Expression of Concern
After publication of this article [1], concerns were raised about the identity of the cell lines used in the study, regions of overlap between some image panels in Fig 4, western blot methodology and representation in Fig 5, and the availability of the underlying data.
Four of the eight nasopharyngeal carcinoma (NPC) cell lines used in the qPCR experiment shown in Fig 1B have been reported elsewhere to be possibly contaminated or misidentified (CNE1, CNE2, HONE1, and HNE1, see ICLAC Register of Misidentified Cell Lines (iclac.org/databases/cross-contaminations/) [2], Cellosaurus (https://web.expasy.org/cellosaurus/) [3] and [4–5]). Of these potentially misidentified cell lines, only HONE1 was used in the further functional studies reported in the article. The corresponding author has provided STR profile reports for the 5-8F cells and the HONE1 cells (S1 File).
In addition to HONE1, the follow-up experiments reported in [1] use only one other NPC cell line, 6-10B, which may limit the generalizability of the findings as representative of nasopharyngeal cancer biology.
Clarification of the source and provenance of the cell lines used is as follows:
- 5-8F, 6-10B, and SUNE1 are from stock kept at the Cancer Institute of Southern Medical University since 2003, originally obtained from Cancer Center, Sun Yat-sen University where these cell lines were generated [6, 7].
- C666-1 cell line was generated by the Chinese University of Hong Kong [8]. It is from stock kept by the Cancer Institute of Southern Medical University since 2003, originally obtained from Cancer Center of Sun Yat-sen University.
- CNE1 and CNE2 are from stock kept by the Cancer Institute of Southern Medical University since 1999.
- HONE1 and HNE1 are from stock kept by the Cancer Institute of Southern Medical University, originally obtained from the Cancer Institute of Hunan Medical University (now the Central Southern University) where these cell lines were generated.
- NP69 [9] is from stock kept by the Cancer Institute of Southern Medical University, since 2009, originally obtained from Cancer Center, Sun Yat-sen University where the cell line was generated.
In Fig 4C, it was noted that the si-CTGF panel in 6-10B cells is the same as Fig 4D si-CTGF panel in 6-10B cells. Additionally, there is a region of overlap between the images in Fig 4C si-CTGF panel in HONE1 cells and Fig 4C si-Ctr in HONE1 cells. The authors confirmed that incorrect image files were used for the following panels:
- Fig 4A shCTGF-B panel;
- All panels of Fig 4B;
- Fig 4C HONE1 cell, si-CTGF panel;
- Fig 4C HONE1 cell, si-Ctr panel;
- All panels of Fig 4D.
A revised Fig 4 is provided here in which the incorrect image panels are replaced. The underlying data for Fig 4, including the representative image files, other replicate image files, and individual-level datasets for the charts, are provided as S2 File. The authors stated that the errors in selecting the representative image files for Fig 4 do not affect the statistical data collected and reported in the accompanying charts.
A. Stably downregulating CTGF enhanced the migration ability of 6–10B shRNA-CTGF-A and B cells in vitro. B. Stably suppressed CTGF elevated in vitro invasiveness of 6–10B shRNA-CTGF-A and B cells. C. Transiently downregulated CTGF dramatically enhanced the ability of 6–10B and HONE1 cells migration in vitro. D. Transiently suppressed CTGF elevated in vitro invasiveness of 6–10B and HONE1 cells. One-way ANOVA was used to determine the differences between two groups. (Original magnification 200×). Data were presented as mean±SD for three independent experiments (*p<0.05).
In Fig 5, the authors clarified that the β-actin panels shown are representative only, and do not show the actual loading controls for all target proteins shown in parts A, B and C, respectively. Actin loading controls were not run on the same gels as target proteins in each experiment. Protein quantification was carried out to ensure equal sample loading, and blots were checked for consistency of actin control bands. Target protein expression levels were compared when actin protein expression was observed to be relatively consistent. The available uncropped western blot images underlying Fig 5 are provided as Supporting Information (S3 File).
The underlying data files are no longer available for the immunohistochemistry images in Fig 1D, the western blots in Figs 2A and 3A, the western blots for PI3K, pPI3K, AKT, pAKT, pRb, E2F1, Snail, E-cadherin, Vimentin and β-actin in Fig 5, and the charts in Figs 2B and 3B.
The raw data for the NimbleGen DNA methylation microarray experiment reported in Fig 6 were not deposited in a public repository as required by the standards of the field. The dataset was subsequently deposited and is available at https://doi.org/10.5061/dryad.wh70rxwj1. No additional underlying data are available for this article.
The following additional issues were noted:
The Transient Transfection with siRNAs subsection of the Materials and Methods of [1] states that the siRNA sequences for the gene and the controls are provided in Table 3. However, the control sequences are not provided. The control siRNA sequences were designed and synthesized by Guangzhou RiboBio (RiboBio Inc, China) and are protected under a patent.
The antisense strand of the siRNAs targeting CTGF are:
5’ UAUGUCUUCAUGCUGGUGC dTdT 3’
5’ UAAUCAUAGUUGGGUCUGG dTdT 3’
5’ UUUGGGAGUACGGAUGCAC dTdT 3’
These sequences are reported in Table 2 of [1] in 3’-5’ direction.
