Figures
Abstract
Major degraders of petroleum hydrocarbons in tropical seas have been indicated only by laboratory culturing and never through observing the bacterial community structure in actual environments. To demonstrate the major degraders of petroleum hydrocarbons spilt in actual tropical seas, indigenous bacterial community in seawater at Sentosa (close to a port) and East Coast Park (far from a port) in Singapore was analyzed. Bacterial species was more diverse at Sentosa than at the Park, and the composition was different: γ-Proteobacteria (57.3%) dominated at Sentosa, while they did not at the Park. Specialized hydrocarbonoclastic bacteria (SHCB), which use limited carbon sources with a preference for petroleum hydrocarbons, were found as abundant species at Sentosa, indicating petroleum contamination. On the other hand, SHCB were not the abundant species at the Park. The abundant species of SHCB at Sentosa were Oleibacter marinus and Alcanivorax species (strain 2A75 type), which have previously been indicated by laboratory culturing as important petroleum-aliphatic-hydrocarbon degraders in tropical seas. Together with the fact that SHCB have been identified as major degraders of petroleum hydrocarbons in marine environments, these results demonstrate that the O. marinus and Alcanivorax species (strain 2A75 type) would be major degraders of petroleum aliphatic hydrocarbons spilt in actual tropical seas.
Citation: Teramoto M, Queck SY, Ohnishi K (2013) Specialized Hydrocarbonoclastic Bacteria Prevailing in Seawater around a Port in the Strait of Malacca. PLoS ONE 8(6): e66594. https://doi.org/10.1371/journal.pone.0066594
Editor: Martha Trujillo, Universidad de Salamanca, Spain
Received: February 24, 2013; Accepted: May 8, 2013; Published: June 18, 2013
Copyright: © 2013 Teramoto et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was performed through Program to Disseminate Tenure Tracking System of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan (http://www.mext.go.jp/english/). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The Strait of Malacca is a major route for crude oil shipments, and the port of Singapore is the busiest hub for transhipment in the world. In accord with this, the port of Singapore has been reported to be chronically contaminated by petroleum oil [1]. In addition, some part of the Strait has shallow water depth, which is prone to stranding of ships and crude oil pollution. Petroleum hydrocarbons accidentally discharged into seawater are degraded mainly by bacteria, and these petroleum-hydrocarbon-degrading bacteria appear to be ubiquitous in marine environments.
A wide variety of the petroleum-hydrocarbon-degrading bacteria are known to date [2], [3], and the degradation mechanisms are rather well understood [4]. Most hydrocarbonoclastic bacteria metabolize either aliphatic or aromatic hydrocarbons, although some bacteria such as strains of Pseudomonas [5] and Rhodococcus [6] have been shown to degrade both types of hydrocarbons. Among hydrocarbonoclastic bacteria, Alcanivorax [7]–[11] and Cycloclasticus [12]–[14] have been identified as key microorganisms with major roles in the degradation of aliphatic and aromatic hydrocarbons, respectively, in marine environments [15]. Alcanivorax and Cycloclasticus use limited carbon sources with a preference for petroleum hydrocarbons and thus are specialized hydrocarbonoclastic bacteria (SHCB; [15]). Accordingly, abundance of the SHCB can be an indicator for the petroleum hydrocarbon contamination in their surrounding environment. Alcanivorax strains are distributed in natural marine environments around the world [16]. On the other hand, Cycloclasticus strains have been suggested to preferentially inhabit colder seawater [17]–[19].
The petroleum-hydrocarbon-degrading bacteria characterized are mainly from temperate marine environments and relatively few studies have been conducted on the bacteria in tropical marine environments. However, recently Oleibacter strains, which are also SHCB, have been indicated as major degraders of aliphatic hydrocarbons spilt in tropical marine environments [20], [21]. In addition to Oleibacter bacteria, Alcanivorax species (such as strain 2A75 type) have been indicated to be also important for aliphatic-hydrocarbon degradation in tropical marine environments [20]. On the other hand, another Alcanivorax species, Alcanivorax borkumensis, can be considered as the major degrader in temperate marine environments [8], [11], [22]. The important, major degraders of petroleum hydrocarbons in tropical marine environments have been indicated only by laboratory culturing and never through observing the bacterial community structure in actual tropical marine environments. The result derived from an environment that simulated a natural environment could be different from the result derived from the actual natural environment. As SHCB have been identified to be major degraders of petroleum hydrocarbons in marine environments [15], we investigated the type of SHCB that are abundant in seawater around the port of Singapore to demonstrate the major degraders of petroleum hydrocarbons in actual tropical marine environments in the present study.
