression of golph2 is detected in the dorsal marginal zone and the derivative mesoderm at the gastrula stage. G–J. Lateral view, anterior towards the left; golph2 expression in the pronephros is detected between stages 25 and 39. Expression of golph2 in the otic vesicle and cement gland is also shown (H). Arrow heads indicate the signal.

https://doi.org/10.1371/journal.pone.0038939.g004

To determine the spatial expression pattern of golph2 during Xenopus development, whole-mount in situ hybridization was performed. As shown in Fig. 4, golph2 transcripts were detected in the dorsal marginal zone during gastrulation (Fig. 4C–4E). At the early tailbud stage, when the pronephros anlagen form, golph2 expression is observed in the pronephric region (Fig. 4G–4H). The expression pattern of golph2 correlated with the stage at which the pronephros morphologically differentiates into the pronephric glomerulus and tubules [30]. At stages 31–35 (Fig. 4H–4I) the expression of golph2 became restricted to the anterior pronephros. At the later tailbud stages (Fig. 4I), golph2 expression was predominantly observed in the proximal tubules, with weaker expression observed in the distal tubules and duct. In addition to the pronephric region, golph2 expression is also detected in the otic vesicle and cement gland (Fig. 4H).

In summary, during early Xenopus development, golph2 is mainly expressed in the pronephros.

3. The Disruption of Golph2 Expression Results in Edema Formation

To examine the role of golph2 during Xenopus development, a morpholino was designed to specifically block golph2 translation (Fig. 5A). To test its efficiency, 16 ng to 56 ng of golph2-MO was injected into the vegetal pole of the fertilized eggs. As shown in Fig. 5B, golph2-MO inhibited endogenous expression of golph2 to an undetectable level, even at lower dosages, relative to the Control-MO. Because Xenopus laevis is a pseudotetraploid, a gene may exist as two alleles. A second golph2 allele (NCBI accession number BP696966) that contained two nucleotide mutations in the golph2-MO-targeting site was identified (Fig. 5A, indicated by an arrowheads), and golph2-MO could also efficiently target this second allele (Fig. 5C, compare lanes 3 and 4) but could not target the rescue mRNA (Fig. 5C, compare lanes 1 and 2).

thumbnail
Figure 5. The inhibition of golph2 expression causes edema formation. A.

Sequences of the two golph2 pseudoalleles and the mRNA used for the rescue experiment. The arrow heads indicates the mismatch in the golph2-MO-targeting site of the second golph2 allele. B. The expression of endogenous golph2 was inhibited by injection with morpholino into the vegetal pole of fertilized eggs. Western blotting analysis was performed at stage 33. Line 1∶56 ng of Control-MO; line 2∶16 ng of golph2-MO; line 3∶32 ng of golph2-MO; line 4∶48 ng of golph2-MO; line 5∶56 ng of golph2-MO. C. The specificity of golph2-MO was examined; 32 ng of golph2-MO was injected along with either 0.5 ng of rescue mRNA (line 2) or 0.5 ng of allele mRNA (line 4). Xenopus golph2 expression was detected in embryos of stage 10 using the antibody 10F12. D. Morphology of Control-MO-injected embryos. E. Morphology of golph2-MO-injected embryos displaying edema at the tadpole stage. F. Quantification of edema formation in embryos injected either with Control-MO (56 ng), golph2-MO (56 ng), golph2-MO (56 ng) with golph2 rescue mRNA (1 ng) or golph2-MO (56 ng) with human GOLPH2 mRNA (1 ng).

https://doi.org/10.1371/journal.pone.0038939.g005

To assess the loss of golph2 function during early Xenopus development, golph2-MO was injected into the vegetal pole of the fertilized eggs. The embryos form edema at later stages. The edema phenotype was mostly seen in embryos injected with higher dosages. Therefore, for displaying the edema phenotype, 56 ng of golph2-MO or Control-MO was injected. At stage 43, 69% of the golph2-MO-injected embryos (n = 128) developed edema (Fig. 5E) compared to only 2% of the Control-MO-injected embryos (n = 96) (Fig. 5D). To determine the specificity of this phenotype, 56 ng of golph2-MO was injected along with either 1 ng of golph2 rescue mRNA or 1 ng of human GOLPH2 mRNA. Both mRNAs reduced the frequency of edema; 45% of the golph2 rescue mRNA-treated embryos (n = 112) and 40% of the GOLPH2 mRNA-treated embryos (n = 123) developed edema (Fig. 5F).