There is an error in the text legend for Fig 1D. A complete, correct Fig 1 legend is provided here.
A. Decreased CTGF expression was shown in NPC cells compared to nasopharynx tissues by microarray data analysis of GSE2370 set retrieved from the GEO database (Red color: high expression,Green color:low expression). B. Compared with immortalized human nasopharyngeal epithelial NP69 cell line, CTGF expression was significantly downregulated in 8 NPC cell lines. C. Compared with 11 NP tissues, CTGF expression was markedly decreased in 20 primary NPC tissues (p = 0.0165). The unpaired t test was used for this assay (*p<0.05). D. CTGF expression in primary NPC samples and NP tissues 1,2)High expression in nasopharyngeal epithelium; 3,4)High expression in NPC; 5,6): Low expression in NPC(Original magnification 400×).
The PLOS ONE Editors issue this Expression of Concern to alert readers to the concerns about the accuracy of the representation of the western blot data and of the migration and invasion image panels, and the use of cell lines previously reported to be misidentified.
Supporting information
S1 File. STR profile reports.
STR profiles of HONE1 and 5-8F cell line samples, analysed in Dec 2017 and Jan 2018, respectively; search results in ATCC and DSMZ databases; and electrophoresis of gene COX1.
https://doi.org/10.1371/journal.pone.0231520.s001
(ZIP)
S2 File. The underlying data for Fig 4.
Representative image files, other replicate image files, and individual-level datasets for the charts.
https://doi.org/10.1371/journal.pone.0231520.s002
(RAR)
S3 File. The available uncropped western blot images underlying Fig 5.
https://doi.org/10.1371/journal.pone.0231520.s003
(DOC)
2 Apr 2020: The PLOS ONE Editors (2020) Expression of Concern: Reduced CTGF expression promotes cell growth, migration, and invasion in nasopharyngeal carcinoma. PLOS ONE 15(4): e0231520. https://doi.org/10.1371/journal.pone.0231520 View expression of concern
Figures
Abstract
Background
The role of CTGF varies in different types of cancer. The purpose of this study is to investigate the involvement of CTGF in tumor progression and prognosis of human nasopharyngeal carcinoma (NPC).
Experimental design
CTGF expression levels were examined in NPC tissues and cells, nasopharynx (NP) tissues, and NP69 cells. The effects and molecular mechanisms of CTGF expression on cell proliferation, migration, invasion, and cell cycle were also explored.
Results
NPC cells exhibited decreased mRNA expression of CTGF compared to immortalized human nasopharyngeal epithelial cell line NP69. Similarly, CTGF was observed to be downregulated in NPC compared to normal tissues at mRNA and protein levels. Furthermore, reduced CTGF was negatively associated with the progression of NPC. Knocking down CTGF expression enhanced the colony formation, cell migration, invasion, and G1/S cell cycle transition. Mechanistic analysis revealed that CTGF suppression activated FAK/PI3K/AKT and its downstream signals regulating the cell cycle, epithelial-mesenchymal transition (EMT) and MMPs. Finally, DNA methylation microarray revealed a lack of hypermethylation at the CTGF promoter, suggesting other mechanisms are associated with suppression of CTGF in NPC.
Citation: Zhen Y, Ye Y, Yu X, Mai C, Zhou Y, Chen Y, et al. (2013) Reduced CTGF Expression Promotes Cell Growth, Migration, and Invasion in Nasopharyngeal Carcinoma. PLoS ONE 8(6): e64976. https://doi.org/10.1371/journal.pone.0064976
Editor: Lucia R. Languino, Thomas Jefferson University, United States of America
Received: November 30, 2012; Accepted: April 19, 2013; Published: June 3, 2013
Copyright: © 2013 Zhen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was supported by National Nature Science Fund of China (No. 81272268), Yangcheng scholar research projects from Universities of Guangzhou(No. 12A011D), Natural science fund of Guangdong Province (No. S2012010009583), New star plan of Pearl River Science and Technology from Guangzhou City (No. 2011J2200009), and Guangdong Province Breeding Project Plan (LYM11102). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
CTGF is a cysteine-rich, matrix-associated, heparin-binding protein, and is widely expressed in variety human tissues and organs, such as connective tissue, pancreas, placenta, and lung. Its expression has been associated with tumor cell proliferation, adhesion, and angiogenesis [1], [2] and serves as a prognostic marker in many types of human cancer [3]–[5]. Interestingly, CTGF plays different roles in different types of cancer. In pancreatic cancer, prostate cancer, liver cancer, breast cancer, and sarcoma, CTGF has been shown to be an oncogenic factor promoting tumor progression [1], [6]–[9]. Conversely, CTGF functions as a tumor suppressor in lung cancer, ovarian cancer, and oral squamous cell cancer [5], [10], [11]. The expression pattern and functional mechanisms of CTGF in NPC have not been established.
