Figures
Abstract
Oxygen relieves the CO2 and acetate dependency of Lactobacillus johnsonii NCC 533. The probiotic Lactobacillus johnsonii NCC 533 is relatively sensitive to oxidative stress; the presence of oxygen causes a lower biomass yield due to early growth stagnation. We show however that oxygen can also be beneficial to this organism as it relieves the requirement for acetate and CO2 during growth. Both on agar- and liquid-media, anaerobic growth of L. johnsonii NCC 533 requires CO2 supplementation of the gas phase. Switching off the CO2 supply induces growth arrest and cell death. The presence of molecular oxygen overcomes the CO2 dependency. Analogously, L. johnsonii NCC 533 strictly requires media with acetate to sustain anaerobic growth, although supplementation at a level that is 100-fold lower (120 microM) than the concentration in regular growth medium for lactobacilli already suffices for normal growth. Analogous to the CO2 requirement, oxygen supply relieves this acetate-dependency for growth. The L. johnsonii NCC 533 genome indicates that this organism lacks genes coding for pyruvate formate lyase (PFL) and pyruvate dehydrogenase (PDH), both CO2 and acetyl-CoA producing systems. Therefore, C1- and C2- compound production is predicted to largely depend on pyruvate oxidase activity (POX). This proposed role of POX in C2/C1-generation is corroborated by the observation that in a POX deficient mutant of L. johnsonii NCC 533, oxygen is not able to overcome acetate dependency nor does it relieve the CO2 dependency.
Citation: Hertzberger RY, Pridmore RD, Gysler C, Kleerebezem M, Teixeira de Mattos MJ (2013) Oxygen Relieves the CO2 and Acetate Dependency of Lactobacillus johnsonii NCC 533. PLoS ONE 8(2): e57235. https://doi.org/10.1371/journal.pone.0057235
Editor: Willem van Schaik, University Medical Center Utrecht, The Netherlands
Received: September 24, 2012; Accepted: January 18, 2013; Published: February 26, 2013
Copyright: © 2013 Hertzberger et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: No current external funding sources for this study.
Competing interests: The authors have the following interests. This project is a collaboration between NIZO Food Research and Nestlé Research Centre, funded by the Nestlé Research Centre, Nestec Ltd. DP is employed by Nestlé Research Centre and affiliated to the Kluyver centre for Genomics of Industrial Fermentation. CG is employed by Nestlé Research Centre who have contributed to the manuscript by supplying the wild type and mutant strains and through regular discussion. RH and CG are also affiliated to the Kluyver centre for Genomics of Industrial Fermentation. RH and MK are affiliated to NIZO food research. There are no patents, products in development or marketed products to declare. This does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials.
Introduction
The Lactobacillus acidophilus group was recognized early as the most prevalent inhabitant of the vaginal microbiota [1], [2] and also as the pioneer bacteria in the developing intestinal microbiota of neonates [3]. Various strains and species of the acidophilus group are marketed as functional ingredients in probiotic products, associated with health benefits for the consumer. Therefore, understanding of the physiology of members of this group of lactic acid bacteria is of importance both from a medical and an economical point of view.
One of the probiotics belonging to this group is Lactobacillus johnsonii NCC 533, whose genome sequence was published in 2004 [4]. Its probiotic functionalities have been explored in detail, including immuno-modulation [5]–[7] and pathogen inhibition [8]. Additionally, its ability to adhere to the epithelial cell was explored [9], [10].
Analogous to many other members of the acidophilus group, L. johnsonii can be considered as a highly auxotrophic species lacking the operons for a range of biosynthetic pathways. The genome of L. johnsonii NCC 533 lacks genes for the synthesis of vitamins, purines, fatty acids and all amino acids (except for the interconversion of L-asparagine and L-aspartate and the interconversion of L-glutamate to L-glutamine) [4], [11]. As a consequence, L. johnsonii has fastidious growth requirements. Noteworthy in the context of applicability, the organism does not grow autonomously on milk [12].
In addition to the above-mentioned auxotrophies, and analogous to many other closely related species, L. johnsonii may require a source of acetate for growth. C2-compounds are required in many anabolic reactions and acetate-mediated stimulation of growth has been reported for lactic acid bacteria that exhibit a predominant homolactic metabolism on hexose sugars, such as Lactobacillus sakei [13] and Lactobacillus delbrueckii [14]. Acetylation of the muramic and glucosamine residues of the peptidoglycan for instance, involves O-acetylation for which a supply of C2 compounds like acetyl-CoA is essential [15].
Heterofermentative lactic acid bacteria have the capacity for acetate production, and are therefore assumed to be independent of exogenous acetate addition. However, growth of a ΔLDH- Lactococcus lactis mutant was reported to be stimulated by acetate which it uses for the conversion to ethanol as a means to regenerate NAD+ in order to rescue its redox balance [16].
