Figures
Abstract
Miniature inverted repeat transposable elements (MITEs) lack protein coding capacity and often share very limited sequence similarity with potential autonomous elements. Their capability of efficient transposition and dramatic amplification led to the proposition that MITEs are an untapped rich source of materials for transposable element (TE) based genetic tools. To test the concept of using MITE sequence in gene transfer, a rice Stowaway MITE previously shown to excise efficiently in yeast was engineered to carry cargo genes (neo and gfp) for delivery into the budding yeast genome. Efficient excision of the cargo gene cassettes was observed even though the excision frequency generally decreases with the increase of the cargo sizes. Excised elements insert into new genomic loci efficiently, with about 65% of the obtained insertion sites located in genes. Elements at the primary insertion sites can be remobilized, frequently resulting in copy number increase of the element. Surprisingly, the orientation of a cargo gene (neo) on a construct bearing dual reporter genes (gfp and neo) was found to have a dramatic effect on transposition frequency. These results demonstrated the concept that MITE sequences can be useful in engineering genetic tools to deliver cargo genes into eukaryotic genomes.
Citation: Fattash I, Bhardwaj P, Hui C, Yang G (2013) A Rice Stowaway MITE for Gene Transfer in Yeast. PLoS ONE 8(5): e64135. https://doi.org/10.1371/journal.pone.0064135
Editor: Michael Freitag, Oregon State University, United States of America
Received: February 2, 2013; Accepted: April 11, 2013; Published: May 21, 2013
Copyright: © 2013 Fattash et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Supported by the National Sciences and Engineering Research Council (NSERC) Discovery Grant (Canada) (RGPIN 371565 to GY), Canadian Foundation for Innovation (CFI24456 and IOF-12 to GY) and Ontario Research Foundation (ORF24456 to GY) and the University of Toronto. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Eukaryotic genomes are rich in repetitive sequences, particularly transposable elements (TEs) that are capable of jumping from one genomic locus to another. Nevertheless, only a small number of TEs produce proteins called transposases to carry out transposition reactions. The majority of TEs do not encode functional transposases, but instead depend on transposases produced by autonomous elements for mobilization. One type of nonautonomous element is wrecked autonomous element, bearing mutations in the transposase coding sequences. In extreme cases, the entire transposase coding sequences are deleted [1], [2]. Another type of nonautonomous elements does not bear protein coding regions, often they share very limited (if any) sequence similarities to transposase coding elements in the genome. Despite the apparent absence of cognate autonomous elements for these orphan elements, many of them appear to be highly efficient in transposition, and therefore exist in high copy numbers in a genome. For example, the human SINE element Alu is mobilized by the transposase produced by L1 elements that share very little sequence similarity with Alu [3]. Over a million copies have accumulated in the human genome [4]. While the high copy number of Alu and other class I TEs is mainly attributed to the “copy and paste” transposition mechanism, dramatic amplification has also been observed for class II TEs that use a “cut and paste” transposition mechanism, which does not inherently favor copy number increase [5], [6]. The most abundant orphan type of non-autonomous class II elements are miniature inverted transposable elements (MITEs) [7].
MITEs are typically very short (<500 bp) and lack any protein coding sequences [8], [9], [10], [11], [12], but they appear to be very effective in transposition and can exist in high copy numbers. A MITE family usually has high intra-family sequence similarity, some even contain a large number of identical copies, suggesting their recent or current transposition activity [1], [10], [13]. However, among the hundreds of identified MITE families, few have apparent cognate autonomous elements [1], [2]. Therefore, most MITE families may have achieved amplification using transposases produced by non-cognate autonomous elements. During evolution, these MITEs may have evolved sequence motifs or structures that allow efficient transposition [7], [14]. Motifs and structures enhancing transposition are sought after features for genetic materials used in TE based genetic tools to deliver cargo genes during transgenesis and mutagenesis.
Canonical use of class II TEs for genetic vectors is to flank cargo genes with the terminal and subterminal sequences of the autonomous elements [15], [16], [17] [18], [19], [20], [21], [22], [23]. However, there are only a limited number of active autonomous element sequences to use. In addition, the activity of autonomous elements may be negatively regulated by the motifs on the subterminal sequences [14]. Orphan type non-autonomous elements with efficient transposition activity such as MITEs may provide additional or alternative sources for efficient TE-based genetic vectors.
MITEs are abundant and often found in or near genes, therefore they can be used as genetic markers. The maize MITE Heartbreaker (Hbr) was used to develop molecular markers for maize [24]. A total of 213 polymorphic fragments were mapped in 100 recombinant inbred lines derived from a cross between the maize inbreds B73×Mo17. Hbr markers are distributed evenly across the 10 maize chromosomes in the studied population. MITE markers (Barfly, Pangrangja and Stowaway) were also integrated into the genetic map of barley [25]. The 214 MITE based AFLP markers were shown to be superior over conventional AFLP mapping. The entire barley genome was covered with a limited set of MITE-based primers, consistent with that of an earlier study using MITEs for genetic mapping of barley genomes [26]. For rice, a Stowaway MITE Pangrangja and a Tourist MITE Ditto were used to reveal polymorphism between the parental lines of intraspecific F15 recombinant inbred lines, locating 78 markers of Ditto and 22 markers of Pangrangja [27]. In addition, a MITE in peanut was used to develop a DNA marker to differentiate chemically induced high-oleate mutants from the normal oleate peanut variety or naturally occurring high-oleate mutants [28]. Recently, the utility of MITEs was demonstrated in the analysis of wheat biodiversity and evolution[29], [30]. MITEs can also be used for gene tagging. The mimp1 element in the Fusarium graminearum genome was used to identify novel pathogenicity genes [31]. The mPing element is active in rice plants [1], [32], [33], [34]. Using transposase sources from Ping and Pong, the transposition activity of mPing has been demonstrated in transgenic heterologous host such as Arabidopsis thaliana [35]. Furthermore, mPing was recently shown to be useful in gene tagging of the soybean genome [36]. Considering the large repository of different MITE families in eukaryotic genomes and their capability of efficient transposition, MITEs are potentially rich sources of genetic materials to engineer genetic tools for transgenesis of both germinal and somatic cells. Despite the recent demonstration of transposition activities for a few other MITE elements including MiHsmar1 in human cell culture, mimp1 in fungus and dTstu1 in potato [2], [31], [37], the potential use of these MITEs for gene transfer remains unclear.