Materials and Methods
Ethics Statement
Permission was obtained for the described field study from National Environment Agency of Singapore government. The location was not privately owned or protected, and this field study did not involve endangered or protected species.
Seawater Sample
Surface seawater was sampled at Sentosa beach (100 ml; 1°15′ N, 103°49′ E) and at East Coast Park (200 ml; 1°18′ N, 103°54′ E) in Singapore in December 2011. The seawater was filtered on a 0.22-µm pore size membrane (express plus, Millipore) to collect the bacteria in the seawater, and the membranes were completely dried at 60°C. The sampling, filtering and drying were done on the same day. The membranes were brought to Japan under dryness condition, and stock at –80°C before using them for DNA extraction.
Construction of 16S rRNA Gene Fragment Library and Sequencing
DNA was extracted from the microorganisms on the membrane by ISOIL for Beads Beating (Nippon Gene, Tokyo) using a beads beater at 30 frequency/sec for 90 seconds (Mixer Mill MM 300; Retsch, Germany). PCR amplification of the 16S rRNA bacterial gene was performed using forward primer 27F (AGRGTTTGATCMTGGCTCAG; [23]) and reverse primer 519R (GWATTACCGCGGCKGCTG; [24]). The forward primer included the fusion primer A (CGTATCGCCTCCCTCGCGCCA) in its 5′ end, followed by a key sequence (TCAG) and sample specific 10 bp barcodes according to GS Junior Titanium emPCR Lib-A kit (Roche). Similarly, the reverse primer included the fusion primer B (CTATGCGCCTTGCCAGCCCGC) in its 5′ end, followed by the key sequence and sample specific 10 bp barcodes. The PCR was performed in a total volume of 25 µl containing 1.25 U Taq DNA polymerase (Ex Taq; Takara, Japan), Mg2+-containing buffer supplied with the polymerase (2 mM Mg2+ at the final concentration), 1 M betaine (Sigma), 1.25 µl DMSO (Sigma), 200 µM of each deoxynucleoside triphosphate, 1 µM of each primer, 5 ng of the extracted DNA. The amplification programme was as follows: (i) 5 min at 94°C; (ii) 30 cycles consisting of 1 min at 94°C, 1 min at 50°C and 2 min at 72°C; and (iv) a final extension for 7 min at 72°C. Four independent PCR amplifications were performed for each sample. Gel based analysis showed that PCR products of the expected size were amplified in equal concentration in each reaction. Equal volumes of the four reaction solutions for the same sample were mixed, and PCR products were purified using AMPure XP (Agencourt). Emulsion-based clonal amplification using Lib-A kit (Roche) and sequencing on the GS Junior 454 system (Roche) were performed according to the manufacturer’s instructions.
Analysis of the Library
Tag and primer regions used for PCR were removed from the sequences by using QIIME (http://www.qiime.org/; [25]) through OTUMAMi (http://www.mwm.k.u-tokyo.ac.jp:8080/Plone?set_language=en) and manually with a sequence editing software Se-Al (http://tree.bio.ed.ac.uk/software/seal/) after alignment of sequences using ClustalX (version 2.1; [26]). The sequences were then checked for putative chimera sequences using Bellerophon server [27] and Mallard program [28] after aligned with the ClustalX. Sequences indicated to be chimera by the both programs were removed, and then the sequences were used for the bacterial community composition analysis in this study. The sequences used were deposited in DDBJ Sequence Read Archive (DRA) under accession numbers DRZ000062 and DRZ000063.