Another well-described growth requirement is CO2. L. johnsonii, is a so called capnophilic organism, i.e. it has a requirement for either gaseous CO2 or bicarbonate supplementation for growth, which is a characteristic that is also observed in many other lactic acid bacteria species [17]–[19]. The C-1 source has been proposed to be required for the synthesis of a common intermediate of the pyrimidine and arginine production pathways, carbamoyl-phosphate. In L. plantarum carbamoyl-phosphate can be synthesized from glutamine, ATP and bicarbonate involving two enzymes: pyrimidine-regulated CPS-P (encoded by carAB) and arginine regulated CPS-A (encoded by pyrAaAb) [20]. Two regulators of this pathway, PyrR1 and PyrR2 control expression of the pyr-operon in response to pyrimidine and inorganic carbon levels, respectively [21], [22]. The genes of the pyr-operon are conserved amongst many lactobacilli, including L, johnsonii NCC 533. Homologues of the argFGH genes for arginine biosynthesis are absent, rendering this species auxotrophic for arginine.
The production and consumption of metabolites, like CO2 and acetate, are known to stabilize microbial communities. For example, in yoghurt fermentation, Streptococcus thermophilus and L. delbrueckii show close metabolic relations with the first species providing the second with CO2, acetate, folate, and formate. In exchange, the streptococcal species profits from the proteolytic activities of L. delbrueckii [23]. Analogously, it can be anticipated that specific nutritional requirements of microbes play an important role in the composition of the human microbiota. In view of both its industrial potential and its niche in the complex microbial environments where these lactobacilli are generally found, such as the gut, understanding the mechanisms that underlie these growth requirements are important.
Growth requirements may be strongly dependent on the growth conditions. For L. johnsonii NCC 533 we observed major differences in growth and viability between aerobic and anaerobic conditions, including a significantly higher viability in the presence of molecular oxygen. This is surprising in view of the observation that L. johnsonii is known to produce hydrogen peroxide under aerobic conditions, a compound that is generally assumed to be toxic [24]. The study presented here indicates that the anaerobic dependency of L. johnsonii for carbon dioxide and acetate is related to its limited flexibility in pyruvate dissipation pathways, which can be overcome by pyruvate oxidase activity in the presence of oxygen, placing this enzyme in a pivotal position in the central metabolism of L. johnsonii.
Materials and Methods
Strains and Culture Conditions
Lactobacillus johnsonii NCC 533 was obtained from the Nestlé Culture Collection. NCC 533 plus NCC 9333, a pox-deletion derivative of NCC 533, were routinely cultured in MRS medium at 37°C under anaerobic conditions. Erythromycin was supplemented at 5 µM/ml as required.
Anopore Growth and Micro-colony Analyses
The Anopore™ method (inoculation, incubation, imaging) was carried out as described before by den Besten et al. [25]. Multiple Anopore™ inorganic membranes (Anodisc™) were placed on MRS-agar plates and four dilutions (102–105) of an overnight MRS culture of L. johnsonii NCC 533 were spotted per slide (to ensure that colonies would be physically separated to allow individual quantification). The plates were incubated at 37°C in Oxoid jars that were filled with a defined gas mixture by vacuuming, followed by replacement with the gas mixture of choice, and repeated 3 times at the start of the experiment as well as after every opening of the jar for sampling. Single Anopore™ slides were removed at different time points and transferred to a microscopic slide with a pronarose layer that contained the cell permeable SYTO9 stain and the cell impermeable propidium iodide stain (baclight live/dead staining, Molecular Probes, Invitrogen). SYTO9 enters all cells but is replaced by propidium iodide whenever the membrane integrity is compromised.
For every time point and condition between 20 and 147 microcolonies were randomly selected from one slide and imaged directly without the use of a cover slip or immersion oil. Photographs were taken through both red and green filters with a cooled charge-coupled device camera (Princeton Instruments, SARL, Utrecht, The Netherlands) mounted on an Olympus BX-60 fluorescence microscope. A threshold was applied to create a binary image of the image intensity plots and these were superimposed using ImageJ. An example of such an image is shown in Supplementary materials, Figure S1 in which images of several colonies are combined. The colony size and viability were quantified using the ImageJ. The ImageJ plugin ObjectJ was employed to facilitate colony selection.
Growth in Liquid Media and Physiological Characterization
Cells were inoculated at an OD600 of 0.01–0.05 in fresh medium. Growth was monitored in continuously stirred vessels with 400 ml regular MRS medium [26](for the CO2 dependency experiments) or a chemically defined medium (in case of the acetate dependency experiments). The latter medium was described for Lactobacillus reuteri [27] and has previously been shown to also support growth of Lactobacillus johnsonii NCC 533. Batches were sparged with specific gas mixtures varying in CO2 and O2 content. Cultures were grown at 37°C with constant mixing (ca. 200 rpm) and pH was maintained at pH 6.5 by automatic 4 M NaOH titration. Cell density was determined by measuring the optical density at 600 nm. Growth rate was determined by fitting an exponential trendline through the data points with a minimal R2 of 0.99. In cases of very slow or no growth a trendline was fitted through the data points of the first five hours of incubation (for instance where chemically defined medium is inoculated in the absence of acetate and oxygen).