The most abundant type of MITEs in the rice genome is Stowaway. There are 25 families of rice Stowaways with a total copy number of ∼20,000 [38]. These elements bear very short terminal inverted repeats (TIRs) and, like Tc1/mariner elements, they insert specifically at the dinucleotide “TA”. These Stowaways are typical orphan TE families that do not have cognate autonomous elements in the genome. Using yeast as a heterologous host, it has been demonstrated that Stowaways can be mobilized by transposases from rice mariner-like elements Osmars [14], [39]. Particularly, one Stowaway element (Ost35) is excised by the Osmar14 transposase efficiently even though the same transposase excises a non-autonomous Osmar14 poorly. Paradoxically, the Osmar14 terminal sequences showed a stronger affinity than those of Ost35 to the transposase. Further analyses revealed a repressive motif present in the subterminal sequence of Osmar14 and, strikingly, the internal sequence of Ost35 was found to enhance transposition significantly. During these studies, an engineered Ost35 (named 14T32) with its TIRs replaced by those of Osmar14 showed a 20-fold increase in excision frequency. A mutated version of this hybrid element named T7 increased activity by an additional 3-fold [14]. This Stowaway-based hyper active element has the potential to be used as a vector to carry cargo genes for genetic manipulation. However, due to their natural existence in minimal sizes, Stowaway sequences may require their native (uninterrupted) forms to function in transposition. To explore the possibility of using MITE sequences as genetic tools to carry cargo genes, we tested the capacity of T7 to carry cargo genes and analyzed the transposition characteristics of T7-derived vectors.
Here we report the engineering of Stowaway-based constructs and the use of these vectors to carry cargo genes for delivery into the yeast genome. The cargo gene cassettes can be efficiently excised and inserted into yeast genomic DNA, introducing reporter genes into the yeast genome and generating mutations in yeast genes. The inserted elements can be remobilized and increase copy number in a genome. Interestingly, the orientation of a cargo gene (neo) was found to have a dramatic influence on the transposition efficiency of the cassette.
Materials and Methods
Strains and constructs
Yeast strain DG2523 (MATalpha ura3-167 trp1-hisG leu2-hisG his3-del200 ade2-hisG) was used in the study. The aminoglycoside 3′ phosphotransferase gene (neo) from Tn903 (Tn601) was amplified from pITY3 [40], [41] with 5′ phosphorylated primers 5′ ggatccgggttacattgcacaaga 3′ and 5′ ggatccggcgccgtcccgtcaagt 3′. Gel purified PCR product was inserted at the BsaAI site on the plasmid pT7, resulting in pT7-neo. The green fluorescence protein gene (gfp) coding sequence was amplified from pBin-mGFP5-er [42] using Pfu DNA polymerase (iProof, Biorad) with primers 5′ atctcaggatccatgagtaaaggagaagaacttttcactggaga 3′ and 5′ atctcagaattcttaaagctcatcatgtttgtatagttcatccatgc 3′, the amplicon was cloned between BamHI and EcoRI sites on the backbone of pOsm14Tp so that gfp is expressed from the gal1 promoter. The fragment containing the gal1 promoter and the gfp fragment and cyc1 terminator was amplified with Pfu DNA polymerase with primers 5′ ctagtacggattagaagccgccg 3′ and 5′ gtttaaacgcaaattaaagccttcgagcgtcc 3′ and cloned at the BsaAI site of pT7, resulting in plasmid pT7-gfp. To construct pT7-gfp-neo and pT7-gfp-oen, the PmeI restriction site that was attached to the reverse primer to amplify the gfp gene was used to clone the neo gene. The orientation of the constructs was determined from the gel banding pattern after restriction enzyme digestion. The neo gene was cloned into the BsaAI site of pOst35 to make pOst35-neo. To construct p14TIR-neo, PCR primers for neo gene amplification were attached with the terminal 32 bp sequences of Osmar14 on the 5′ end. PCR products using pfu were cloned into the HpaI site inside the ade2 gene on pWL89A [43].
Yeast excision assay
Yeast excision assays were performed according to the procedure described previously [14], [39]. Briefly, yeast competent cells were transformed with pOsm14Tp and the constructs described above and double transformants were selected on yeast dropout medium lacking histidine and uracil in the presence of 2% galactose and 1% raffinose to induce transposase production. After incubation at room temperature, cells from a colony were resuspended in 50 µl of water and 49 µl plated on medium lacking adenine to select for ade2 revertants. The reversion frequency was calculated as the number of revertants per cell per generation. The number of generations was estimated using the formula: N = log2T, where N is the number of generations and T is the number of total viable cells. The number of total viable cells of a colony was determined by plating 49 µl diluted (1.6×105) cell suspension on YPD plates. Genomic DNA extracted from revertants was used in PCR to amplify the donor sites using primers 5′ gggttttccattcgtcttgaagtcgaggac 3′ and 5′ catttccacaccaaatataccacaaccggga 3′. PCR products were sequenced at The Center for Applied Genomics (The Hospital for Sick Children, Toronto) and the donor sites were inspected for transposition footprints.