4. Xenopus Golph2 is Required for the Terminal Differentiation of the Pronephros

Defects in pronephros development have been reported to cause edema in Xenopus [18], [31]. To assess whether the inhibition of golph2 translation affects the pronephros development, we analyzed the expression of a panel of segment-specific marker genes (listed in Fig. 6A) along distinct regions of the pronephros. As shown in Fig. 6, 32 ng of golph2-MO, along with fluorescein-dextran as a lineage tracer, was targeted to the presumptive pronephric region by injection into one ventral blastomere of 4-cell-stage embryos from the lateral region [32]. Whole-mount in situ hybridization was performed using probes against the marker genes, and their expression in an uninjected site was compared with that of the golph2-MO-injected site in stage 38 embryos. The expression domain of Nephrin, a slit diaphragm-associated protein in the glomus, was increased in 61% of the embryos (n = 69; compare Fig. 6C to 6C’). In contrast, the expression of atp1b1, the beta-1 subunit of Na+, K+-ATPase present in the pronephric tubules and duct, decreased in 67% of the embryos (n = 58; compare Fig. 6E to 6E’). For SGLT-1K, a sodium glucose transporter present in the proximal tubule (Fig. 6A, PT1, PT2, and PT3), no difference in expression was observed (compare Fig. 6G to 6G’). However, expression of ClC-K, a chloride channel, in the intermediate-distal tubule and pronephric duct (Fig. 6A, IT1, IT2, DT1, DT2, and PD) decreased in 78% of the embryos (n = 108; compare Fig. 6I to 6I’). NKCC2 is a sodium potassium co-transporter that is expressed in the intermediate and early distal tubule (Fig. 6A, IT1, IT2, and DT1). NBC1 is a sodium bicarbonate transporter that is expressed in the early proximal and distal tubules of the pronephros (Fig. 6A, PT1, PT2, PT3, DT1, and DT2). At the golph2-MO injection site, the expression of NKCC2 was reduced in 60% of the embryos (n = 74; compare Fig. 6K to 6K’), whereas NBC1 expression was decreased in the distal tubule in 67% of the embryos (n = 40; compare Fig. 6M to 6M’).

thumbnail
Figure 6. Xenopus golph2 is required for pronephros development. A.

Schematic diagram of the pronephros with a summary of the pronephric marker genes that were used (lateral view, anterior towards the left). At stage 38, the pronephros is subdivided into distinct segments: the glomus, proximal tubule (PT1, PT2, PT3), intermediate tubule (IT1, IT2), distal tubule (DT1, DT2) and pronephric duct (PD). B–M’. Expression of the marker genes; the orientations of panels B to M show a lateral view, the anterior towards the right; the orientations of panels B’ to M’ show a lateral view, the anterior towards the left. A total of 32 ng of Control or golph2 morpholino was injected into a single ventral blastomere of 4-cell-stage embryos from the lateral region; whole-mount in situ hybridization analysis was performed on stage 38. (B–C’) Nephrin; (a–c) transverse section of the embryos in panels B’ and C’; (D–E’) atp1b1; (F–G’) SGLT-1K; (H–I’) ClC-K; (J–K’) NKCC2; (L–M’) NBC1.