Construction of the pox-deletion Derivative of L. johnsonii NCC533
The deletion of the gene LJ1853 encoding a predicted pyruvate oxidase enzyme was achieved as described previously [28] with the exception that the plasmid pDP749 was used. In pDP749 the erythromycin resistance gene in pDP600-Ery has been flanked by direct copies of the yeast 2-micron plasmid FLP recombination target sites to facilitate excision of the erythromycin resistance marker by the FLP recombinase. The 5′ region was amplified from L. johnsonii NCC 533 genomic DNA with the primers A (ATATATGAGCTCAGCAAGAACGGCTTCTGC) and B (ATATATGGATCCAGATGCTGCTTCTGGTGC) introducing SacI and BamHI restriction sites, respectively. The amplicon was SacI-BamHI digested and cloned in similarly digested pDP749, yielding an intermediate plasmid. The 3′ region was amplified using the primers C (GTGAACGGCACCAGGACC ) plus D (ATATATGGTACCGAAGCATATATTGGGGTC), the amplicon obtained was PstI-KpnI digested and cloned in similarly digested intermediate plasmid to yield the POX-deletion plasmid pDP887. Plasmid pDP887 isolated from Lactococcus lactis was used to transform NCC 533 [11]and loop-in/loop-out gene replacement was achieved as described previously [28]. The deletion was confirmed by PCR analysis.
Organic Acids Measurement by HPLC
Extracellular metabolite concentrations were determined as described previously [29] using HPLC (LKB and Pharmacia, Oregon City, OR, USA) fitted with a REZEX organic acid analysis column (Phenomenex, Torrance, CA, USA) at 45°C and a RI 1530 refractive index detector (Jasco, Easton, MD, USA). The mobile phase consisted of a 7.2 mM H2SO4 solution. Chromatograms were analysed using AZUR chromatography software (St. Martin D’Heres, France).
Results
CO2 Dependency of L. johnsonii NCC 533 during Aerobic and Anaerobic Microcolony Growth
To study CO2 dependency of L. johnsonii, we used a high-resolution and quantitative technique by using Anopore™ slides to visualize growth on plates that were placed in jars with a controlled atmosphere. This allowed for the rapid assessment of growth requirements and in combination with time-resolved microscopic inspection at using live/dead staining, enabled the generation of additional data related to the organisms’ physiological state, viability and population heterogeneity [25], [30], [31].
This set-up was employed to evaluate growth and viability during CO2 limitation under aerobic and anaerobic conditions. To this end, Anopore™ slides on MRS-agar plates were inoculated with different dilutions of cells and incubated in jars filled with gas-mixtures varying in CO2 and O2 content. At regular intervals the viability and size of the colonies were determined using a live/dead baclight stain as described in Materials & Methods. The sum of the propidium iodide stained pixels and the SYTO9 stained pixels was used to estimate the size of the colony. The fraction of SYTO9 over all stained pixels was used as a relative measure of viability.
CO2 supplementation to the gas phase (5%) was found to stimulate growth under both aerobic (air) and anaerobic (N2) conditions. When plates were transferred to a CO2 depleted environment, growth stagnated after 7 hours, both in aerobic and anaerobic conditions. In the presence of supplemented CO2, microcolonies continued growth with an estimated growth rate of 0.79 h−1 in the anaerobic, and 0.74 h−1 in the aerobic environment, which is comparable to growth rate in liquid culture (data not shown). This growth rate was estimated by fitting an exponential trend line through the average colony size (Figure 1, panels A and B). Growth stagnation was accompanied by loss of membrane integrity observed in microcolonies that are grown without CO2 supplementation, whereas microcolonies grown in CO2 supplemented environments sustained viability above 90% throughout the experiment (Figure 1, panels C and D).
L. johnsonii NCC 533 is grown on Anopore™ slides that are transferred from a 2 hour pre-incubation period in an N2+5% CO2 environment to environments that vary in CO2 and O2 content. Average size of microcolonies grown aerobically (A) and anaerobically (B) and average viability of microcolonies grown aerobically (C) and anaerobically (D). Growth after the pre-incubation was either in the presence (closed symbols) or absence (open symbols) of 5% CO2. Data shown are the mean of all colonies counted for that time point and condition ± standard deviation.
Notably, microcolonies grown in aerobic atmosphere displayed reduced loss of viability albeit with a higher degree of heterogeneity, as compared to microcolonies grown in a nitrogen atmosphere (Figure 1 C and D). This observation was remarkable since it has been documented that L. johnsonii produces hydrogen peroxide in the presence of oxygen [24], which was presumed to reduce growth rate and induce considerable cell death under aerobic conditions. Taken together, these results suggest that CO2 depletion leads to loss of membrane integrity and growth stagnation, while oxygenation appears to support extended viability as compared to anaerobic conditions.
CO2 Dependency of L. johnsonii NCC 533 during Aerobic and Anaerobic Liquid Growth
To consolidate the results obtained with the Anopore system in the more routinely employed liquid culture conditions, L. johnsonii NCC 533 was grown in a pH-controlled stirred batch culture, sparged with predefined gas mixtures at a rate of 750 ml/min. When L. johnsonii was grown in MRS medium in this experimental setup, a clear difference between aerobic and anaerobic growth was observed. Anaerobic and aerobic cultures reached an exponential growth rate of 0.85 h−1 and 0.69 h−1, respectively. After 6 hours of incubation aerobic growth strongly slowed down and eventually the culture entered stationary phase, whereas the anaerobic culture continued growth (Figure 2A). The aerobic growth stagnation was related to the accumulation of H2O2 in the extracellular growth medium, as is evidenced by the complete prevention of the growth stagnation by the addition of 0.5 mg/ml catalase to the medium (Supplemental material, Figure S2).