Yeast insertion assay
To detect insertion of cargo gene cassettes into the yeast genome, colonies incubated on transposase induction medium were cultured in YPD to allow some cells to lose the transformed plasmids bearing the original cargo gene cassettes. Then a appropriately diluted YPD culture suspension was plated onto complete synthetic medium (Sunrise Science Products, Inc., CA) lacking histidine but containing 1% 5-fluoroorotic acid (5-FOA, BioBasic) to obtain well separated colonies. This medium selects for cells that have lost the plasmid carrying the cargo gene construct, but retained the transposase construct (pOsm14Tp). For pT7-neo, the colonies on 5-FOA medium were replica plated onto YPD plates containing the antibiotic G418 (100 mg/L, BioShop) to select for cells containing a transposed copy of the neo gene. For constructs bearing the gfp gene, colonies grown on plates containing 5-FOA were examined under blue light to identify colonies with green fluorescence using a SteREO Discovery 12 microscope (Carl Zeiss). The insertion frequency was calculated as the number of G418 resistant colonies (for T7-neo) or GFP expressing colonies (for T7-gfp) divided by the total number of 5-FOA tolerant colonies. The presence or absence of the T7-neo cassette was verified by PCR amplification using primers 5′ tactccctccgtcccagaaagaagggattc 3′ and 5′ tgctcgatgagtttttctaatcagaattggttaattggttgt 3′. The presence or absence of the T7-gfp cassette was verified by PCR amplification using primers 5′ tactccctccgtcccagaaagaagggattc 3′ and 5′ atctcagaattcttaaagctcatcatg 3′. The presence or absence of the donor plasmid was verified by PCR amplification of the ade2 coding sequence using primers 5′ gggttttccattcgtcttgaagtcgaggac 3′ and 5′ catttccacaccaaatataccacaaccggga 3′ and by culturing the colonies in complete synthetic medium with or without uracil.
Inverse PCR and insertion site sequencing
To determine the insertion sites of the transposed elements, yeast genomic DNA was extracted from liquid culture of individual colonies using E.Z.N.A.® Yeast DNA Kit (Omega BioTek). Genomic DNA (200 ng) was digested with MseI and ligated with T4 DNA ligase (NEB) in a 10 µl reaction at 16°C for 16 hours. The digestion/ligation product was diluted 100 times and 1 µl was used as a template for 20 µl PCR reaction using 2× PCR Master Mix (NEB) with primers 5′ ggtatttttgtcattctccatctcc 3′ and 5′ tgctgagggtaggtaggatggta 3′. Nested PCR was performed using 1 µl of the initial PCR product using 5′ tcacctcgggatgccaggaa 3′ and 5′ tgggacaaaattcaaactccaga 3′ primers. Individual gel bands from the amplified products were gel extracted and subsequently sequenced at The Center for Applied Genomics with the PCR primer 5′ tgggacaaaattcaaactccaga 3′. Genomic locations and annotations of insertion sequences were retrieved from Saccharomyces Genome Database (SGD) at www.yeastgenome.org.
Genomic DNA blot analysis
Yeast genomic DNA (∼200 ng) was digested with NdeI and XhoI separated on an agarose gel (1%). DNA was electro-blotted onto nylon membrane using Mini Trans-Blot® Module (BioRad). Gel purified PCR product of T7-neo fragment amplified from pT7-neo was used as the template for probe preparation. Probe preparation and hybridization were performed using DIG high prime DNA labeling and detection starter kit I (Roche) according to the manual.
Serial culture of yeast cells
Cultures of yeast bearing only a transposed copy of the T7-neo cassette were maintained continuously in the lab. Every 2–3 days, 200 µl culture was sub-cultured in 1.8 ml fresh complete synthetic liquid medium lacking histidine but containing 2% galactose and 1% raffinose at 30°C. An aliquot of 50 week old culture was plated onto solid medium lacking histidine and containing 2% galactose and 1% raffinose to obtain single colonies and to further induce transposition.
Results
1. Excision of Stowaway-based cargo gene cassettes
The hybrid Stowaway element T7 (240 bp) is hyper active in excision [14]. Cargo genes neo (1,213 bp), gfp (1,740 bp) and gfp-neo (2,713 bp) were cloned into the BsaAI site in the middle of T7 (Fig. 1A). In addition, the neo gene was also cloned into the BsaAI site of Ost35 (Ost35-neo) and between the TIR sequences of Osmar14 (14TIR-neo). After co-transformation with the plasmid (pOsm14Tp) bearing the Osmar14 transposase gene (Fig. 1B), colonies were grown on galactose medium to induce transposase required for the excision assay [14], [39]. As expected, no ade2 revertant was obtained from any of the control plasmid lacking the transposase gene. Hundreds of ade2 revertant colonies were obtained from the positive control pT7 and all vectors derived from pT7 (Fig. 2A, Table S1). Only one colony was obtained for Ost35-neo and 14TIR-neo (Fig. 2A). These results suggest that gene cassettes carried in T7 are excised efficiently.
Vertical yellow line, mutated site on T7; P, promoter for neo gene; T, terminator of neo gene; Pgal1, gal1 promoter; Tcyc1, terminator of cyc1. Donor plasmids are based on the pWL89A backbone. Constructs lengths are to scale. The plasmid pRS413 that does not carry the transposase gene was used as the control. No ade2 revertant was obtained on any control plate. Small arrowheads, positions for PCR primers to check the presence or absence of corresponding genes. The first three tracks show three different constructs used for integration at the BsaAI site (as mentioned in the text).