https://doi.org/10.1371/journal.pone.0038939.g006

To determine whether the effect of golph2-MO is mediated by the altered expression of related transcription factors, the expression levels of WT1, Pax2, Lim1, Pax8, GATA3 and HNF1β were analyzed by in situ hybridization at stage 35. As shown in Fig. 7A–7B’, the injection of golph2-MO resulted in the ectopic expression of WT1 in both the glomus and the pronephric region in 52% of the embryos (n = 42; compare Fig. 7B to 7B’). Among other transcription factors tested, HNF1β, GATA3, and Pax2 expression showed slight reduction on the injected side (Fig. 7L, 7L’; 7J, 7J’; and 7D, 7D’).

thumbnail
Figure 7. Expression analysis of transcription factors. A–L’,

Whole-mount in situ hybridization analysis of Control and golph2-MO-injected embryos at stage 35; orientation: panels A–L, lateral view, the anterior towards the right; panels A’–L’, lateral view, the anterior towards the left. Morpholino (32 ng) was injected into a single ventral blastomere of 4-cell-stage embryos from the lateral region. (A–B’) WT1. Brackets indicate the expression domains. (C–D’), Pax2; (E–F’), Lim1; (G–H’), Pax8; (I–J’) GATA3; (K–L’), HNF1β. The arrow heads indicate reduced convolution of the pronephric tubules.

https://doi.org/10.1371/journal.pone.0038939.g007

Together, these results suggest that deletion of golph2 altered the expression of both WT1 and terminal differentiation genes in the pronephric tubules, duct and glomus.

5. Human GOLPH2 Rescues Defects Caused by Golph2-MO

Previous results indicated that injection of GOLPH2 mRNA could partially reverse edema induced by golph2-MO (Fig. 5F), thereby suggesting that GOLPH2 could partially complement golph2 function. To further confirm this observation, GOLPH2 mRNA was co-injected with golph2-MO in one ventral blastomere of 4-cell-stage embryos, and the percentage of embryos with normal ClC-K expression was measured by whole-mount in situ hybridization at stage 39. As shown in Fig. 8, 94% of the Control-MO-injected embryos (n = 76) expressed ClC-K normally on the injected site compared to 20% of the golph2-MO-injected embryos (n = 86). Both golph2 rescue mRNA and GOLPH2 mRNA rescued the CIC-K expression in the pronephric tubules and pronephric duct. The percentages are (n = total injected embryos): 0.8 ng of golph2 rescue mRNA, 40% (n = 33); 1.2 ng of golph2 rescue mRNA, 45% (n = 66); 0.8 ng of GOLPH2 mRNA, 37% (n = 33); 1.2 ng of GOLPH2 mRNA, 41% (n = 55). This result indicates that both golph2 and GOLPH2 could partially rescue the phenotype observed when endogenous golph2 expression is blocked.

thumbnail
Figure 8. Both human and Xenopus golph2 can rescue the expression of the marker gene ClC-K.

The percentage of embryos with normal levels of ClC-K expression relative to the total number of analyzed embryos (n). Control-MO (32 ng; n = 76); golph2-MO (32 ng; n = 86); golph2-MO (32 ng) with 0.8 ng of golph2 rescue mRNA (n = 33); golph2-MO (32 ng) with 1.2 ng of golph2 rescue mRNA (n = 66); golph2-MO (32 ng) with 0.8 ng of GOLPH2 mRNA (n = 33); golph2-MO (32 ng) with 1.2 ng of GOLPH2 mRNA (n = 55).

https://doi.org/10.1371/journal.pone.0038939.g008

Discussion

It has been shown that GOLPH2 is upregulated in a number of tumors and is an emerging biomarker for liver diseases [33]. Therefore, it is important to understand the biological function of GOLPH2 and its role in pathogenesis. Based on the high level of sequence conservation among vertebrates, it has been suggested that the biological function of GOLPH2 is also conserved. Therefore, it is reasonable to study the biological function of GOLPH2 using model organisms, such as Xenopus laevis.