Growth in stirred pH-controlled batch cultures sparged by N2+5% CO2 (closed symbols) or N2+20% O2+5% CO2 (open symbols) as measured at OD600. Data shown are the mean of at least two independent experiments ± standard error of the mean. In panel B, the gas regime was switched after 3 hours of exponential growth from a CO2-rich gas to a CO2-free gas: N2 (closed symbols curve), N2+20% O2 (open symbols). Growth curves are the average ± standard deviation of triplicate experiments.
To assess the influence of CO2 on growth in these conditions, cultures were grown until early-logarithmic phase of growth while sparging a defined gas composition, aerobic (75% N2, 20% O2 and 5% CO2) or anaerobic (95% N2 and 5% CO2). Subsequently sparging was switched to a CO2-free gas mixture. Depletion of CO2 in anaerobic cultures resulted in growth stagnation and initiation of cell death within one hour (Figure 2B), whereas in aerobic cultures this effect was not observed and growth continued until it stagnated at a final OD of approximately 1.5, due to the accumulation of H2O2. Overall, these data show that oxygen supplementation in the gas phase relieves the CO2 requirement for growth, both on solid, as well as in liquid media.
Oxygen Overcomes the Acetate Dependency of L. johnsonii NCC 533
In addition to CO2 dependency, growth of many lactobacilli also depends on the presence of acetate in the growth medium [14]. L. johnsonii was unable to grow in chemically defined medium without acetate supplementation. Notably, the addition of as little as 12 µM sodium acetate (1/1000 of the regular sodium acetate concentration in the chemically defined medium) allowed for recovery of growth, albeit at a slower rate and yielding lower final biomass concentrations. Acetate supplementation at a 100-fold lower level as compared to its regular concentration in CDM (120 µM) completely restored normal anaerobic growth (Figure 3). These results show that although there is a strict acetate-requirement for growth, this requirement is already fulfilled with concentrations that are substantially below the levels that are normally added to typical Lactobacillus-laboratory media, such as MRS or CDM.
Growth of L. johnsonii NCC 533 in a chemically defined medium with varying concentrations of sodium acetate: 12 mM as in standard CDM (closed square symbols) 120 µM (round symbols), 12 µM (triangular symbols) and without any Na-acetate supplemented (open square symbols) in stirred pH controlled cultures sparged with N2+5% CO2 at a rate of 500 ml/min. The growth curves are the average of duplicate experiments ± standard error of the mean.
To assess whether the acetate requirement of L. johnsonii NCC 533 depended on the growth conditions, the strain was grown in chemically defined medium with or without acetate supplementation (12 mM), under aerobic or anaerobic conditions. Analogous to what was observed with respect to the CO2 dependency, anaerobic growth of L. johnsonii NCC 533 depended more strictly on acetate supplementation as compared to aerobic growth, which could be sustained without an external acetate source, albeit with a slower growth rate and a lower final biomass yield (Figure 4). This implies that the endogenous production of acetate under these conditions may be expected to be in the same range as the 12 µM that allowed similar growth restoration under anaerobic conditions (see above).
Growth of L. johnsonii NCC 533 in a chemically defined medium with 12 mM Na-acetate (square symbols) and without 12 mM Na-acetate (round symbols) in stirred pH controlled cultures sparged with N2+5% CO2 (closed symbols) or N2+20% O2+5% CO2 (open symbols) at a rate of 500 ml/min. Data are average of independent triplicate experiments ± standard deviation.
Both aerobic and anaerobic growth of L. johnsonii in chemically defined medium with 12 mM or 120 µM of acetate were analyzed with respect to acetate metabolism: significant change in extracellular acetate were not detected by HPLC analysis nor by a highly specific and sensitive acetate kinase/pyruvate kinase assay (ref) (results not shown). This result is likely caused by analytical limitations that did not allow detection of the minute amounts of acetate that are required to sustain growth under these conditions, (estimated detection limit in spent medium is 200 µM).
In most organisms acetyl-CoA functions as the central C2-intermediate in several biosynthetic pathways. This metabolite can be produced from pyruvate by reactions catalyzed by pyruvate dehydrogenase (PDH) or pyruvate formate lyase (PFL). However, apart from a homologue for one subunit of pyruvate dehydrogenase, the corresponding genes appeared to be absent in the L. johnsonii NCC 533 genome [4]. This genotype is shared with the other members of the acidophilus-group (see Supplement, table S1), indicating that these species lack the capacity for autonomous acetyl-CoA production from their central energy metabolism (Figure 5).
Overview of pyruvate metabolism based on genome annotation. LDH: Lactate dehydrogenase. POX: pyruvate oxidase. ACK: Acetate kinase. PAT: Phosphate acetyltransferase.
The L. johnsonii genome does encode an enzyme that could provide the cell with both CO2 and acetate, namely pyruvate oxidase (POX). POX catalyzes a reaction that requires molecular oxygen as a co-substrate, and therefore its activity may directly explain the observed physiological consequences of the presence of oxygen (aerobic growth is independent of an external CO2 and acetate source). Therefore, we hypothesized that oxygen availability relieves the CO2 and acetate dependency by the pyruvate oxidase derived supply of both these metabolites.