(A) plates of medium lacking adenine in the presence (bottom row) and absence of transposase sources (top row), cells in each sector on a plate were from a separate colony incubated on medium lacking histidine and uracil for 14 days. (B) PCR amplification of the donor sites in the ade2 revertants. C, plasmid control; (C) Sequences of the donor sites in the ade2 revertants. Red letters, target site dinucleotide “TA”. Dashes, empty space. The donor sites containing TEs are shown on top of the donor sites containing footprints. (D) Reversion frequency for the constructs T7, T7-neo, T7-gfp, T7-neo-gfp. The reversion frequency (left y-axis) is plotted against the length of the cargo cassettes (right y-axis). Error bars, standard error of the mean for three independent replicates. Plates were incubated on transposase induction medium for nine days.
Genomic DNA extracted from the revertants was used for PCR amplification of the donor site inside the ade2 coding sequence. Compared to the plasmid control, all of the revertants resulted in shorter PCR products with the size of about 300 bp, indicating the loss of the elements from the donor sites in the revertants (Fig. 2B). Sequencing of the PCR products confirmed the loss of the element and revealed footprints typically containing relic residues from the end of the TE left at the donor sites. Therefore, these revertants resulted from transposition events that have the excision sites repaired to restore the ade2 reading frame (Fig. 2C).
2. Cargo gene sizes and excision frequency
Among the constructs, pT7-neo has the highest reversion frequency (6.07×10−7 per cell per generation), about half of that for T7. The reversion frequency for T7-gfp (5.77×10−8 per cell per generation) is about one tenth of that for T7-neo (Fig. 2D, Table S2). The reversion frequency for T7-gfp-neo (2.17×10−8 per cell per generation) is about one thirtieth of that for T7-neo even though hundreds of ade2 revertants can be reproducibly obtained from a single colony bearing the construct. When the frequencies were plotted against the sizes of the elements (240, 1,213 bp, 1,740 bp and 2,713 bp), a negative correlation between the reversion frequencies and the sizes of the cassettes is apparent (Fig. 2D, Table S2). Similar observations have been reported for other TEs such as Mos1, IS50 and IS1 [44], [45], [46]. However, this negative correlation between cargo size and excision frequency can be disturbed by the configuration of cargo genes as described in “Effect of Orientation of neo gene on transposition efficiency”.
3. Insertion of cargo gene cassettes
To detect insertions of the excised gene cassettes, yeast colonies carrying pOsm14Tp and a T7 based vector (pT7-neo or p T7-gfp) were plated on transposase induction medium. Cells in these colonies were allowed to lose their plasmids by subculturing in YPD medium without selection pressure. Cells that have lost the donor plasmid harboring the ura3 gene were counter selected on medium containing 5-FOA (Fig. 3A). Previous studies suggested that about 1% of the yeast cells carrying the CEN/ARS sequences will lose the plasmid every generation [47], [48]. For pT7-neo, colonies growing on 5-FOA were selected for the presence of neo gene by G418 resistance (Fig. 3B). The insertion frequency for T7-neo was determined to be 1.12±0.27×10−3 of the 5-FOA tolerant colonies (per cell per generation). Twenty-three colonies were picked for genomic DNA extraction and subsequent PCR amplification to check whether the cargo gene and the ade2 gene were present. All of the analyzed 23 colonies contained the cargo gene, but the ade2 gene was not amplified in any of them, confirming loss of the donor plasmid (Fig. 3C). In addition, these colonies were unable to grow in medium lacking uracil, indicating the loss of the donor plasmid (Fig. 3D). Seven genomic DNA samples were also used for DNA blot analysis. While none of the seven colonies contained the ade2 gene, they all contained the cargo genes. Based on the presence of different sized digestion fragments, some of the insertions are apparently at different genomic locations (Fig. 3E). A similar procedure was used to detect insertions of T7-gfp (Fig. 4A). Colonies growing on medium containing 5-FOA were examined for green fluorescence under blue light (Fig. 4B). The genomic insertion frequency for T7-gfp was determined to be 1.82±0.93×10−4 (per cell per generation). PCR amplification using yeast DNA was performed to determine the presence or absence of the gfp gene and the ade2 gene in yeast. While none of the 8 analyzed colonies carried the ade2 gene, all of them contained the T7-gfp cargo gene cassette (Fig. 4C). In addition, these colonies were unable to grow in medium lacking uracil (Fig. 4D). These results suggest that cargo genes transposed from the donor plasmids into yeast DNA.
(A) schematic experimental procedure to select for genomic insertion of T7-neo (see Materials and Methods); (B) selection of G418 resistant colonies in the presence (right) and absence of (left) transposase sources; (C) PCR amplification of ade2 gene coding sequence; N, negative control using DG2523 genomic DNA; P, positive control using plasmid pT7-neo. (D) growth of G418 resistant colonies on complete synthetic medium with (bottom) or without (top) uracil. (E) Genomic DNA blot analysis. P, plasmid (pT7-neo) control; N, negative control of yeast genomic DNA not containing T7-neo fragment. Both images were from the same blot but hybridized with different probes. (F) Inverse PCR amplification of insertion sites in G418 resistant colonies. C, control using DG2523 yeast genomic DNA. Plates were incubated on transposase induction medium for two weeks.
(A) schematic experimental procedure to identify genomic insertion of T7-gfp (see Materials and Methods); (B) Colonies in the presence (right) and absence of (left) transposase sources; (C) PCR amplification of ade2 gene coding sequence; N, negative control using DG2523 yeast genomic DNA; P, positive control using plasmid pT7-gfp. (D) growth of green fluorescent colonies in complete synthetic medium with (bottom) or without (top) uracil; (E) Inverse PCR amplification of insertion sites for green fluorescent colonies. C, control using DG2523 yeast genomic DNA. Plates were incubated on transposase induction medium for two weeks.