Xenopus as a Model System for the Study of GOLPH2 Function

In this report, we provided experimental evidence confirming that golph2 shares characteristic properties with human GOLPH2. We showed that golph2 exists as a dimer that is capable of associating with GOLPH2 to form a hetero-complex, thereby suggesting that the two proteins are structurally similar. The coiled-coil domain, which is one of the most conserved regions of GOLPH2, has been shown to be the determinant for both dimer formation and interactions with other protein (secretory clusterin) [34]. Thus, it is reasonable to predict that golph2 interaction pathways (i.e., networks) identified in Xenopus might also be shared by GOLPH2 in humans.

Other conserved regions of GOLPH2 include the TMD and positively charged residues on the cytoplasmic side. These structural features are the determinants for the intracellular localization and transportation of GOLPH2. We demonstrated that endogenous golph2 localizes to Golgi in Xenopus cells. It is hypothesized that golph2 could also be trafficked between the Golgi and plasma membrane through an endosomal pathway, cleaved by proprotein protease and secreted when expression is up-regulated, as found in studies of GOLPH2 [35]. The epithelial-specific expression of golph2 is interesting. This finding suggests that in addition to similarity in sequences and protein structures, the expression of GOLPH2 and golph2 are regulated by similar mechanisms.

In summary, the results presented in this report support the notion that Xenopus model could be use to study the function of GOLPH2.

Xenopus Golph2 is Required for the Pronephros Development

In this report, we showed that golph2 plays a critical role in the terminal differentiation of the Xenopus pronephros. The elimination of golph2 using translation-specific morpholino oligomers resulted in the expansion of glomus size and reduced the expression of transport membrane proteins along the pronephric tubules and duct.

During the early development of Xenopus, we demonstrated that golph2 is expressed after the mid-blastula transition, in the dorsal blastopore lip and the derivatives from mesoderm (notochord and head endomesoderm) at the gastrula stage. The Spemann Organizer region secretes a cocktail of BMP antagonists, and the GOLPH2 protein has been reported to be secreted [35], [36]. However, protein sequence predictions have not indicated the presence of any cysteine residues or CR motifs, which are common in the BMP antagonists [37], and the injection of golph2 mRNA into embryos does not induce the expansion of the dorsal organ (data not shown). Additionally, golph2 transcripts were detected in the cement gland, which is a mucus-secreting organ. It has been presumed that GOLPH2 serves as a Golgi resident protein that may be involved in the trafficking or modification of secreted proteins. In the tailbud stages, golph2 was expressed in the pronephros during proximal-distal differentiation and tubule extension. This distinct expression pattern suggested a spatiotemporal requirement of golph2 in pronephros development.

In the Xenopus model, the experimental block of golph2 translation by specific antisense morpholino oligomers caused edema in tadpole-stage embryos. Members of the Xenopus have adapted to the constant influx of water from the skin and gut by excreting large volumes of urine. The impaired pronephros may result in water retention and an edema phenotype [31]. Both golph2 and GOLPH2 mRNA could partially rescue the edema formation. To obtain a more detailed understanding, we analyzed a series of marker genes for the proximal-distal patterning of pronephros. The depletion of golph2 results in an expanded size of the glomus, reduced tubular convolution and decreased expression of transport proteins along the pronephric tubules and duct. These results implicated golph2 in pronephros patterning and terminal differentiation of the tubules. It has been shown that several transcription factors are expressed in response to nephrogenesis. Among the factors that we examined, WT1 is expressed around the anterior border of the pronephros [25] and is regarded as the key factor in the regulation of glomus development by the suppression of tubule and duct gene expression [38], [39], [40]. In the golph2-MO-injected site of the embryos, WT1 expression was increased in the glomus and laterally expanded. Together with the observed changes in marker gene expression, these results suggest that ectopic WT1 induces the expression of Nephrin and suppresses the expression of pronephros transporters in the tubules. It has been reported that WT1 represses the expression of Pax2 during kidney development [41]. The ectopic WT1 in the lateral region may inhibit the expression of the other transcript factors in the pronephric tubules. Using a mouse model, a previous study provided evidence for a role of GOLPH2 in kidney function. The transgenic mouse with truncated GOLPH2 developed a glomerular disease, i.e., focal segmental glomerulosclerosis (FSGS), based on the observation of histological changes [8]. FSGS is a broadly defined pattern of injury, whereas genetic defects are revealed in clinical studies. It has been shown that mutations in Nephrin, ClC-K and NKCC2 are related to this disease [42], [43], [44].