Acetate and CO2 Dependency of a pox-deletion Mutant
To test the proposed hypothesis, a pox deletion derivate that lacks the pyruvate oxidase encoding gene was constructed. Under anaerobic condition in an atmosphere supplemented with 5% CO2, the growth rate of the mutant in MRS was similar to that observed for NCC 533. Moreover, under these conditions the wild-type and its pox-deletion derivative displayed a comparable growth arrest upon CO2 depletion. However, under aerobic conditions, shutting down the 5% CO2 supply elicited rapid growth stagnation of the pox mutant (Figure 6), which is in clear contrast to the wild-type that continues to grow under these conditions. Clearly, the deletion of pox resulted in a L. johnsonii mutant that depended on exogenous CO2 supplementation for aerobic growth. This fully supports the proposed pivotal role of the pox-encoded pyruvate oxidase enzyme in the generation of this essential C1-source under these conditions.
Growth of the NCC 533 (closed symbols) and NCC 9333 (open symbols) as measured at OD600 in stirred batch cultures sparged with N2+20% O2+5% CO2. The gas regime was switched after 3 hours of exponential growth to N2+20% O2. Data are the average of quadruple independent experiments ± standard deviation.
Analogous to the CO2 supply provided by the POX-pathway under aerobic conditions, it would be expected that this pathway also provides an acetate supply when oxygen is available. Consequently, the pox mutant would be expected to be more hampered aerobically in media that lack exogenous acetate as compared to the wild-type strain.
Generally, the pyruvate oxidase deficient mutant displayed slower growth rates than the wild type, independent of the presence of oxygen (Figure 7A). However, growth of the pox mutant in the absence of acetate differed considerably, i.e., the typical oxygen relief of the acetate dependency that was observed for the wild type was not observed for the pox mutant (Figure 7B), which supports our hypothesized role of pyruvate oxidase in generating C2-compounds.
Growth rate of L. johnsonii NCC 533 in the standard chemically defined medium with (panel A) and without 12 mM Na-acetate (panel B) in stirred pH controlled aerobic batch cultures (open bars) or anaerobic batch cultures (closed bars). Growth rates were determined as explained in Materials & Methods. Data are average of triplicate experiments (panel A) and duplicate experiments (panel B) ± standard error of the mean.
Discussion
Lactobacillus johnsonii is generally described as an anaerobic fastidious lactic acid bacterium. Fastidious because its growth is dependent on supplementation of various nutrients to its growth medium, and anaerobic because oxygen cannot be used for respiration. Moreover, L. johnsonii produces hydrogen peroxide when grown under aerobic conditions, which inhibits growth. Here we present an example that auxotrophy can be dependent on external conditions that seemingly are not related to the nutrient requirement: we show that anaerobicity actually exacerbates the fastidious nature of L. johnsonii NCC 533 since the presence of oxygen is shown to relieve at least two of its anaerobic growth requirements, i.e., the requirement for acetate and CO2.
Both on plates and in liquid culture, L. johnsonii showed clear CO2 dependent growth. However, the oxygen relief of this dependency was more apparent in liquid culture than on solid medium, as illustrated by the observation that aerobic growth on plates without CO2 still resulted in smaller colonies and reduced viability. In contrast, these CO2 dependent phenotypic differences were completely abolished by oxygen supplementation in liquid culture. One explanation for the observed difference could be found in the ambient pH, which is controlled at 6.5 in liquid culture and is uncontrolled in the Anopore experiment. It should be noted in this context that pH influences the equilibrium between the different dissolved carbonic species; CO2 dissolves in water as H2CO3 (pKa 6.1) and the latter species may be deprotonated in a pH dependent manner to generate HCO3− and CO32−, respectively. Thus, lower pH values shift the equilibrium resulting in release of CO2 from the solution to the effect that less CO2 is available to the bacteria.It is to be expected that on solid media especially the local pH within the direct environment of emerging microcolonies drops substantially below 6.1 due to lactic acid production. These micro-scale differences in environmental conditions experienced by bacteria grown in microcolonies versus liquid cultures may explain the observed CO2 dependency differences observed.
Like the other species in the acidophilus-group (L. delbrueckii, L. gasseri, L. johnsonii, L. crispatus, L. amylovorus, L. helveticus), the genome of L. johnsonii lacks two major systems for the production of C2- and C1-compounds, namely the pyruvate dehydrogenase complex (PDH) and pyruvate-formate lyase (PFL) producing acetyl –CoA (Supplemental material, table S1). Instead, the genomes of these species all encode the pyruvate oxidase gene that can provide a metabolic source of C2-compounds whenever molecular oxygen is available for the POX reaction. The primary habitat of L. johnsonii is considered to be the intestine, which is a predominantly anaerobic environment and would therefore not support POX mediated C2-production. However, in close vicinity to the mucosal tissues, local and a steep oxygen gradient may be encountered [32] that may allow for the POX-mediated contribution to metabolism. Notably, preliminary transcriptome studies of L. johnsonii grown under anaerobic, aerobic and CO2 depleted conditions did not reveal regulation of the pox gene expression, suggesting that the enzyme is constitutively expressed. Based on the physiological observations both on plate and in liquid culture, combined with the absence of these genes, we hypothesized that pyruvate oxidase activity would play a pivotal role in the acetate and CO2 supply for the cell. Indeed, a pox-deletion derivative of L. johnsonii did not display a higher growth rate under aerobic conditions in the absence of acetate, such as observed in the wild type strain. Moreover, whereas the wild type strain continued to grow upon a switch to CO2 depletion, growth of the mutant stagnated at a lower biomass concentration. The observed time lapse between the onset of flushing with CO2 free gas and the actual CO2 depletion of the system is most likely due to the slow removal of all carbonic species at a pH higher than 6.1 (the pKa of carbonic acid). Both results show that, in contrast to the wild type, the pox-mutant has lost the ability to aerobically generate CO2 and acetate. This corroborates the proposed role of pyruvate oxidase in the generation of C1 and C2 metabolic intermediates.