Nasopharyngeal carcinoma (NPC) is a tumor arising from the epithelial cells that cover the surface and line the nasopharynx. Its highest incidence worldwide occurs in Southern China, with an age-standardized incidence rate varying from 20 to 50 cases per 100,000 people. Typical cervical lymph node metastases frequently occur in early stages. Synergetic effects of viral infections, genetic alterations, and environmental factors are thought to drive abnormal gene expression, which contributes to the initiation and development of NPC [12]–[15]. In a previous study, cDNA microarray was utilized to examine differentially expressed genes between NPC tissues and non-cancerous nasopharyngeal tissues. Through BRB-array tool analysis, the expression of connective tissue growth factor (CTGF), a member of CCN family, was found to be notably downregulated in NPC tissues, suggesting a potential role in suppressing the pathogenesis of NPC [12].
In order to further clarify the role of CTGF in the pathogenesis of NPC, we investigated its expression and correlation with clinicopathologic features in NPC patients, as well as its effects on cell growth, cell cycle, migration, and invasion in cell lines. Our studies demonstrated that reduced CTGF expression stimulates cell proliferation, migration, invasion and cell cycle progression via FAK/PI3K/AKT signaling, EMT and MMP pathways.
Materials and Methods
Cell Culture and Sample Collection
Eight NPC cell lines 5–8F, 6–10B, CNE2, CNE1, C666–1, HONE1, HNE1 and SUNE1 were obtained from Cancer Research Institute of Southern Medical University. All cell lines were maintained in RPMI 1640 medium supplemented with 10% newborn calf serum (NBCS) (PAA Laboratories, Inc, Pasching, Austria). NP69, an immortalized human nasopharyngeal epithelial cell line, was grown in defined-KSFM medium supplemented with epidermal growth factor (EGF) (Invitrogen, Carlsbad, USA). All cell lines were incubated in a humidified chamber with 5% CO2 at 37°C. 20 fresh primary NPC tissues, 11 fresh NP tissuses, 92 paraffin-embedded undifferentiated primary NPC specimens and 25 paraffin-embedded NP specimens were obtained at the time of diagnosis before any therapy from People’s Hospital in Zhongshan City (Guangdong, China). The clinical processes were approval from the Ethics Committees of People’s Hospital of Zhongshan City and patients provided informed consent. The pathologic stage of all specimens was confirmed according to the 1997 NPC staging system of the UICC.
Reanalysis of Microarray Data
Microarray data set (GEO accession number: GSE2370) between five representative EBV-negative NPC cell lines: TW01, TW03, TW04, TW06 and CGBM1 and normal nasal mucosal epithelial submitted by Lee was retrieved from the GEO database and differentially expressed genes were screened with a selection criteria based on our previous investigation [12].
RNA Isolation, Reverse Transcription, and qRT-PCR
RNA was extracted from the NPC cell lines, NP69 cell line, NPC tissues and NP tissues using Trizol(Takara, Shiga, Japan). For CTGF, RNA was transcribed into cDNA and amplified with specific sense: 5′CTGCCCTCGCGGCTTAC3′; antisense primer: 5′TGGTGCAGCCAGAAAGCTCA3′. The assays were performed in accordance with manufacturer’s instructions (Takara, Shiga, Japan). The PCR reaction for each gene was repeated three times. ARF5 was used as internal control [13].
Immunohistochemistry and Evaluation of Staining
Immunohistochemistry and evaluation of staining of CTGF (Santa Cruz Biotechnology, Santa Cruz, USA) were performed in NPC and noncancerous nasopharyngeal tissues according to a previous description [14].
Western Blot Analysis
Western blot was carried out according as described [13] with rabbit polyclonal anti-CTGF antibody (1∶200; Epitomics, Burlingame, USA), anti-PCNA antibody (1∶1000; Epitomics, Burlingame, USA), anti-ACTB,CCND1,CDK4, p21, E2F1, and p15 antibody (1∶400; Santa Cruz Biotechnology, Santa Cruz, USA), anti-pRb(Ser,780), MMP2, MMP9, FAK, pFAK(Tyr397), AKT, pAKT(Ser473), PI3K, pPI3K(Tyr458), Snail, E-Cadherin, N-Cadherin and Vimentin antibody(1∶1000; Cell signaling technology, Danvers, USA). An HRP-conjugated anti-rabbit IgG antibody was used as the secondary antibody (Zhongshan, Beijing, China). Signals were detected using enhanced chemiluminescence reagents (Pierce, Rockford, IL).
Establishment of NPC 6–10B Cell Line with Stable Expression of CTGF Short Hairpin RNA
The preparation of lentivirus expressing human CTGF short hairpin RNA (shRNA-1024,1047) (Table 1) was performed using the pLVTHM-GFP lentiviral RNAi expression system [16]. NPC 6–10B cells were infected with lentiviral particles containing specific or negative control vectors, and the polyclonal cells with GFP signals were selected for further experiments using FACS flow cytometry.
Transient Transfection with siRNAs
Small-interfering RNA (siRNA) for CTGF was designed and synthesized by Guangzhou RiboBio (RiboBio Inc, China). The sequence of each gene and their controls are shown in Table 2. Twenty-four hours prior to transfection, NPC cells 6–10B and HONE1 were plated onto a 6-well plate or a 96-well plate (Nest, Biotech,China) at 30–50% confluence. They were then transfected into cells using TurboFect™ siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) according to the manufacturer's protocol. Cells were collected after 48–72 hr for the further experiments.