It has been reported that Notch signaling was involved in the segmentation patterning of the pronephros along the proximal-distal axis. Studies in Xenopus indicated that the activation of Notch signaling promotes glomus formation but inhibits tubulogenesis [13]. In addition, ectopic expression of WT1 is induced by Notch signaling, and the downstream Notch effector gene, hey1, is regulated by WT1 [14]. This suggests that golph2 may mediate Notch signaling during pronephros development. However, the Notch-mediated lateral inhibition was not detected on the golph2-MO injected site (data not shown). On the other hand, Notch receptors are coated with a variety of glycans; the O-fucose glycans modulate the binding between Notch and its ligands [45], mutations that prevent the glycans synthesis cause signaling defects. The Golgi protein fringe, which transfers GlcNAC onto fucose in Notch EGF repeats, was demonstrated to mediate Notch signaling during Drosophila and vertebrate development [46]. Whether golph2 affects Notch signaling via modification of Notch proteins requires further investigation.

In conclusion, we propose the use of Xenopus laevis as a model system for the study of golph2 function. Our results suggest that golph2 is required for pronephros development. The utilization of a well-defined model system such as Xenopus laevis will lead to a better understanding of the biological functions, expression regulation mechanisms, pathogenicity and other important aspects of GOLPH2.

Supporting Information

Figure S1.

Xenopus golph2 is conserved with other vertebrate GOLPH2 sequences. The alignment of golph2 with human and mouse GOLPH2 sequences using ClustalW showed high conservation in the N-terminus of the protein. The accession numbers are: Homo sapiens, NP_057632; Mus musculus, BAE39697; Xenopus laevis, JF79249.

https://doi.org/10.1371/journal.pone.0038939.s001

(TIF)

Table S1.

Primer sequences for the required molecular markers.

https://doi.org/10.1371/journal.pone.0038939.s002

(DOC)

Acknowledgments

We thank Dandan Han, Xiaogang Guo, Tiejun Zhang and other members in the lab for their technical assistance.

Author Contributions

Conceived and designed the experiments: TP LL YC. Performed the experiments: LL LW. Analyzed the data: TP LL YC. Contributed reagents/materials/analysis tools: YG GM JL. Wrote the paper: TP LL.