It was observed that the pox mutant has a lower growth rate, both aerobically and aerobically. Although it can be argued that under aerobic conditions the pox gene might play a role in protection against its reaction product, hydrogen peroxide by allowing for a faster production rate of ATP via the production of acetyl-phosphate and subsequent generation of ATP by acetate kinase [33], this argument does not hold for anaerobic growth conditions. So far, no specific role for POX under these conditions can be brought forward and the cause of the effect of the deletion on growth remains to be elucidated.
The major dependency of L. johnsonii on pyruvate oxidase for the supply of these compounds was rather unforeseen since many other pathways are known and present in L. johnsonii that can render CO2 and acetate. Phosphoketolase, for instance, catalyzes the deacetylation of xylulose-5-phosphate which yields acetyl-phosphate. Similarly, CO2 can be produced through decarboxylation of amino acids, oxaloacetic acid and phosphopantotenoyl. However, acetate and CO2 are both required for growth of L. johnsonii in the absence of oxygen, even though very low concentrations of acetate (<120µM) already suffice for growth. This suggests that the flux through these pathways compared to pyruvate oxidase is marginal.
It is uncertain, however, that the lactobacilli that do possess PDH and PFL encoding genes (Supplemental materials, Table S1), can actually employ these pathways for the synthesis of C1 and C2-compounds under aerobic conditions. Literature suggests that L. plantarum does not possess a functional pyruvate dehydrogenase pathway, since acetate production does not require CoA and is not hampered by PDH-inhibitors like arsenate [34], [35]. In addition, pyruvate formate lyase activity has been reported to be highly oxygen sensitive and is only considered active under anaerobic conditions [36]. The presence of genes predicted to encode PFL or genes that resemble the PDH-genes of other organisms does not preclude that a species still depends on pyruvate oxidase under aerobic conditions for the production of C2 and C1 components, analogous to what we concluded for L. johnsonii.
Clear data to support this hypothesis are lacking, although CO2 dependency of L. plantarum was also reported to cause a characteristic growth stagnation under aerobic conditions [19]. In addition, another study showed that a pyruvate-oxidase deficient mutant of L. plantarum is hampered in its acetate production capacity [37], [38], supporting the role of this enzyme in aerobic acetate supply in lactobacilli that have a broader genetic arsenal.
The effect of deletion of pox in L. johnsonii confirms the role of POX in the generation of both C1 and C2 sources (CO2 and acetate) required for growth. However, a byproduct of pyruvate oxidation by POX is hydrogen peroxide, of which the accumulation induces oxidative stress that leads to premature growth arrest under aerobic conditions [24]. This brings us to the intriguing conclusion that oxygen appears to both benefit and harm L. johnsonii. Under aerobic conditions, clearly, a lower biomass yield is reached (Supplemental material, Figure S1) on the one hand, presumably as a consequence of hydrogen peroxide production. On the other, our data also establish clearly that oxygen can increase the metabolic capacity of the strain, relieving some of its fastidious growth requirements. These opposing consequences of oxygen presence suggest that a micro-aerobic environment may be optimal for growth of L. johnsonii NCC 533.
Here we have refined the metabolic requirements of L. johnsonii NCC 533 and pinpointed the pivotal role of the pox gene in the requirement for C1 and C2 sources. These findings can provide novel clues for the optimization of growth conditions of these commercially relevant microbes, and may in more general terms facilitate a more efficient regime for the production of probiotics belonging to this group of lactobacilli.
Supporting Information
Figure S1.
Effect of catalase on aerobic growth. Figure 1: Growth of L. johnsonii NCC 533 in MRS medium supplemented with 0.5 mg/ml catalase (open symbols) and regular MRS medium (closed symbols) in either static tubes with limited headspace (round symbols) or in shake flasks (square symbols). Depicted are the averages of duplicate experiments ± standard error of the mean.
https://doi.org/10.1371/journal.pone.0057235.s001
(TIF)
Figure S2.
Superimposed image of baclight-stained microcolonies. Composite picture in which images of colonies after 7 hours of growth in environments that vary in oxygen and CO2 content are grouped. Images were thresholded, colors were assigned artificially and superimposed as described in Materials & Methods.
https://doi.org/10.1371/journal.pone.0057235.s002
(TIF)
Table S1.
Presence of genes for pyruvate dehydrogenase or pyruvate formate lyase in Lactobacilli. Overview of pyruvate dehydrogenase and pyruvate formate lyase encoding gene prevalence in lactobacilli (Table A) and in species belonging to the Lactobacillus acidophilus group (Table 1B). If no gene was found, a BLAST search was performed using the protein sequence of the homologue in L. plantarum WCFS1. Shown are the query coverage and the e-value.
https://doi.org/10.1371/journal.pone.0057235.s003
(DOCX)
Acknowledgments
We would like to thank the Molecular Cytology group at SILS, University of Amsterdam for letting us use the BX fluorescence microscope and in particular Norbert Vischer for the assistance with ObjectJ. More information on ObjectJ can be found at http://simon.bio.uva.nl/object.