CCK8 Assay
The rate of in vitro cell viability was assessed using CCK8 assay. Cells were seeded in 96-well plates at a density of 1,000 cells/well. For shRNA-CTGF, the cells were incubated for 1, 2, 3, 4, 5, 6, or 7 d. For siRNA-CTGF, the cells were incubated for 1, 2, or 3d. Ten microliters of CCK8 (Cell Counting Kit-8, Beyotime, China) was added to each well and incubated for 2 h. The absorbance value (OD) of each well was measured at 450 nm. For each experimental condition, 5 wells were used. Experiments were performed three times.
Colony Formation Assay
Cells were plated in 6-well culture plates at 100 cells/well. Each cell group had 2 wells. After incubation for 12 days at 37°C, cells were washed twice with PBS and stained with Giemsa solution. The number of colonies containing ≥50 cells was counted under a microscope. The colony formation efficiency was calculated as (number of colonies/number of cells inoculated)×100%.
Cell Cycle Analysis
Cell cycle examination was carried out according to previous description [14]. The DNA content of labeled cells was acquired using FACS cytometry assay(BD Biosciences).
In vitro Cell Migration and Invasion Assays
In vitro cell migration and invasion assays were examined according to our previous study (13). Briefly, 1×105 cells were seeded on a fibronectin-coated polycarbonate membrane insert in a transwell apparatus (Corning, Corning, USA). After the cells were incubated for 12 h, Giemsa-stained cells adhering to the lower surface were counted under a microscope in five predetermined fields (100×). For the cell invasion assay, the procedure was similar to the cell migration assay, except that the transwell membranes were pre-coated with 24 µg/µl Matrigel (R&D Systems, USA).
Examination of CTGF Promoter Methylation by DNA Methylation Microarray Assay
The examination procedure for NimbleGen DNA methylation microarray for 17 NPCs and 3 NP tissues has been described [14], [17]. All experiments were performed at the Kangchen Biology Corporation, Shanghai, China.
Statistical Analysis
All data were analyzed for statistical significance using SPSS 13.0 software. The unpaired T test was applied to test the differential mRNA expression of CTGF in NPC tissues compared to NP tissues. The Chi-square test was used to examine the differences of CTGF protein expression between normal epithelium and cancer tissues of nasopharynx. The Chi-square test was applied to the examination of relationship between CTGF expression levels and clinicopathologic characteristics. One-way ANOVA was used to determine the differences between groups in vitro analyses. A P value of less than 0.05 was considered statistically significant.
Results
CTGF is Expressed at Low Levels in NPC
From Lee et al’s microarray data (GSE2370), CTGF was more weakly expressed in NPC tissues compared to NP tissues by an average of 0.13 fold (Figure 1A). This expression pattern was similar to our microarray data comparing NPC cells and NP tissues (12). QPCR analysis indicated that the CTGF expression level was significantly decreased in 8 NPC cell lines in comparison to the immortalized human nasopharyngeal epithelial cell lines NP69 (Figure 1B). Furthermore, downregulation of CTGF mRNA was also observed in NPC tissues compared to normal nasopharyngeal tissues(p = 0.0165) (Figure 1C). We also measured the expression levels of CTGF protein in archived paraffin-embedded NPC samples and NP specimens using immunohistochemical staining (Figure 1D). Specific CTGF protein staining was found in the cytoplasm of non-cancerous and malignant nasopharynx tissues. CTGF protein was highly expressed in NP epithelium compared to NPC samples (P<0.001) (Table 3).
A. Decreased CTGF expression was shown in NPC cells compared to nasopharynx tissues by microarray data analysis of GSE2370 set retrieved from the GEO database (Red color: high expression,Green color:low expression). B. Compared with immortalized human nasopharyngeal epithelial NP69 cell line, CTGF expression was significantly downregulated in 8 NPC cell lines. C. Compared with 11 NP tissues, CTGF expression was markedly decreased in 20 primary NPC tissues (p = 0.0165). The unpaired t test was used for this assay (*p<0.05). D. CTGF expression was decreased in 92 primary NPC samples compared to 25 NP tissues 1,2)High expression in nasopharyngeal epithelium; 3,4)High expression in NPC; 5,6): Low expression in NPC(Original magnification 400×). The Chi-square test was used for this assay (*p<0.05).
Downregulated Protein Expression of CTGF is Negatively Associated with NPC Progression
We analyzed the relationship between clinicopathologic characteristics and CTGF expression levels in individuals with NPC (Table 4). We did not find a significant association of CTGF expression levels with patient's age, sex, smoking status, family tumor history, disease recurrence, or distant metastasis (M classification) in 92 NPC cases. However, we observed that the reduced expression level of CTGF was markedly correlated with tumor size (T classification) (P = 0.036), lymph node metastasis (N classification) (N0–N1 vs. N2–N3) (P = 0.020), and clinical stage (I–II vs. III–IV) (P = 0.027) in NPC patients.