References

  1. 1. Kladney RD, Bulla GA, Guo LS, Mason AL, Tollefson AE, et al. (2000) GP73, a novel Golgi-localized protein upregulated by viral infection. Gene 249: 53–65.
  2. 2. Kladney RD, Cui XY, Bulla GA, Brunt EM, Fimmel CJ (2002) Expression of GP73, a resident Golgi membrane protein, in viral and nonviral liver disease. Hepatology 35: 1431–1440.
  3. 3. Iftikhar R, Kladney RD, Havlioglu N, Schmitt-Graff A, Gusmirovic I, et al. (2004) Disease- and cell-specific expression of GP73 in human liver disease. Am J Gastroenterol 99: 1087–1095.
  4. 4. Fritzsche FR, Riener MO, Dietel M, Moch H, Jung K, et al. (2008) GOLPH2 expression in renal cell cancer. BMC Urol 8: 15.
  5. 5. Wei S, Dunn TA, Isaacs WB, De Marzo AM, Luo J (2008) GOLPH2 and MYO6: putative prostate cancer markers localized to the Golgi apparatus. Prostate 68: 1387–1395.
  6. 6. Gong Y, Long Q, Xie H, Zhang T, Peng T (2012) Cloning and characterization of human Golgi phosphoprotein 2 gene (GOLPH2/GP73/GOLM1) promoter. Biochem Biophys Res Commun.
  7. 7. Hu L, Li L, Xie H, Gu Y, Peng T (2011) The Golgi localization of GOLPH2 (GP73/GOLM1) is determined by the transmembrane and cytoplamic sequences. PLoS One 6: e28207.
  8. 8. Wright LM, Yong S, Picken MM, Rockey D, Fimmel CJ (2009) Decreased survival and hepato-renal pathology in mice with C-terminally truncated GP73 (GOLPH2). Int J Clin Exp Pathol 2: 34–47.
  9. 9. Saxén L (1987) Organogenesis of the Kidney. Cambridge, UK: Cambridge University Press.
  10. 10. Vize PD, Woolf A, Bard J (2003) The Kidney: From Normal Development to Congenital Diseases. Amsterdam: Academic Press.
  11. 11. Zhou X, Vize PD (2004) Proximo-distal specialization of epithelial transport processes within the Xenopus pronephric kidney tubules. Dev Biol 271: 322–338.
  12. 12. Reggiani L, Raciti D, Airik R, Kispert A, Brandli AW (2007) The prepattern transcription factor Irx3 directs nephron segment identity. Genes Dev 21: 2358–2370.
  13. 13. McLaughlin KA, Rones MS, Mercola M (2000) Notch regulates cell fate in the developing pronephros. Dev Biol 227: 567–580.
  14. 14. Taelman V, Van Campenhout C, Solter M, Pieler T, Bellefroid EJ (2006) The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen. Development 133: 2961–2971.
  15. 15. Wessely O, Tran U (2011) Xenopus pronephros development-past, present, and future. Pediatric Nephrology.
  16. 16. Dressler GR (2006) The cellular basis of kidney development. Annu Rev Cell Dev Biol 22: 509–529.
  17. 17. Jones EA (2005) Xenopus: a prince among models for pronephric kidney development. J Am Soc Nephrol 16: 313–321.
  18. 18. Tran U, Pickney LM, Ozpolat BD, Wessely O (2007) Xenopus Bicaudal-C is required for the differentiation of the amphibian pronephros. Dev Biol 307: 152–164.
  19. 19. Le Bot N, Antony C, White J, Karsenti E, Vernos I (1998) Role of xklp3, a subunit of the Xenopus kinesin II heterotrimeric complex, in membrane transport between the endoplasmic reticulum and the Golgi apparatus. J Cell Biol 143: 1559–1573.
  20. 20. Zhang F, Gu Y, Li X, Wang W, He J, et al. (2010) Up-regulated Golgi phosphoprotein 2 (GOLPH2) expression in lung adenocarcinoma tissue. Clin Biochem 43: 983–991.
  21. 21. Wen L, Yang Y, Wang Y, Xu A, Wu D, et al. (2010) Appl1 is essential for the survival of Xenopus pancreas, duodenum, and stomach progenitor cells. Dev Dyn 239: 2198–2207.
  22. 22. Nieuwkoop P, Faber J (1994) Normal table of Xenopus laevis. New York: Garland Publishing, Inc.
  23. 23. Gerth VE, Zhou X, Vize PD (2005) Nephrin expression and three-dimensional morphogenesis of the Xenopus pronephric glomus. Dev Dyn 233: 1131–1139.
  24. 24. Vize PD (2003) The chloride conductance channel ClC-K is a specific marker for the Xenopus pronephric distal tubule and duct. Gene Expr Patterns 3: 347–350.