Ribosomal Database Project (RDP; [29]) was used for classifying the sequences into phylum/class, clustering the sequences into operational taxonomic units (OTUs), selecting representative sequences from each OTU, and calculating Chao 1 richness estimates [30], [31]. The representative sequences were compared to DNA sequences in the GenBank database by using BLAST [32].
Strains
The reference strain Alteromonas macleodii NBRC 102226T, Alcanivorax sp. 2A75 ( = NBRC 105763; [20]) and Altererythrobacter sp. 1lE25 ( = NBRC 105748; [18]) were obtained from NBRC (NITE Biological Resource Center), while Erythrobacter aquimaris JCM 12189T was from RIKEN BRC through the National Bio-Resource Project of the MEXT, Japan.
Degradation of Crude Oil and GC-MS Analysis
The SW medium is comprised of (per litre) 1 l seawater, 1 g NH4NO3, 0.2 g K2HPO4 and 12 mg FeCl3 [20], while dMB plate is of (per litre) 0.9 l seawater, 0.1 l distilled water, 3.74 g Marine broth 2216 (Difco), and 15 g agar. Seawater for formulating media was collected from the surface at a coastal area of Muroto city, Kochi, Japan (33°18′ N, 134°11′ E).
The crude-oil-degrading activity was measured as described previously [20], unless stated otherwise. Cells of each bacterium (test strains, A. macleodii NBRC 102226T and E. aquimaris JCM 12189T; positive control strains, the aliphatic-hydrocarbon degrader Alcanivorax sp. 2A75 [20] and an aromatic-hydrocarbon degrader Altererythrobacter sp. 1lE25 [18]) freshly grown on a dMB plate supplemented with 0.5% (w/v) pyruvate at 20°C were collected and suspended in filter-sterilized seawater to an OD600 of 0.5. Then 150 µl of this bacterial suspension was inoculated into 3 ml sterilized SW medium supplemented with 3 µl crude oil (heat-treated Arabian light crude oil; [20]). Large amounts of cells of the test two strains grown on the dMB plate with 0.5% (w/v) pyruvate in the same way were also inoculated into 3 ml sterilized ONR7a medium [12] supplemented with 3 µl crude oil. These cultures were incubated for 14–16 days with shaking (200 r.p.m.) at 30°C to examine the crude-oil-degrading abilities. Non-inoculated tubes were similarly incubated and served as non-degrading controls. Hydrocarbons were extracted with n-heptane. After dehydrated and concentrated, the extracts were subjected to GC-MS using a 6890N gas chromatograph with a 5973 mass-selective detector (Agilent Technologies). To investigate whether a strain degraded petroleum hydrocarbons, all peak areas for hydrocarbons obtained with the GC-MS selected ion monitoring were normalized by dividing by the peak area for 17α(H),21β(H)-hopane [33]. Aliphatic- and aromatic-hydrocarbon degrading activities were detected with the positive control strains 2A75 and 1lE25, respectively.
Results and Discussion
Diversity of Bacterial Species in Seawater at Sentosa and East Coast Park
Seawater was sampled at Sentosa, which is close to Harbourfront port, and at East Coast Park (Fig. 1). The bacteria in seawater at Sentosa and East Coast Park were examined by sequencing the 16S rRNA gene fragments obtained from the seawater. The Chao1 OTU (operational taxonomic unit) richness estimates indicated that bacterial species in seawater at Sentosa were about three times as diverse as those at East Coast Park (Table 1). This increased diversity at Sentosa compared to East Coast Park was confirmed by their rarefaction curves (Fig. 2). In addition, out of 1925 OTUs from 6823 total sequences from both sites (Table 1), only a fraction of OTUs (76 OTUs) were shared by both sites (Fig. 3). Many bacterial species found only at Sentosa could include diverse petroleum-hydrocarbon-degrading bacteria and various bacteria that are tolerant to the crude oil and its concomitant heavy metals which would be general and main contaminants at ports [34].
The number of OTUs (maximum distance of 0.03) detected vs the number of sequences arbitrarily sampled is plotted.
The distributions were estimated by the total and each numbers of OTUs from the two seawater samples (Table 1). Relations (identical, close or independent) of abundant OTUs from the two seawater samples (listed in Table 2 and 3) are also shown.