Stably Downregulated or Transiently Inhibited CTGF Expression Stimulated Cell Proliferation, the Plate Clone Formation in vitro and Increased Cell Cycle Transition from G1 to S
Among NPC cell lines, 6–10B and HONE1 cells had the highest expression levels of CTGF(Figure 1B), thus these lines were chosen to study the functions of endogenous CTGF through a loss-of-function approach. We used a lentiviral shRNA vector to specifically and stably knock down the expression of CTGF in 6–10B cell line (Figure S1). Stably decreased expression of CTGF protein induced the expression of cell proliferation marker PCNA by western blot in shRNA-1024 and 1047 cells compared to PLV-Ctr cells (Figure 2A). Subsequently, we examined the effect of decreased CTGF expression on NPC cell growth in vitro. The growth curves determined by CCK8 assay showed that suppressing CTGF significantly elevated cell viability in comparison to PLV-Ctr cells (Figure 2B). Plate clone formation assay showed that suppressing CTGF significantly elevated cell proliferation compared to PLV-Ctr cells (Figure 2C). Downregulated CTGF expression in shRNA-CTGF-1024 and 1047 cells accelerated cell cycle transition from G1 to S compared to PLV-Ctr cells (Figure 2D). Interestingly, similar results were also observed in siRNA-mediated suppression of CTGF in NPC cells. We found that knocking down endogenous CTGF expression not only elevated the expression of PCNA (Figure 3A) but also sped up cell proliferation (Figure 3B) and the G1/S transition in NPC 6–10B and HONE1 cells(Figure 3C), compared to their respective Si-Ctr-treated NPC cells. These results suggested a significant inhibitory effect of CTGF on cell growth in vitro.
A. Stably knocking down CTGF increased the expression of proliferation marker PCNA in shRNA-CTGF-A and B cells compared to PLV-Ctr cells by western blot. B. In vitro viability of NPC cells was increased in CTGF-suppressed cells compared to PLV-Ctr cells by CCK8 assay. C. In vitro proliferative ability of NPC cells was significantly increased in CTGF-suppressed cells compared to PLV-Ctr cells by colony formation assay. D. Stably downregulated CTGF expression stimulated cell cycle transition from G1 to S in shRNA-CTGF-A and B cells. One-way ANOVA was used for CCK8 assay, plate clone formation and cell cycle assay. Data were presented as mean±SD for three independent experiments (*p<0.05).
A.Suppression of CTGF expression by siRNA induced the expression of PCNA in 6–10B cells and HONE1 cells by western blot. B.Transiently reducing the expression of CTGF by siRNA stimulated cell proliferation in 6–10B cells and HONE1 cells. C. Transiently knocking down the expression of CTGF promoted G1 to S cell cycle transition in NPC 6–10B and HONE cells. One-way ANOVA was used for CCK8 assay and cell cycle assay. Data were presented as mean±SD for three independent experiments (*p<0.05).
Knock-down of CTGF Facilitates Cell Migration and Invasion
To examine the effect of CTGF on cell migration, stably shRNA-CTGF-expressing 1024 and 1047 6–10B NPC cells were cultured on transwell apparatus. After 12-h incubation, the percentage of migrated cells in both shRNA-CTGF-1024 and 1047 NPC cell groups was significantly more than that in the PLV-Ctr cells (for both P<0.001) (Figure 4A). Using a boyden chamber coated with matrigel, we determined changes in cell invasiveness after 16 h incubation. Compared with the PLV-Ctr cells, shRNA-CTGF-expressing 1024 and 1047 6–10B NPC cells both showed significantly increased invasiveness (for both P<0.001) (Figure 4B). Similar to the stably suppressed CTGF expression results, suppressing CTGF expression using siRNA-CTGF also facilitated cell migration and invasion in 6–10B and HONE1 cells (Figure 4C, D).
A. Stably downregulating CTGF enhanced the migration ability of 6–10B shRNA-CTGF-A and B cells in vitro. B. Stably suppressed CTGF elevated in vitro invasiveness of 6–10B shRNA-CTGF-A and B cells. C. Transiently downregulated CTGF dramatically enhanced the ability of 6–10B and HONE1 cells migration in vitro. D. Transiently suppressed CTGF elevated in vitro invasiveness of 6–10B and HONE1 cells. One-way ANOVA was used to determine the differences between two groups. (Original magnification 200×). Data were presented as mean±SD for three independent experiments (*p<0.05).
CTGF Controls the Expression of Cell Cycle, MMPs, and EMT-associated Genes in NPC
To further study the mechanism by which CTGF regulates cell proliferation, migration, and invasion, we examined protein levels of cell cycle, MMP, and EMT-associated genes in NPC 6–10B cells with stably suppressed CTGF expression. Knocking down endogenous CTGF expression elevated the activiation of pRB(ser 780), an oncogenic cell cycle regulator including CCND1 and E2F1, and suppressed the expression of tumor suppressors including p15 and p21. However, the expression of CDK4 and CDK6 were not affected (Figure 5A). Further, we found that suppressing CTGF expression increased the expression of MMP2, MMP9 and EMT-marker genes including Snail, N-cadherin, and Vimentin and decreased E-cadherin expression (Figure 5B). CTGF suppression did not lead to any change from epithelial to mesenchymal morphology transition in NPC 6–10B cells (Figure S2).