Author Contributions
Conceived and designed the experiments: RYH RDP CG MK MJTM. Performed the experiments: RYH RDP. Analyzed the data: RYH MK MJTM RDP CG. Contributed reagents/materials/analysis tools: RDP CG MJTM. Wrote the paper: RYH MK MJTM.
References
- 1. Aagaard K, Riehle K, Ma J, Segata N, Mistretta TA, et al. (2012) A metagenomic approach to characterization of the vaginal microbiome signature in pregnancy. PloS One 7: e36466.
- 2. Lamont RF, Sobel JD, Akins RA, Hassan SS, Chaiworapongsa T, et al. (2011) The vaginal microbiome: New information about genital tract flora using molecular based techniques. BJOG : An International Journal of Obstetrics and Gynaecology 118: 533–549.
- 3. Karlsson CL, Molin G, Cilio CM, Ahrne S (2011) The pioneer gut microbiota in human neonates vaginally born at term-a pilot study. Pediatric Research 70: 282–286.
- 4. Pridmore RD, Berger B, Desiere F, Vilanova D, Barretto C, et al. (2004) The genome sequence of the probiotic intestinal bacterium Lactobacillus johnsonii NCC 533. Proceedings of the National Academy of Sciences of the United States of America 101: 2512–2517.
- 5. Haller D, Serrant P, Granato D, Schiffrin EJ, Blum S (2002) Activation of human NK cells by staphylococci and lactobacilli requires cell contact-dependent costimulation by autologous monocytes. Clinical and Diagnostic Laboratory Immunology 9: 649–657.
- 6. Haller D, Bode C, Hammes WP, Pfeifer AM, Schiffrin EJ, et al. (2000) Non-pathogenic bacteria elicit a differential cytokine response by intestinal epithelial cell/leucocyte co-cultures. Gut 47: 79–87.
- 7. Ibnou-Zekri N, Blum S, Schiffrin EJ, von der Weid T (2003) Divergent patterns of colonization and immune response elicited from two intestinal lactobacillus strains that display similar properties in vitro. Infection and Immunity 71: 428–436.
- 8. Bernet MF, Brassart D, Neeser JR, Servin AL (1994) Lactobacillus acidophilus LA 1 binds to cultured human intestinal cell lines and inhibits cell attachment and cell invasion by enterovirulent bacteria. Gut 35: 483–489.
- 9. Granato D, Perotti F, Masserey I, Rouvet M, Golliard M, et al. (1999) Cell surface-associated lipoteichoic acid acts as an adhesion factor for attachment of Lactobacillus johnsonii La1 to human enterocyte-like caco-2 cells. Applied and Environmental Microbiology 65: 1071–1077.
- 10. Neeser JR, Granato D, Rouvet M, Servin A, Teneberg S, et al. (2000) Lactobacillus johnsonii La1 shares carbohydrate-binding specificities with several enteropathogenic bacteria. Glycobiology 10: 1193–1199.
- 11. van der Kaaij H, Desiere F, Mollet B, Germond JE (2004) L-alanine auxotrophy of Lactobacillus johnsonii as demonstrated by physiological, genomic, and gene complementation approaches. Applied and Environmental Microbiology 70: 1869–1873.
- 12. Elli M, Zink R, Reniero R, Morelli L (1999) Growth requirements of Lactobacillus johnsonii in skim an UHT milk. International Dairy Journal 9: 507–507–513.
- 13. Iino T, Uchimura T, Komagata K (2002) The effect of sodium acetate on the growth yield, the production of L- and D-lactic acid, and the activity of some enzymes of the glycolytic pathway of Lactobacillus sakei NRIC 1071(T) and Lactobacillus plantarum NRIC 1067(T). The Journal of General and Applied Microbiology 48: 91–102.
- 14. Chervaux C, Ehrlich SD, Maguin E (2000) Physiological study of Lactobacillus delbrueckii subsp. bulgaricus strains in a novel chemically defined medium. Applied and Environmental Microbiology 66: 5306–5311.
- 15. Bernard E, Rolain T, Courtin P, Guillot A, Langella P, et al. (2011) Characterization of O-acetylation of N-acetylglucosamine: A novel structural variation of bacterial peptidoglycan. The Journal of Biological Chemistry 286: 23950–23958.
- 16. Hols P, Ramos A, Hugenholtz J, Delcour J, de Vos WM, et al. (1999) Acetate utilization in Lactococcus lactis deficient in lactate dehydrogenase: A rescue pathway for maintaining redox balance. Journal of Bacteriology 181: 5521–5526.
- 17. Arioli S, Roncada P, Salzano AM, Deriu F, Corona S, et al. (2009) The relevance of carbon dioxide metabolism in Streptococcus thermophilus. Microbiology (Reading, England) 155: 1953–1965.
- 18. Bringel F, Hubert JC (2003) Extent of genetic lesions of the arginine and pyrimidine biosynthetic pathways in Lactobacillus plantarum, L. paraplantarum, L. pentosus, and L. casei: Prevalence of CO(2)-dependent auxotrophs and characterization of deficient arg genes in L. plantarum. Applied and Environmental Microbiology 69: 2674–2683.
- 19. Stevens MJ, Wiersma A, de Vos WM, Kuipers OP, Smid EJ, et al. (2008) Improvement of Lactobacillus plantarum aerobic growth as directed by comprehensive transcriptome analysis. Applied and Environmental Microbiology 74: 4776–4778.