To determine insertion site sequences, inverse PCR was performed and the PCR products were sequenced (Fig. 3F, 4E). All of the 25 obtained insertion sites are at the dinucleotides “TA” (Table S3), 16 (64%) are in genes and 9 (36%) are in intergenic regions. The haploidy of the strain used in this study may have lowered the percentage of insertions in coding sequences due to reduced fitness or lethality resulted from mutations of essential genes, nevertheless, the 64% insertion in genes is within the range of the ∼70% protein coding content of the genome. Interestingly, while all of the insertion sites from T7-gfp and T7-gfp-oen, a construct bearing the neo gene in opposite orientation to that in T7-gfp-neo, are on yeast chromosomes (Table S3), 7 (36.8%) from T7-neo are on the yeast 2 µ plasmid. Since the colonies bearing insertions for the first two constructs were identified by GFP expression, the selection on G418 for T7-neo may have arbitrarily enriched cells bearing insertions on the 2 µ plasmid. Since yeast strains often carry the 2 µ plasmid at 50–100copies/cell [49], the gfp marker appears to be better at generating insertions into chromosomes.
4. Remobilization and copy number increase
Increase in copy number of a TE element depends on remobilization of an existing element. The neo gene was shown to have a dosage dependent resistance to G418, therefore a higher copy number of neo can be enriched on medium containing a higher concentration of G418 [40]. To understand whether a primary insertion of a T7-neo gene cassette can be remobilized and result in an increase in copy number, yeast strain L7 containing an initial insertion of T7-neo into the 2 µ plasmid was used. The yeast strain was serially sub-cultured in liquid synthetic medium containing galactose for transposase induction but lacking histidine to retain the transposase plasmid (see Materials and Methods). This condition favors the loss of the 2 µ plasmid from yeast cells [50]. An aliquot was sub-cultured on solid transposase inducing medium to obtain single colonies. Cells from a randomly picked colony were plated onto medium containing a relatively high level of G418 (500 mg/L) to select for cells expressing a relatively high level of neo expression. The insertion sites in these cells were determined by inverse PCR and subsequent sequencing of the PCR products (Fig. 5A). None of the obtained insertion sites are in the 2 micron plasmid, suggesting the loss of the 2 micron plasmid and remobilization of the original insertion into a yeast chromosome location (Table S4). Among the 20 analyzed colonies, 12 exhibited multiple bands in inverse PCR, and at least eight were confirmed to have two or more genomic copies of the gene cassette. Two contained at least three copies. While an early genomic insertion site in this lineage can be inferred to be at chromosome XV at 81,298 because of its high frequency of occurrence, the exact order of transposition events in this lineage is not clear. These results suggest that primary insertions of the gene cassette can be remobilized and result in an increase in the copy number of cargo genes.
(A) Inverse PCR amplification of T7-neo insertion sites of the colonies on higher level of G418 (see Materials and Methods). C, negative control using the genomic DNA of the yeast strain. (B) T7-neo insertion sites in Table S4 mapped on yeast schematic chromosomes. Short vertical bars, insertion sites with the red bar representing the inferred first insertion on chromosomes.
5. Linked and unlinked transposition
Tc1/mariner elements have been shown to have a preference to transpose locally [51]. An excised element can be inserted into a linked DNA molecule (linked) or into an unlinked DNA location (unlinked). To investigate whether T7 derived cargo vectors have a preference to transpose to linked DNA molecules, we determined the ratio of linked and unlinked transposition for T7-gfp construct (Fig. 6A). In an excision assay using pT7-gfp, ade2 revertants were selected on medium containing galactose to induce GFP expression. Among the revertants, 186 of 220 (∼84%) showed green fluorescence, suggesting that 16% of the revertants lost the gfp gene. The absence of T7-gfp in these colonies was confirmed by PCR amplification (Fig. 6B). The colonies expressing GFP were allowed to lose the donor plasmid by culturing in YPD medium. Cells missing the donor plasmid were selected on medium containing 5-FOA and galactose. Genomic insertions of the T7-gfp results in GFP expression in these colonies and donor plasmid insertions of T7-gfp gene results in the loss of GFP expression in these colonies. Therefore, either all of the colonies growing on this medium express GFP (unlinked insertion) or none of the colonies express GFP (linked insertion) (Fig. 6C). Among the 80 analyzed ade2 revertant colonies, 40 (50%) resulted in colonies expressing GFP on 5-FOA plates containing galactose, suggesting that 50% of the excised elements inserted linked into new loci on the donor plasmid and 50% inserted unlinked into yeast genomic DNA (Table S5). In addition, when the insertion sites of T7-neo listed in Table S4 were mapped onto the schematic yeast chromosomes (Fig. 5B), four clusters of doublet or triplet insertion sites were observed, probably resulted from local transposition events.
(A) Schematic experimental procedure to determine the rate of loss of the excised elements, linked and unlinked insertion; (B) PCR amplification of the donor sites in ade2 coding sequences (top) and the cargo gene cassette T7-gfp in the ade2 revertant colonies that do not express GFP. C, pT7-gfp plasmid control; (C) Presence (left) or absence (right) of GFP expression in the colonies that have lost the donor plasmids (on medium containing 5-FOA).
6. Effect of Orientation of neo gene on transposition efficiency
As described above, the gfp reporter resulted in a higher proportion of chromosomal integrations compared to the neo reporter (Table S3). The neo gene is useful for identifying remobilization and copy number increase. Therefore a dual gene cassette is a desirable construct to achieve these purposes. However, as shown in Fig. 2, the transposition frequency of a dual cassette in pT7-gfp-neo is significantly lower than that of the T7-neo and T7-gfp. We tested a construct bearing both gfp and neo but with the neo gene cloned in a different orientation from that on pT7-gpf-neo, therefore named as T7-gfp-oen (Fig. 7A). This construct was used to perform excision and insertion assays in comparison with T7-gfp and T7- gfp-neo. Strikingly, the ade2 reversion frequency for pT7-gfp-oen was about 20-fold of that for pT7-gfp-neo and about two-fold of that for pT7-gfp. Similarly, the insertion frequency for pT7- gfp-oen was nearly four-fold of that for pT7-gfp (Fig. 7B). Therefore, pT7-gfp-oen is an efficient vector both for the selection of insertions into genomic locations and for detecting copy number increase of the cargo gene construct. These results also suggest that, when large cargo cassettes are used, transposition efficiency may be enhanced with a specific cargo gene configuration that breaks the negative correlation between cargo size and transposition frequency observed for a number of elements [44], [45], [46].