A. Knocking down endogenous CTGF expression elevated the expression of pRB(ser 780), oncogenic cell cycle regulators including CCND1, and E2F1, and suppressed the expression of tumor suppressors including p15 and p21. However, CDK4 and CDK6 were not affected. B. Suppressing CTGF expression increased the expression of MMP2, MMP9 and EMT-marker genes including Snail, N-cadherin, and Vimentin and decreased E-cadherin expression. C.Reduced CTGF expression induced the expression of phos-FAK, PI3K, and AKT, but not their total protein levels. Each experiment was repeated three times.
CTGF Regulates FAK/PI3K/AKT Pathway
FAK/PI3K/AKT has been reported as upstream signal modulating cell cycle, EMT, and MMPs signals. We examined the effect of CTGF on FAK/PI3K/AKT pathway and found that reduced CTGF significantly increased the expression of phosphorylated FAK, PI3K and AKT, but not their total protein levels (Figure 5C). These results suggested that CTGF is an upstream factor modulating the FAK/PI3K/AKT pathway in NPC.
CTGF Promoter Lacks Methylation in NPC
Due to a bioinformatics-predicted CpG island in the CTGF promoter, we tested whether hypermethylation of CTGF might result in the suppressed expression of CTGF in NPC. After examination by NimbleGen DNA methylation microarray, we did not find any methylation modification in CTGF promoter region in 17 NPC samples and 3 NPs (Figure 6), which suggested that reduced expression of CTGF in NPC was not related to its promoter methylation.
Using a NimbleGen DNA methylation microarray containing CTGF, we did not detect a significant methylation change in CTGF promoter region in 17 primary NPC samples and 3 NPs.
Discussion
CTGF plays dual roles as oncogene and tumor suppressor in different cancer types [6]–[14], which may be attributed to tissue-specific patterns of expression in different tissues and organs in tumourigenesis. However, its roles and molecular mechanisms linking the initiation and development of NPC are not well understood [12].
In this study, we first found that CTGF expression was decreased in NPCs compared to normal nasopharyngx (NP) tissues by microarray examination. This result strongly supported Lee et al’s microarray data (GSE2370). Further, we confirmed CTGF mRNA was weakly expressed in NPC cell lines compared to NP69 cell line or in NPC tissues compared to NPs by qPCR. These results were consistent with our microarray data, suggesting that downregulated CTGF is involved in promoting NPC pathogenesis. We used immunohistochemistry to further examine the expression level of CTGF protein in NPC tissues and noncancerous tissues. We observed that cytoplasmic CTGF expression was markedly decreased in cancer tissues compared to normal epithelium. These results were not only consistent with our previous investigation [12], but also hinted that decreased expression of CTGF was involved in the stages of NPC initiation.
In previous studies of other tumor types, different expression patterns of CTGF correlated with both favorable and unfavorable tumor progression. Elevated expression of CTGF was positively associated with progression and poor prognosis in melanoma, papillary thyroid carcinoma, esophageal squamous cell carcinoma, gastric cancer, and cervical tumors [18]–[22]. Conversely, reduced CTGF expression was favorable for tumor progression and prognosis, in oral squamous cell carcinoma, ovarian cancer, and lung adenocarcinomas [23]–[25]. In this study, we found that attenuated CTGF expression was negatively associated with T, N classification, and clinical stages of NPC patients. The results suggested the downregulated expression of CTGF promoted NPC pathogenesis. To specifically determine the contributions of CTGF in the regulation of NPC phenotypes, we modulated its expression in 6–10B cell lines. We found that stably decreased expression of CTGF by shRNA conferred 6–10B cells with higher expression of proliferation marker protein PCNA, cell proliferation, colony formation, G1/S cell cycle transition, migration and invasion in vitro. Similar results were observed after transiently suppressing CTGF expression by siRNA transfection in NPC 6–10B and HONE1 cells.
The biological functions of CTGF found in this study provided a mechanistic basis for the pathological and clinical observations. We examined key cell cycle regulators of the G1-S transition and observed that CCND1, pRb, and E2F1 were upregulated while p15 and p21 were downregulated after stable CTGF knockdown in 6–10B cells. Further, we found that CTGF suppression-induced expression of genes is associated with cell migration and invasion. MMP2, MMP9, and EMT-marker genes including Snail, N-cadherin, and Vimentin were highly upregulated while EMT-marked gene E-cadherin was weakly expressed in shRNA treated 6–10B cells. However, CTGF suppression did not lead to any change from epithelial to mesenchymal morphology changes in NPC 6–10B cells.