Comparison of Bacteria in Seawater at the Two Sites at Phylum/class Level
The obtained sequences were assigned to phylum or class using RDP classifier with a confidence threshold of 80% (Fig. 4). At Sentosa, γ-Proteobacteria were the most dominant class, followed by α-Proteobacteria (Fig. 4). In most marine environments, γ-Proteobacteria appear outcompeted by α-Proteobacteria [35]–[37]. It has been shown that γ-Proteobacteria prefer elevated concentrations of nutrients and are outcompeted by α-Proteobacteria at low nutrient concentrations [38]. Our results thus suggest that the seawater around Sentosa would contain an elevated level of nutrients. On the other hand, bacterial community structure at East Coast Park was different from that at Sentosa, and Cyanobacteria which are unlikely to degrade petroleum hydrocarbons [39] were the most dominant group in seawater (Fig. 4).
Sequences were assigned to phylum or class with RDP classifier with a confidence threshold of 80%. Indications are given for the composition with a frequency of 0.1% or more.
Abundant Bacterial Species and Petroleum-hydrocarbon-degrading Activity
SHCB, Oleibacter marinus and Alcanivorax species (strain 2A75 type), were found as abundant species at Sentosa (Table 2), indicating that seawater at Sentosa was likely to be contaminated with petroleum hydrocarbons. SHCB were not found as abundant species at East Coast Park (Table 3), and bacteria of Alcanivorax and Oleibacter were not detected at this site, suggesting that the level of crude oil would have been low in seawater at East Coast Park.
Abundant species of genera Marinobacter [40], Pseudidiomarina [41], Marinomonas [42], Vibrio [43] and Sphingomonas [15] detected at Sentosa (Table 2) are potential petroleum-hydrocarbon degraders. These bacteria, with the possible exception of Pseudidiomarina (however, there is no report on the hydrocarbon-degrading activity from all the type strains of Pseudidiomarina), grow on a broad range of carbon sources [15], [44], [45]. Maybe the most and third abundant species of genera Alteromonas and Erythrobacter, respectively, detected at Sentosa (Table 2) would not degrade petroleum hydrocarbons, because no hydrocarbon-degrading activity was detected with type strains of Alteromonas macleodii and Erythrobacter aquimaris in this study. However, Alteromonas species have been found as main species in petroleum-contaminated marine environments [8], [46], and this reason is unknown. Therefore, the O. marinus and Alcanivorax species (strain 2A75 type) were strongly suggested to be the only SHCB detected as abundant species (constituting more than 0.5% of the total bacterial population) at Sentosa (Table 2), demonstrating that these species would be the major degraders of petroleum aliphatic hydrocarbons spilt in actual tropical marine environments. A. borkumensis was not detected at Sentosa, demonstrating that A. borkumensis might not become important Alcanivorax species for the degradation in actual tropical marine environments.
The most abundant species detected at East Coast Park, Synechococcus species (Table 3), may favor tropical marine environments, as dominance of Synechococcus has been observed in tropical seawater [35]. Abundant species found only at East Coast Park mostly belonged to class Chloroplast (Table 3, Fig. 3), species of which may not have been tolerant to contaminants around the port.
N and P are the primary growth limiting nutrients in marine environments. A. macleodii has grown on a N free medium [47], suggesting the possibility of its N2 fixation. This would be beneficial for its dominance (Table 2). Consistently, A. macleodii has become dominant in (Mediterranean offshore) seawater supplemented with glucose and P [38]. A. macleodii produces exopolysaccharides [48] that bind heavy metals [49], [50], which would be useful for the heavy metal remediation around the port.
Although the key aromatic-hydrocarbon degrader Cycloclasticus appears to prefer colder seawater [17]–[19], it has been detected from tropical seawater [18]. Cycloclasticus has constituted 0.6% of the total bacterial population in seawater at Tokyo Bay [14]. However, Cycloclasticus was not detected in this study, suggesting that its level was very low at two sites.