(A) schematic structure of the T7-gfp-oen cargo gene cassette. Legends are the same as those in Fig. 1. (B) Relative ade2 reversion efficiency (left) and cargo gene cassette insertion frequency (right) of the three constructs. The mean values of both reversion frequency and insertion frequency for T7-gfp were arbitrarily designated as 100%. Error bar, standard error of the mean for six independent replicates.
Discussion
In our studies, a Stowaway sequence was shown to be useful for gene delivery and mutagenesis in yeast. Even though a cargo gene cassette carried by the original MITE Ost35 did not result in efficient transposition activity, the internal sequence of this MITE is critical to the high transposition efficiencies for the hybrid Stowaway T7 based vectors. Even though this Stowaway has not been used for gene transfer in rice or other higher eukaryotes, the results obtained from the studies in yeast demonstrated the capability of MITE sequences in gene transfer. The fact that the rice MITE can be used to transfer genes into yeast suggests that they may also be useful for gene transfer in other heterologous hosts. The numerous MITE families in eukaryotic genomes can be a rich source of materials for TE based genetic vectors. However, the exact transposase sources for most of MITE families remain to be determined.
In this study, a surprising increase of transposition efficiency was observed simply by inverting the neo gene on the dual reporter gene vector. With few exceptions, conventional wisdom expects a negative correlation between the construct sizes and transposition efficiencies 44,45,46,52. This was observed for T7, T7-neo, and T7-gfp-neo. However, the plasmid containing the inverted neo (pT7-gfp-oen) did not follow the trend. The increased activity for pT7-gfp-oen is attributable to enhancement caused by the inverted orientation of neo gene. Interestingly, when the same neo gene was inserted into the Mariner element Mos1, no difference in transposition frequency was observed even when the neo gene was reversed in an in vitro assay [46]. One explanation for this observation can be due to the non-specific binding between the transposase and the neo sequence. Alternatively, changes in transposition efficiency may be caused by the changed direction of neo gene transcription. For example, the machinery associated with the transcription of the gfp gene and the neo gene toward each other on pT7-gfp-oen may facilitate the formation of synaptic complexes, or alternatively the transcription of the neo gene in pT7-gfp-neo may cause run off transcripts through the right TIR to reduce its accessibility by transposases. Since high transposition efficiency is desirable for TE based genetic tools, the observation of a dramatic influence of the orientation of a cargo gene on transposition efficiency may facilitate the optimization of a TE based genetic tool.
In addition to demonstrating the use of MITE for genetic tools, these studies also provided a tool for genetic manipulation of yeast. Even though studies of yeast genes benefited from a number of efficient genetic tools, TEs can be very useful in mutagenesis. The endogeneous Ty retroelements have been shown to be efficient in mutagenesis [41]. Unlike retroelements, cut-and-paste TEs can excise from an insertion site therefore potentially leading to the restoration of the function of a mutated gene. Since the demonstration of transposition activity of the Ac element in yeast, transposition assay has been subsequently established in budding yeast for several other elements including the rice Mariner-like elements (Osmar5 and Osmar17) and Stowaway MITE Ost35, the housefly Hermes element and the flour beetle TcBuster element [14], [39], [43], [53], [54]. Insertion frequency was reported only for Hermes (2.5×10−5 per cell generation for the native transposase and 7×10−2 per cell generation for a hyperactive mutant transposase) and TcBuster (5×10−4 per cell generation). The transposition rate of the T7 derived constructs can be further increased upon improvement of the Osmar14 transposase, nevertheless, the insertion frequency of 1.12×10−3 per cell generation for T7-neo in our findings is within the range considered ideal for generating libraries with a large number of cells bearing a single insertion while minimizing double or multiple insertions [55]. Recently, a piggyBac based mutagenesis system has been demonstrated to be powerful in identifying both loss-of-function and gain-of-function alleles [56]. Excision of the piggyBac elements rarely leaves footprints, leading to complete reversion of the insertion sites. Since the transposition of Mariner elements and Stowaway MITEs generates TSDs of only two nucleotides, they are presumably less disruptive than hAT elements upon excision from a coding sequence.
Supporting Information
Table S1.
Excision assay raw data for Fig. 2A.
https://doi.org/10.1371/journal.pone.0064135.s001
(DOCX)
Table S2.
Excision assay raw data for Fig. 2D.
https://doi.org/10.1371/journal.pone.0064135.s002
(DOCX)
Table S3.
Insertions sites of hybrid Stowaway T7 derived vectors carrying cargo genes.
https://doi.org/10.1371/journal.pone.0064135.s003
(DOCX)
Table S5.
Linked and unlinked transposition.
https://doi.org/10.1371/journal.pone.0064135.s005
(DOCX)
Acknowledgments
We would like to thank Dr. Dane Wittrup (MIT) for providing plasmid pITY3 and Dr. Teresa Crease (University of Guelph) for comments on the manuscript.
Author Contributions
Conceived and designed the experiments: GY. Performed the experiments: IF PB CH GY. Analyzed the data: IF PB CH GY. Wrote the paper: IF GY.
References
- 1. Jiang N, Bao Z, Zhang X, Hirochika H, Eddy SR, et al. (2003) An active DNA transposon family in rice. Nature 421: 163–167.