PI3K/AKT is a classical signal pathway [26], [27] and its activated status induces ell cycle transition of G1/S [28], increases the expression of Snail promoting the EMT [29], [30] and stimulates the secretion of MMP2 and MMP9 [31]. This signaling respectively promotes cell proliferation, migration, and invasion during tumor pathogenesis. In previous investigation of oral cancer, CTGF was reported to inhibit cell motility and COX-2 expression through the FAK/PI3K/AKT pathway [15]. We conjectured that decreased CTGF expression promoted cell growth, migration, and invasion via the same pathway activity in NPC. In this study, we also observed that decreased CTGF expression increased pFAK, pPI3K, and pAKT levels, while not afftecting total FAK, PI3K, and AKT protein levels. Furthermore, we also observed that inhibiting PI3K expression downregulated the expression of PI3K, pPI3K, and pAKT. However, a change in CTGF expression was not observed. These results demonstrated that attenuated CTGF expression is an upstream factor involved in activation of the FAK/PI3K/AKT pathway in NPC.
The hypermethylation of CpG islands in gene promoters can often lead to transcriptional silencing of genes, including tumor suppressor genes. Due to the existence of predicted CpG islands and hypermethylation of CTGF promoter region in ovarian cancers [24], we used a NimbleGen DNA methylation microarray to assess its methylation status in 17 NPC cases. However, there were no significant changes in CTGF promoter methylation observed in these samples, suggesting the involvement of other mechanisms in suppressing CTGF expression in NPC.
In summary, this study provides evidence that CTGF is downregulated in NPC and its reduced cytoplasmic expression facilitates disease progression. Reduced CTGF levels lead to elevated cell proliferation, migration, invasion, and cell cycle progression by activating the FAK/PI3K/AKT pathway. Our studies demonstrated that CTGF plays a potential tumor suppressor role in NPC pathogenesis.
Supporting Information
Figure S1.
The efficiency of infection was determined by the numbers of cells with green fluorescent protein (GFP) which were infected by viruses labeled with GFP. Cells are presented at 100 times magnification.
https://doi.org/10.1371/journal.pone.0064976.s001
(TIF)
Figure S2.
Stably knocking down the CTGF expression did not lead to epithelial to mesenchymal transition morphology changes in NPC 6–10B cells.
https://doi.org/10.1371/journal.pone.0064976.s002
(TIF)
Author Contributions
Conceived and designed the experiments: WF ZL Y. Zhang. Performed the experiments: Y. Zhen YY XY CM Y. Zhou YC HY XL YS QW MZ SH QF HW. Analyzed the data: WF Y. Zhen Y. Zhou ZL. Contributed reagents/materials/analysis tools: ZL Y. Zhang. Wrote the paper: WF.
References
- 1. Chien W, O'Kelly J, Lu D, Leiter A, Sohn J, et al. (2011) Expression of connective tissue growth factor (CTGF/CCN2) in breast cancer cells is associated with increased migration and angiogenesis. Int J Oncol 38: 1741–1747.
- 2. Chu CY, Chang CC, Prakash E, Kuo ML (2008) Connective tissue growth factor (CTGF) and cancer progression. J Biomed Sci 15: 675–685.
- 3. Zhou ZQ, Cao WH, Xie JJ, Lin J, Shen ZY, et al. (2009) Expression and prognostic significance of THBS1, Cyr61 and CTGF in esophageal squamous cell carcinoma. BMC Cancer 9: 291.
- 4. Liu L, Li Z, Feng G, You W, Li J (2007) Expression of connective tissue growth factor is in agreement with the expression of VEGF, VEGF-C, -D and associated with shorter survival in gastric cancer. Pathol Int 57: 712–718.
- 5. Chen PP, Li WJ, Wang Y, Zhao S, Li DY, et al. (2007) Expression of Cyr61, CTGF, and WISP-1 correlates with clinical features of lung cancer. PLoS One 2: e534.
- 6. Bennewith KL, Huang X, Ham CM, Graves EE, Erler JT, et al. (2009) The role of tumor cell-derived connective tissue growth factor (CTGF/CCN2) in pancreatic tumor growth. Cancer Res 69: 775–784.
- 7. Yang F, Tuxhorn JA, Ressler SJ, McAlhany SJ, Dang TD, et al. (2005) Stromal expression of connective tissue growth factor promotes angiogenesis and prostate cancer tumorigenesis. Cancer Res 65: 8887–8895.
- 8. Jia XQ, Cheng HQ, Li H, Zhu Y, Li YH, et al. (2011) Inhibition of connective tissue growth factor overexpression decreases growth of hepatocellular carcinoma cells in vitro and in vivo. Chin Med J (Engl) 124: 3794–3799.
- 9. Croci S, Landuzzi L, Astolfi A, Nicoletti G, Rosolen A, et al. (2004) Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells. Cancer Res 64: 1730–1736.
- 10. Barbolina MV, Adley BP, Kelly DL, Shepard J, Fought AJ, et al. (2009) Downregulation of connective tissue growth factor by three-dimensional matrix enhances ovarian carcinoma cell invasion. Int J Cancer 125: 816–825.
- 11. Chuang JY, Yang WY, Lai CH, Lin CD, Tsai MH, et al. (2011) CTGF inhibits cell motility and COX-2 expression in oral cancer cells. Int Immunopharmacol 11: 948–954.