Conclusions
It was demonstrated that O. marinus and Alcanivorax species (strain 2A75 type) but not A. borkumensis would be the major degraders of petroleum aliphatic hydrocarbons spilt in actual tropical marine environments. The Alcanivorax species (strain 2A75 type) would represent a novel species of Alcanivorax [20]. Description of this important species as the novel species will promote rational and systematic petroleum bioremediation strategies for tropical marine environments.
Acknowledgments
We thank Ayumi Komatsu for technical assistance, Satoru Ibuki & Takahiro Tsushima for providing Muroto seawater and Minoru Ikehara for help in using GC-MS. This study was performed through Program to Disseminate Tenure Tracking System of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan.
Author Contributions
Conceived and designed the experiments: MT. Performed the experiments: MT KO. Analyzed the data: MT KO. Contributed reagents/materials/analysis tools: MT SYQ KO. Wrote the paper: MT KO.
References
- 1. Lu J (2003) Marine oil spill detection, statistics and mapping with ERS SAR imagery in south-east Asia. Int J Remote Sensing 24: 3013–3032.
- 2.
Prince RC (2005) The microbiology of marine oil spill bioremediation. In: Ollivier B, Magot M, editors. Petroleum Microbiology. Washington DC: American Society for Microbiology. 317–335.
- 3. Head IM, Jones DM, Roling WF (2006) Marine microorganisms make a meal of oil. Nat Rev Microbiol 4: 173–182.
- 4. Van Hamme JD, Singh A, Ward OP (2003) Recent advances in petroleum microbiology. Microbiol Mol Biol Rev 67: 503–549.
- 5. Whyte LG, Bourbonniere L, Greer CW (1997) Biodegradation of petroleum hydrocarbons by psychrotrophic Pseudomonas strains possessing both alkane (alk) and naphthalene (nah) catabolic pathways. Appl Environ Microbiol 63: 3719–3723.
- 6. Andreoni V, Bernasconi S, Colombo M, van Beilen JB, Cavalca L (2000) Detection of genes for alkane and naphthalene catabolism in Rhodococcus sp. strain 1BN. Environ Microbiol 2: 572–577.
- 7. Yakimov MM, Golyshin PN, Lang S, Moore ER, Abraham WR, et al. (1998) Alcanivorax borkumensis gen. nov., sp. nov., a new, hydrocarbon-degrading and surfactant-producing marine bacterium. Int J Syst Bacteriol 48: 339–348.
- 8. Kasai Y, Kishira H, Syutsubo K, Harayama S (2001) Molecular detection of marine bacterial populations on beaches contaminated by the Nakhodka tanker oil-spill accident. Environ Microbiol 3: 246–255.
- 9. Hara A, Syutsubo K, Harayama S (2003) Alcanivorax which prevails in oil-contaminated seawater exhibits broad substrate specificity for alkane degradation. Environ Microbiol 5: 746–753.
- 10. Roling WF, Milner MG, Jones DM, Fratepietro F, Swannell RP, et al. (2004) Bacterial community dynamics and hydrocarbon degradation during a field-scale evaluation of bioremediation on a mudflat beach contaminated with buried oil. Appl Environ Microbiol 70: 2603–2613.
- 11. Yakimov MM, Denaro R, Genovese M, Cappello S, D’Auria G, et al. (2005) Natural microbial diversity in superficial sediments of Milazzo Harbor (Sicily) and community successions during microcosm enrichment with various hydrocarbons. Environ Microbiol 7: 1426–1441.
- 12. Dyksterhouse SE, Gray JP, Herwig RP, Lara JC, Staley JT (1995) Cycloclasticus pugetii gen. nov., sp. nov., an aromatic hydrocarbon-degrading bacterium from marine sediments. Int J Syst Bacteriol 45: 116–123.
- 13. Kasai Y, Kishira H, Harayama S (2002) Bacteria belonging to the genus Cycloclasticus play a primary role in the degradation of aromatic hydrocarbons released in a marine environment. Appl Environ Microbiol 68: 5625–5633.
- 14. Maruyama A, Ishiwata H, Kitamura K, Sunamura M, Fujita T, et al. (2003) Dynamics of microbial populations and strong selection for Cycloclasticus pugetii following the Nakhodka oil spill. Microb Ecol 46: 442–453.