  25. 25. Carroll TJ, Vize PD (1996) Wilms’ tumor suppressor gene is involved in the development of disparate kidney forms: evidence from expression in the Xenopus pronephros. Dev Dyn 206: 131–138.
  26. 26. Carroll TJ, Vize PD (1999) Synergism between Pax-8 and lim-1 in embryonic kidney development. Dev Biol 214: 46–59.
  27. 27. Wild W, Pogge von Strandmann E, Nastos A, Senkel S, Lingott-Frieg A, et al. (2000) The mutated human gene encoding hepatocyte nuclear factor 1beta inhibits kidney formation in developing Xenopus embryos. Proc Natl Acad Sci U S A 97: 4695–4700.
  28. 28. Harland RM (1991) In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol 36: 685–695.
  29. 29. Li XJ, Han DD, Kam RKT, Guo XG, Chen M, et al. (2010) Developmental Expression of sideroflexin Family Genes in Xenopus Embryos. Developmental Dynamics 239: 2742–2747.
  30. 30. Vize PD, Seufert DW, Carroll TJ, Wallingford JB (1997) Model systems for the study of kidney development: Use of the pronephros in the analysis of organ induction and patterning. Developmental Biology 188: 189–204.
  31. 31. Howland RB (1916) On the Effect of Removal of the Pronephros of the Amphibian Embryo. Proc Natl Acad Sci U S A 2: 231–234.
  32. 32. Tena JJ, Neto A, de la Calle-Mustienes E, Bras-Pereira C, Casares F, et al. (2007) Odd-skipped genes encode repressors that control kidney development. Dev Biol 301: 518–531.
  33. 33. Gu Y, Chen W, Zhao Y, Chen L, Peng T (2009) Quantitative analysis of elevated serum Golgi protein-73 expression in patients with liver diseases. Ann Clin Biochem 46: 38–43.
  34. 34. Zhou Y, Li LK, Hu LB, Peng T (2011) Golgi phosphoprotein 2 (GOLPH2/GP73/GOLM1) interacts with secretory clusterin. Molecular Biology Reports 38: 1457–1462.
  35. 35. Bachert C, Fimmel C, Linstedt AD (2007) Endosomal trafficking and proprotein convertase cleavage of cis Golgi protein GP73 produces marker for hepatocellular carcinoma. Traffic 8: 1415–1423.
  36. 36. Romano PR, Nikolaeva OV, Steel L, Fimmel CJ, Marrero J, et al. (2003) GP73, a resident Golgi membrane protein, appears in sera of patients with viral liver disease and hepatocellular cancer. Hepatology 38: 768a–768a.
  37. 37. De Robertis EM, Larrain J, Oelgeschlager M, Wessely O (2000) The establishment of Spemann’s organizer and patterning of the vertebrate embryo. Nature Reviews Genetics 1: 171–181.
  38. 38. Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, et al. (1993) Wt-1 Is Required for Early Kidney Development. Cell 74: 679–691.
  39. 39. Van Campenhout C, Nichane M, Antoniou A, Pendeville H, Bronchain OJ, et al. (2006) Evi1 is specifically expressed in the distal tubule and duct of the Xenopus pronephros and plays a role in its formation. Dev Biol 294: 203–219.
  40. 40. Perner B, Englert C, Bollig F (2007) The Wilms tumor genes wt1a and wt1b control different steps during formation of the zebrafish pronephros. Dev Biol 309: 87–96.
  41. 41. Ryan G, Steele-Perkins V, Morris JF, Rauscher FJ, 3rd, Dressler GR (1995) Repression of Pax-2 by WT1 during normal kidney development. Development 121: 867–875.
  42. 42. Chiang CK, Inagi R (2010) Glomerular diseases: genetic causes and future therapeutics. Nat Rev Nephrol 6: 539–554.
  43. 43. Bettinelli A, Borsa N, Syren ML, Mattiello C, Coviello D, et al. (2005) Simultaneous mutations in the CLCNKB and SLC12A3 genes in two siblings with phenotypic heterogeneity in classic Bartter syndrome. Pediatr Res 58: 1269–1273.
  44. 44. Yamazaki H, Nozu K, Narita I, Nagata M, Nozu Y, et al. (2009) Atypical phenotype of type I Bartter syndrome accompanied by focal segmental glomerulosclerosis. Pediatric Nephrology 24: 415–418.
  45. 45. Moloney DJ, Panin VM, Johnston SH, Chen J, Shao L, et al. (2000) Fringe is a glycosyltransferase that modifies Notch. Nature 406: 369–375.
  46. 46. Stanley P, Okajima T (2010) Roles of Glycosylation in Notch Signaling. Notch Signaling 92: 131–164.