- 12. Fang W, Li X, Jiang Q, Liu Z, Yang H, et al. (2008) Transcriptional patterns, biomarkers and pathways characterizing nasopharyngeal carcinoma of Southern China. J Transl Med 6: 32.
- 13. Alajez NM, Shi W, Hui AB, Bruce J, Lenarduzzi M, et al. (2010) Enhancer of Zeste homolog 2 (EZH2) is overexpressed in recurrent nasopharyngeal carcinoma and is regulated by miR-26a, miR-101, and miR-98.Cell Death. Dis (1) e85.
- 14. Liu Z, Luo W, Zhou Y, Zhen Y, Yang H, et al. (2011) Potential tumor suppressor NESG1 as an unfavorable prognosis factor in nasopharyngeal carcinoma. PLoS One. 6: e27887.
- 15. Wang S, Fang W (2011) Increased expression of hepatoma-derived growth factor correlates with poor prognosis in human nasopharyngeal carcinoma. Histopathology. 58: 217–224.
- 16. Liu Z, Chen J, Luo W, Yang H, Wu A, et al. (2012) Overexpressed DNA-binding protein inhibitor 2 as an unfavorable prognosis factor promotes cell proliferation in nasopharyngeal carcinoma. Acta Biochim Biophys Sin (Shanghai) 44: 503–512.
- 17. Koga Y, Pelizzola M, Cheng E, Krauthammer M, Sznol M, et al. (2009) Genome-wide screen of promoter methylation identifies novel markers in melanoma. Genome Res 19: 1462–1470.
- 18. Braig S, Wallner S, Junglas B, Fuchshofer R, Bosserhoff AK (2011) CTGF is overexpressed in malignant melanoma and promotes cell invasion and migration. Br J Cancer 105: 231–238.
- 19. Cui L, Zhang Q, Mao Z, Chen J, Wang X, et al. (2011) CTGF is overexpressed in papillary thyroid carcinoma and promotes the growth of papillary thyroid cancer cells. Tumour Biol 32: 721–728.
- 20. Xie JJ, Xu LY, Wu JY, Shen ZY, Zhao Q, et al. (2010) Involvement of CYR61 and CTGF in the fascin-mediated proliferation and invasiveness of esophageal squamous cell carcinomas cells. Am J Pathol 176: 939–951.
- 21. Jiang CG, Lv L, Liu FR, Wang ZN, Liu FN, et al. (2011) Downregulation of connective tissue growth factor inhibits the growth and invasion of gastric cancer cells and attenuates peritoneal dissemination. Mol Cancer 10: 122.
- 22. Wong YF, Cheung TH, Tsao GS, Lo KW, Yim SF, et al. (2006) Genome-wide gene expression profiling of cervical cancer in Hong Kong women by oligonucleotide microarray. Int J Cancer 118: 2461–2469.
- 23. Yang MH, Lin BR, Chang CH, Chen ST, Lin SK, et al. (2012) Connective tissue growth factor modulates oral squamous cell carcinoma invasion by activating a miR-504/FOXP1 signalling. Oncogene 31: 2401–2411.
- 24. Kikuchi R, Tsuda H, Kanai Y, Kasamatsu T, Sengoku K, et al. (2007) Promoter hypermethylation contributes to frequent inactivation of a putative conditional tumor suppressor gene connective tissue growth factor in ovarian cancer. Cancer Res 67: 7095–7105.
- 25. Chang CC, Shih JY, Jeng YM, Su JL, Lin BZ, et al. (2004) Connective tissue growth factor and its role in lung adenocarcinoma invasion and metastasis. J Natl Cancer Inst 96: 364–375.
- 26. Ma B, Sen T, Asnaghi L, Valapala M, Yang F, et al. (2011) βA3/A1-Crystallin controls anoikis-mediated cell death in astrocytes by modulating PI3K/AKT/mTOR and ERK survival pathways through the PKD/Bit1-signaling axis.Cell Death Dis. 2: e217.
- 27. Jackson TC, Verrier JD, Kochanek PM (2013) Anthraquinone-2-sulfonic acid (AQ2S) is a novel neurotherapeutic agent. Cell Death Dis. 4: e451.
- 28. Wang G, Wang F, Ding W, Wang J, Jing R, et al. (2013) APRIL induces tumorigenesis and metastasis of colorectal cancer cells via activation of the PI3K/Akt pathway. PLoS One. 8: e55298.
- 29. Wang H, Quah SY, Dong JM, Manser E, Tang JP, et al. (2007) PRL-3 down-regulates PTEN expression and signals through PI3K to promote epithelial-mesenchymal transition. Cancer Res 67: 2922–2926.
- 30. Cheng JC, Auersperg N, Leung PC (2012) EGF-induced EMT and invasiveness in serous borderline ovarian tumor cells: a possible step in the transition to low-grade serous carcinoma cells?. PLoS One. 7: e34071.
- 31. Jang JY, Jeon YK, Kim CW (2010) Degradation of HER2/neu by ANT2 shRNA suppresses migration and invasiveness of breast cancer cells. BMC Cancer 10: 391.