- 15. Harayama S, Kasai Y, Hara A (2004) Microbial communities in oil-contaminated seawater. Curr Opin Biotechnol 15: 205–214.
- 16.
Golyshin PN, Harayama S, Timmis KN, Yakimov MM (2005) Family Alcanivoraceae. In: Garrity GM, editor. Bergey’s Manual of Systematic Bacteriology, 2nd edn, vol. 2. New York: Springer. 295–299.
- 17. Teira E, Lekunberri I, Gasol JM, Nieto-Cid M, Alvarez-Salgado XA, et al. (2007) Dynamics of the hydrocarbon-degrading Cycloclasticus bacteria during mesocosm-simulated oil spills. Environ Microbiol 9: 2551–2562.
- 18. Teramoto M, Suzuki M, Hatmanti A, Harayama S (2010) The potential of Cycloclasticus and Altererythrobacter strains for use in bioremediation of petroleum-aromatic-contaminated tropical marine environments. J Biosci Bioeng 110: 48–52.
- 19. Valentine DL, Kessler JD, Redmond MC, Mendes SD, Heintz MB, et al. (2010) Propane respiration jump-starts microbial response to a deep oil spill. Science 330: 208–211.
- 20. Teramoto M, Suzuki M, Okazaki F, Hatmanti A, Harayama S (2009) Oceanobacter-related bacteria are important for the degradation of petroleum aliphatic hydrocarbons in the tropical marine environment. Microbiology 155: 3362–3370.
- 21. Teramoto M, Ohuchi M, Hatmanti A, Darmayati Y, Widyastuti Y, et al. (2011) Oleibacter marinus gen. nov., sp. nov., a bacterium that degrades petroleum aliphatic hydrocarbons in a tropical marine environment. Int J Syst Evol Microbiol 61: 375–380.
- 22.
Teramoto M, Harayama S (2011) Potential for petroleum aliphatic hydrocarbon degradation of the key bacteria in temperate seas. In: Nemeth AD, editor. The Marine Environment: Ecology, Management and Conservation. New York: Nova publishers. 157–166.
- 23. Vergin KL, Urbach E, Stein JL, DeLong EF, Lanoil BD, et al. (1998) Screening of a fosmid library of marine environmental genomic DNA fragments reveals four clones related to members of the order Planctomycetales. Appl Environ Microbiol 64: 3075–3078.
- 24. Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 59: 143–169.
- 25. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, et al. (2010) QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7: 335–336.
- 26. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) ClustalW and ClustalX version 2. Bioinformatics 23: 2947–2948.
- 27. Huber T, Faulkner G, Hugenholtz P (2004) Bellerophon; a program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 20: 2317–2319.
- 28. Ashelford KE, Chuzhanova NA, Fry JC, Jones AJ, Weightman AJ (2006) New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras. Appl Environ Microbiol 72: 5734–5741.
- 29. Cole JR, Wang Q, Cardenas E, Fish J, Chai B, et al. (2009) The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res 37: 141–145.
- 30. Chao A (1984) Nonparametric estimation of the number of classes in a population. Scand J Stat 11: 265–270.
- 31. Hughes JB, Hellmann JJ, Ricketts TH, Bohannan BJM (2001) Counting the uncountable: statistical approaches to estimating microbial diversity. Appl Environ Microbiol 67: 4399–4406.
- 32. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410.
- 33. Prince RC, Elmendorf DL, Lute JR, Hsu CS, Haith CE, et al. (1994) 17α(H),21β (H)-hopane as a conserved internal marker for estimating the biodegradation of crude oil. Environ Sci Technol 28: 142–145.
- 34. Iannelli R, Bianchi V, Macci C, Peruzzi E, Chiellini C, et al. (2012) Assessment of pollution impact on biological activity and structure of seabed bacterial communities in the Port of Livorno (Italy). Sci Total Environ 426: 56–64.
- 35. Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, et al. (2007) The Sorcerer II Global Ocean Sampling expedition: northwest Atlantic through eastern tropical Pacific. PLoS Biol 5: 398–431.