- 2. Miskey C, Papp B, Mates L, Sinzelle L, Keller H, et al. (2007) The ancient mariner sails again: transposition of the human Hsmar1 element by a reconstructed transposase and activities of the SETMAR protein on transposon ends. Mol Cell Biol 27: 4589–4600.
- 3. Dewannieux M, Esnault C, Heidmann T (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat Genet 35: 41–48.
- 4. Batzer MA, Deininger PL (2002) Alu repeats and human genomic diversity. Nature Reviews Genetics 3: 370–379.
- 5. Langdon T, Jenkins G, Hasterok R, Jones RN, King LP (2003) A high-copy-number CACTA family transposon in temperate grasses and cereals. Genetics 163: 1097–1108.
- 6. Naito K, Cho E, Yang GJ, Campbell MA, Yano K, et al. (2006) Dramatic amplification of a rice transposable element during recent domestication. Proceedings of the National Academy of Sciences of the United States of America 103: 17620–17625.
- 7.
Feschotte C, Zhang X, Wessler SR (2002) Miniature Inverted-repeat Transposable Elements (MITEs) and their relationship with established DNA transposons. In: Craig N, Craigie R, Gellert M, Lambowitz A, editors. Mobile DNA II. Washington D.C.: American Society of Microbiology Press. pp. 1147–1158.
- 8. Bureau TE, Wessler SR (1992) Tourist: a large family of small inverted repeat elements frequently associated with maize genes. Plant Cell 4: 1283–1294.
- 9. Charrier B, Foucher F, Kondorosi E, d'Aubenton-Carafa Y, Thermes C, et al. (1999) Bigfoot. a new family of MITE elements characterized from the Medicago genus. Plant J 18: 431–441.
- 10. Zhang X, Feschotte C, Zhang Q, Jiang N, Eggleston WB, et al. (2001) P instability factor: an active maize transposon system associated with the amplification of Tourist-like MITEs and a new superfamily of transposases. Proc Natl Acad Sci U S A 98: 12572–12577.
- 11. Yang G, Dong J, Chandrasekharan MB, Hall TC (2001) Kiddo, a new transposable element family closely associated with rice genes. Mol Genet Genomics 266: 417–424.
- 12. Yang G, Hall TC (2003) MDM-1 and MDM-2: two mutator-derived MITE families in rice. J Mol Evol 56: 255–264.
- 13. Yang G, Wong A, Rooke R (2012) ATon, abundant novel nonautonomous mobile genetic elements in yellow fever mosquito (Aedes aegypti). BMC Genomics 13: 283.
- 14. Yang GJ, Nagel DH, Feschotte C, Hancock CN, Wessler SR (2009) Tuned for Transposition: Molecular Determinants Underlying the Hyperactivity of a Stowaway MITE. Science 325: 1391–1394.
- 15. Gueiros FJ, Beverley SM (1997) Trans-kingdom transposition of the Drosophila element mariner within the protozoan Leishmania (vol 276, pg 1716, 1997). Science 277: 753–753.
- 16. Fadool JM, Hartl DL, Dowling JE (1998) Transposition of the mariner element from Drosophila mauritiana in zebrafish. Proc Natl Acad Sci U S A 95: 5182–5186.
- 17. Bessereau JL, Wright A, Williams DC, Schuske K, Davis MW, et al. (2001) Mobilization of a Drosophila transposon in the Caenorhabditis elegans germ line. Nature 413: 70–74.
- 18. Fischer SE, Wienholds E, Plasterk RH (2001) Regulated transposition of a fish transposon in the mouse germ line. Proc Natl Acad Sci U S A 98: 6759–6764.
- 19. Horie K, Kuroiwa A, Ikawa M, Okabe M, Kondoh G, et al. (2001) Efficient chromosomal transposition of a Tc1/mariner- like transposon Sleeping Beauty in mice. Proc Natl Acad Sci U S A 98: 9191–9196.
- 20. Spradling AC, Rubin GM (1982) Transposition of Cloned P Elements into Drosophila Germ Line Chromosomes. Science 218: 341–347.
- 21. Rubin GM, Spradling AC (1982) Genetic-Transformation of Drosophila with Transposable Element Vectors. Science 218: 348–353.
- 22. Ding S, Wu XH, Li G, Han M, Zhuang Y, et al. (2005) Efficient transposition of the piggyBac resource (PB) transposon in mammalian cells and mice. Cell 122: 473–483.
- 23. Lozovsky ER, Nurminsky D, Wimmer EA, Hartl DL (2002) Unexpected stability of mariner transgenes in Drosophila. Genetics 160: 527–535.
- 24. Casa AM, Mitchell SE, Smith OS, Register JC, Wessler SR, et al. (2002) Evaluation of Hbr (MITE) markers for assessment of genetic relationships among maize (Zea mays L.) inbred lines. Theoretical and Applied Genetics 104: 104–110.
- 25. Takahashi H, Akagi H, Mori K, Sato K, Takeda K (2006) Genomic distribution of MITEs in barley determined by MITE-AFLP mapping. Genome 49: 1616–1620.
- 26. Chang RY, O'Donoughue LS, Bureau TE (2001) Inter-MITE polymorphisms (IMP): a high throughput transposon-based genome mapping and fingerprinting approach. Theoretical and Applied Genetics 102: 773–781.
- 27. Kwon SJ, Hong SW, Son JH, Lee JK, Cha YS, et al. (2006) CACTA and MITE transposon distributions on a genetic map of rice using F-15 RILs derived from Milyang 23 and Gihobyeo hybrids. Molecules and Cells 21: 360–366.
- 28. Patel M, Jung S, Moore K, Powell G, Ainsworth C, et al. (2004) High-oleate peanut mutants result from a MITE insertion into the FAD2 gene. Theoretical and Applied Genetics 108: 1492–1502.