- 20. Nicoloff H, Hubert JC, Bringel F (2000) In Lactobacillus plantarum, carbamoyl phosphate is synthesized by two carbamoyl-phosphate synthetases (CPS): Carbon dioxide differentiates the arginine-repressed from the pyrimidine-regulated CPS. Journal of Bacteriology 182: 3416–3422.
- 21. Arsene-Ploetze F, Kugler V, Martinussen J, Bringel F (2006) Expression of the pyr operon of Lactobacillus plantarum is regulated by inorganic carbon availability through a second regulator, PyrR2, homologous to the pyrimidine-dependent regulator PyrR1. Journal of Bacteriology 188: 8607–8616.
- 22. Bringel F, Vuilleumier S, Arsene-Ploetze F (2008) Low carbamoyl phosphate pools may drive Lactobacillus plantarum CO2-dependent growth phenotype. Journal of Molecular Microbiology and Biotechnology 14: 22–30.
- 23. Sieuwerts S, Molenaar D, van Hijum SA, Beerthuyzen M, Stevens MJ, et al. (2010) Mixed-culture transcriptome analysis reveals the molecular basis of mixed-culture growth in Streptococcus thermophilus and Lactobacillus bulgaricus. Applied and Environmental Microbiology 76: 7775–7784.
- 24. Pridmore RD, Pittet AC, Praplan F, Cavadini C (2008) Hydrogen peroxide production by Lactobacillus johnsonii NCC 533 and its role in anti-salmonella activity. FEMS Microbiology Letters 283: 210–215.
- 25. den Besten HM, Ingham CJ, van Hylckama Vlieg JE, Beerthuyzen MM, Zwietering MH, et al. (2007) Quantitative analysis of population heterogeneity of the adaptive salt stress response and growth capacity of Bacillus cereus ATCC 14579. Applied and Environmental Microbiology 73: 4797–4804.
- 26.
de Man JC, Rogosa M, Sharpe MEA (1960) A medium for the cultivation of lactobacilli. Journal of Applied Bacteriology : 130–130–135.
- 27. Santos F, Teusink B, Molenaar D, van Heck M, Wels M, et al. (2009) Effect of amino acid availability on vitamin B12 production in Lactobacillus reuteri. Applied and Environmental Microbiology 75: 3930–3936.
- 28. Denou E, Pridmore RD, Berger B, Panoff JM, Arigoni F, et al. (2008) Identification of genes associated with the long-gut-persistence phenotype of the probiotic Lactobacillus johnsonii strain NCC533 using a combination of genomics and transcriptome analysis. Journal of Bacteriology 190: 3161–3168.
- 29. Bekker M, de Vries S, Ter Beek A, Hellingwerf KJ, de Mattos MJ (2009) Respiration of Escherichia coli can be fully uncoupled via the nonelectrogenic terminal cytochrome bd-II oxidase. Journal of Bacteriology 191: 5510–5517.
- 30. den Besten HM, Garcia D, Moezelaar R, Zwietering MH, Abee T (2010) Direct-imaging-based quantification of Bacillus cereus ATCC 14579 population heterogeneity at a low incubation temperature. Applied and Environmental Microbiology 76: 927–930.
- 31. Ingham CJ, Beerthuyzen M, van Hylckama Vlieg J (2008) Population heterogeneity of Lactobacillus plantarum WCFS1 microcolonies in response to and recovery from acid stress. Applied and Environmental Microbiology 74: 7750–7758.
- 32.
Marteyn B, West NP, Browning DF, Cole JA, Shaw JG, et al.. (2010) Modulation of Shigella virulence in response to available oxygen in vivo Nature. 10.1038/nature08970. Available: http://www.nature.com/nature/current_issue/via the Internet.
- 33. Pericone CD, Park S, Imlay JA, Weiser JN (2003) Factors contributing to hydrogen peroxide resistance in Streptococcus pneumoniae include pyruvate oxidase (SpxB) and avoidance of the toxic effects of the fenton reaction. Journal of Bacteriology 185: 6815–6825.
- 34. Dirar H, Collins EB (1973) Aerobic utilization of low concentrations of galactose by Lactobacillus plantarum. Journal of General Microbiology 78: 211–215.
- 35. Murphy MG, Condon S (1984) Correlation of oxygen utilization and hydrogen peroxide accumulation with oxygen induced enzymes in Lactobacillus plantarum cultures. Archives of Microbiology 138: 44–48.
- 36. Melchiorsen CR, Jokumsen KV, Villadsen J, Israelsen H, Arnau J (2002) The level of pyruvate-formate lyase controls the shift from homolactic to mixed-acid product formation in Lactococcus lactis. Applied Microbiology and Biotechnology 58: 338–344.
- 37. Goffin P, Muscariello L, Lorquet F, Stukkens A, Prozzi D, et al. (2006) Involvement of pyruvate oxidase activity and acetate production in the survival of Lactobacillus plantarum during the stationary phase of aerobic growth. Applied and Environmental Microbiology 72: 7933–7940.
- 38. Lorquet F, Goffin P, Muscariello L, Baudry JB, Ladero V, et al. (2004) Characterization and functional analysis of the poxB gene, which encodes pyruvate oxidase in Lactobacillus plantarum. Journal of Bacteriology 186: 3749–3759.