- 36. Shaw AK, Halpern AL, Beeson K, Tran B, Venter JC, et al. (2008) It's all relative: ranking the diversity of aquatic bacterial communities. Environ Microbiol 10: 2200–2210.
- 37. Burke C, Thomas T, Lewis M, Steinberg P, Kjelleberg S (2011) Composition, uniqueness and variability of the epiphytic bacterial community of the green alga Ulva australis. ISME J 5: 590–600.
- 38. Pinhassi J, Berman T (2003) Differential growth response of colony-forming α- and γ-proteobacteria in dilution culture and nutrient addition experiments from Lake Kinneret (Israel), the eastern Mediterranean Sea, and the Gulf of Eilat. Appl Environ Microbiol 69: 199–211.
- 39. Abed RMM, Köster J (2005) The direct role of aerobic heterotrophic bacteria associated with cyanobacteria in the degradation of oil compounds. Int Biodeterior Biodegrad 55: 29–37.
- 40. Gauthier MJ, Lafay B, Christen R, Fernandez L, Acquaviva M, et al. (1992) Marinobacter hydrocarbonoclasticus gen. nov., sp. nov., a new, extremely halotolerant, hydrocarbon-degrading marine bacterium. Int J Syst Bacteriol 42: 568–576.
- 41. Kostka JE, Prakash O, Overholt WA, Green SJ, Freyer G, et al. (2011) Hydrocarbon-degrading bacteria and the bacterial community response in gulf of Mexico beach sands impacted by the deepwater horizon oil spill. Appl Environ Microbiol 77: 7962–7974.
- 42. Melcher RJ, Apitz SE, Hemmingsen BB (2002) Impact of irradiation and polycyclic aromatic hydrocarbon spiking on microbial populations in marine sediment for future aging and biodegradability studies. Appl Environ Microbiol 68: 2858–2868.
- 43. Hedlund BP, Staley JT (2001) Vibrio cyclotrophicus sp. nov., a polycyclic aromatic hydrocarbon (PAH)-degrading marine bacterium. Int J Syst Evol Microbiol 51: 61–66.
- 44. Balkwill DL, Drake GR, Reeves RH, Fredrickson JK, White DC, et al. (1997) Taxonomic study of aromatic-degrading bacteria from deep-terrestrial-subsurface sediments and description of Sphingomonas aromaticivorans sp. nov., Sphingomonas subterranea sp. nov., and Sphingomonas stygia sp. nov. Int J Syst Bacteriol 47: 191–201.
- 45. Wu YH, Shen YQ, Xu XW, Wang CS, Oren A, et al. (2009) Pseudidiomarina donghaiensis sp. nov. and Pseudidiomarina maritima sp. nov., isolated from the East China Sea. Int J Syst Evol Microbiol 59: 1321–1325.
- 46. Cui Z, Lai Q, Dong C, Shao Z (2008) Biodiversity of polycyclic aromatic hydrocarbon-degrading bacteria from deep sea sediments of the Middle Atlantic Ridge. Environ Microbiol 10: 2138–2149.
- 47. Sorkhoh NA, Al-Awadhi H, Al-Mailem DM, Kansour MK, Khanafer M, et al. (2010) Agarolytic bacteria with hydrocarbon-utilization potential in fouling material from the Arabian Gulf coast. Int Biodet Biodeg 64: 554–559.
- 48. Raguenes G, Pignet P, Gauthier G, Peres A, Christen R, et al. (1996) Description of a new polymer-secreting bacterium from a deep-sea hydrothermal vent, Alteromonas macleodii subsp. fijiensis, and preliminary characterization of the polymer. Appl Environ Microbiol 62: 67–73.
- 49. Loaëc M, Olier R, Guezennec J (1997) Uptake of lead, cadmium and zinc by a novel bacterial exopolysaccharide. Water Res 31: 1171–1179.
- 50. Loaëc M, Olier R, Guezennec J (1998) Chelating properties of bacterial exopolysaccharides from deep-sea hydrothermal vents. Carbohydr Polym 35: 65–70.