- 29. Yaakov B, Ben-David S, Kashkush K (2012) Genome-wide analysis of Stowaway-like MITEs in wheat reveals high sequence conservation, gene association and genomic diversification. Plant Physiol
- 30. Yaakov B, Ceylan E, Domb K, Kashkush K (2012) Marker utility of miniature inverted-repeat transposable elements for wheat biodiversity and evolution. Theor Appl Genet 124: 1365–1373.
- 31. Dufresne M, van der Lee T, Ben M'Barek S, Xu XD, Zhang X, et al. (2008) Transposon-tagging identifies novel pathogenicity genes in Fusarium graminearum. Fungal Genetics and Biology 45: 1552–1561.
- 32. Lin XY, Long LK, Shan XH, Zhang SY, Shen S, et al. (2006) In planta mobilization of mPing and its putative autonomous element Pong in rice by hydrostatic pressurization. Journal of Experimental Botany 57: 2313–2323.
- 33. Kikuchi K, Terauchi K, Wada M, Hirano HY (2003) The plant MITE mPing is mobilized in anther culture. Nature 421: 167–170.
- 34. Nakazaki T, Okumoto Y, Horibata A, Yamahira S, Teraishi M, et al. (2003) Mobilization of a transposon in the rice genome. Nature 421: 170–172.
- 35. Yang G, Zhang F, Hancock CN, Wessler SR (2007) Transposition of the rice miniature inverted repeat transposable element mPing in Arabidopsis thaliana. Proc Natl Acad Sci U S A 104: 10962–10967.
- 36. Hancock CN, Zhang F, Floyd K, Richardson AO, LaFayette P, et al. (2011) The Rice Miniature Inverted Repeat Transposable Element mPing Is an Effective Insertional Mutagen in Soybean. Plant Physiology 157: 552–562.
- 37. Momose M, Abe Y, Ozeki Y (2010) Miniature Inverted-Repeat Transposable Elements of Stowaway Are Active in Potato. Genetics 186: 59–U115.
- 38. Feschotte C, Swamy L, Wessler SR (2003) Genome-wide analysis of mariner-like transposable elements in rice reveals complex relationships with stowaway miniature inverted repeat transposable elements (MITEs). Genetics 163: 747–758.
- 39. Yang G, Weil CF, Wessler SR (2006) A rice Tc1/mariner-like element transposes in yeast. Plant Cell 18: 2469–2478.
- 40. Parekh RN, Shaw MR, Wittrup KD (1996) An integrating vector for tunable, high copy, stable integration into the dispersed Ty delta sites of Saccharomyces cerevisiae. Biotechnology Progress 12: 16–21.
- 41. Garfinkel DJ, Mastrangelo MF, Sanders NJ, Shafer BK, Strathern JN (1988) Transposon Tagging Using Ty Elements in Yeast. Genetics 120: 95–108.
- 42. Haseloff J, Siemering KR, Prasher DC, Hodge S (1997) Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proceedings of the National Academy of Sciences of the United States of America 94: 2122–2127.
- 43. Weil CF, Kunze R (2000) Transposition of maize Ac/Ds transposable elements in the yeast Saccharomyces cerevisiae. Nature Genetics 26: 187–190.
- 44. Goryshin I, Kil YV, Reznikoff WS (1994) DNA length, bending, and twisting constraints on IS50 transposition. Proc Natl Acad Sci U S A 91: 10834–10838.
- 45. Chandler M, Clerget M, Galas DJ (1982) The Transposition Frequency of Is1-Flanked Transposons Is a Function of Their Size. Journal of Molecular Biology 154: 229–243.
- 46. Tosi LRO, Beverley SM (2000) cis and trans factors affecting Mos1 mariner evolution and transposition in vitro, and its potential for functional genomics. Nucleic Acids Research 28: 784–790.
- 47. Clarke L, Carbon J (1980) Isolation of a yeast centromere and construction of functional small circular chromosomes. Nature 287: 504–509.
- 48. Hsiao CL, Carbon J (1981) Characterization of a yeast replication origin (ars2) and construction of stable minichromosomes containing cloned yeast centromere DNA (CEN3). Gene 15: 157–166.
- 49. Zakian VA, Brewer BJ, Fangman WL (1979) Replication of Each Copy of the Yeast 2-Micron-DNA Plasmid Occurs during the S-Phase. Cell 17: 923–934.
- 50. Mead DJ, Gardner DC, Oliver SG (1986) The yeast 2 micron plasmid: strategies for the survival of a selfish DNA. Mol Gen Genet 205: 417–421.
- 51. Luo GB, Ivics Z, Izsvak Z, Bradley A (1998) Chromosomal transposition of a Tc1/mariner-like element in mouse embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 95: 10769–10773.
- 52. Way JC, Kleckner N (1985) Transposition of plasmid-borne Tn10 elements does not exhibit simple length-dependence. Genetics 111: 705–713.
- 53. Gangadharan S, Mularoni L, Fain-Thornton J, Wheelan SJ, Craig NL (2010) DNA transposon Hermes inserts into DNA in nucleosome-free regions in vivo. Proceedings of the National Academy of Sciences of the United States of America 107: 21966–21972.
- 54. Li X, Ewis H, Hice RH, Malani N, Parker N, et al. (2012) A resurrected mammalian hAT transposable element and a closely related insect element are highly active in human cell culture. Proc Natl Acad Sci U S A
- 55. Evertts AG, Plymire C, Craig NL, Levin HL (2007) The hermes transposon of Musca domestica is an efficient tool for the mutagenesis of Schizosaccharomyces pombe. Genetics 177: 2519–2523.
- 56. Li J, Zhang JM, Li X, Suo F, Zhang MJ, et al. (2011) A piggyBac transposon-based mutagenesis system for the fission yeast Schizosaccharomyces pombe. Nucleic Acids Res 39: e40.