Bacterial strains, plasmids, growth conditions, and chemicals

The strains and plasmids used in this study are listed in Table 2. L. lactis was grown in M17 broth (Difco, Becton Dickinson, Le Pont de Claix, France) at 30° C as standing cultures or on M17 (1.5% w/v) agar, all of which were supplemented with 0.5% glucose (GM17). For the preparation of electrocompetent cells the media and agar contained 0.5 M sucrose (Acros Organics, Morris Plains, NJ). Erythromycin (Roche Diagnostics GmbH, Mannheim, Germany), chloramphenicol (Sigma Chemicals Co., St. Louis, Mo) and 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (Sigma Chemicals Co.) were added to concentrations of 5 µg/ml, 5 µg/ml and 0.008%, respectively. Escherichia coli was grown in Tryptone Yeast (TY) extract medium (Difco, Becton Dickinson) at 37° C with vigorous agitation or on TY extract medium solidified with 1.5% (wt/vol) agar and containing 100 µg of erythromycin (Roche Diagnostics GmbH) per ml, when required. For E. coli EC101, 40 µg/ml kanamycin (Roche Diagnostics GmbH) was used and for E. coli MC1061 ampicillin (100 µg/ml) (Sigma, Zwijndrecht, The Netherlands) was used. All chemicals used were of analytical grade and, unless indicated otherwise, obtained from Merck KGaA (Darmstadt, Germany).

General DNA techniques and transformation

Molecular cloning techniques were performed essentially as described by Sambrook et al. (23). Genomic DNA of L. lactis was isolated according to the method of Leenhouts et al. [29]. Minipreparations of plasmid DNA from L. lactis were obtained by the alkaline lysis method as described by Seegers et al. [37]. Plasmid DNA was isolated at a large scale using a Nucleobond kit PC 100 (Machery-Nagel, Düren, Germany) as specified by the supplier. Restriction enzymes, T4 DNA ligase, and deoxynucleotides were obtained from Roche Diagnostics GmbH and were used according to the supplier’s instructions. Polymerase chain reactions (PCR) were performed in a Master cycler gradient (Merck KGaA) using Taq DNA polymerase or Expand DNA polymerase according to the instructions of the manufacturer (Roche Diagnostics GmbH). PCR products were purified using the High pure PCR product purification kit and protocol (Roche Diagnostics GmbH). E. coli and L. lactis were transformed by electroporation using a Gene pulser (Bio-Rad Laboratories, Richmond, CA) as described by Zabarovsky and Winburg [51] and Leenhouts and Venema [26], respectively. E. coli MC1061 cells were transformed with the recombinant vector by the heat-shock method [45].

Construction of AcmA and AcmD fusion proteins

The modular architecture of all the constructs used in this study is depicted in Figure 1. Plasmid pNGacmD [41] was digested with the restriction enzyme BamHI for which a recognition site is located in the active site of AcmD. The oligonucleotides pACMDmyc1 (GATCTAGAACAAAAACTTATTTCAGAAGAAGATCTT, underlined XbaI) and pACMDmyc2 (GATCAAGATCTTCTTCTGAAATAAGTTTTTGTTCT, underlined XbaI) were annealed at 70^oC and cloned into the BamHI site of pNGacmD resulting in the plasmid pNGacmD::myc.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Modular architecture of AcmA, AcmD and the fusion proteins used in this study.

The description of the protein is depicted on the left and their respective molecular masses (MM) (kDa) and pIs are given on the right. Dark and light grey boxes indicate the LysM repeats and their intervening amino acid sequences, respectively. *, site of in-frame myc-tag insertion in the active site of AcmD; MSA-2, Plasmodium falciparum Merozoite Surface Antigen-2; GFP, Green Fluorescence Protein; His_10, tag of 10 Histidine residues; SS, Signal Sequence; ppPrtP, pre-pro of prtP.

https://doi.org/10.1371/journal.pone.0072167.g001

Primers pACMD2 and pACMD3 (CGGAATTCAAGGAGGAGAAATATCAGGAGG; underlined EcoRI site) were used to amplify a 603-bp fragment encoding the C-terminal domain of AcmD that contains the three LysM repeats, using chromosomal DNA of L. lactis IL1403 as a template. Upon digestion with EcoRI and HindIII the fragment was cloned into the EcoRI/HindIII sites of pNG3041 thereby replacing the 1162-bp domain encoding the LysM repeats of AcmA. The resulting plasmid was named pNG3042 [5].

The LysM-containing domains of AcmA and AcmD were amplified by PCR using the primers AcmA-LysMcLIC-forward (ATGGGTGGTGGATTTGCTGGAAATACTAATTCTGGTGGC) and AcmA-LysMcLIC-Reverse (TTGGAAGTATAAATTTTCTTTTATTCGTAGATACTGACC) for AcmA and AcmD-LysMcLIC-Forward (ATGGGTGGTGGATTTGCTGTCGGAACTTATAAAGTACAAG) and AcmD-LysMcLIC-Reverse (TTGGAAGTATAAATTTTCAATTTTAATGGTTTGGCCTGG) for AcmD. Nucleotide sequences of AcmA and AcmD LysM regions are in italic and underlined. LysM_AcmA-GFP-His₁₀ and LysM_AcmD-GFP-His₁₀ constructs were cloned in pBADcLIC-GFP plasmid containing Green Fluorescent Protein gene from Aequorea victoriae (Clontech, Mountain view, CA, USA), by the Ligation Independent Cloning procedure described by Geertsma et al. [14].

Construction of an acmD insertion mutant of L. lactis IL1403

pNGacmD::myc was cut with SphI and PstI. The fragment carrying acmD::myc was inserted into the SphI /PstI sites of pORI280, an integration vector which lacks the gene encoding the replication initiation protein, repA [27,28]. The resulting plasmid, pORIacmD::myc, was obtained in L. lactis strain LL108, which carries multiple copies of the repA gene on the chromosome [27]. After transformation of L. lactis IL1403acmA::ISS1 with pORIacmD::myc, erythromycin resistant integrants were checked by PCR with the primers: pEM280 (GCCCATATTTTTTCCTCC; annealing in the 5’-end of the erythromycin resistance gene) and pACMD2 (CGCAAGCTTCTGCAGAGCTCTTAGATTCTAATTGTTTGTCCTGG; underlined HindIII, which anneals to the 3’-end of acmD) as was described before [7].

Selection of the second crossover event was done as described by Leenhouts and Venema [26]. A 1040-bp region of acmD was amplified from the chromosomal DNA of selected integrants using the primers pACMD1 (CCTGTCATGAAACAGAAACATAAAT) and pACMD2, which anneal at either end of acmD. The presence of the c-myc epitope in acmD was confirmed by restriction with XbaI, as this site is only present in the DNA coding for this epitope. Although attempts were made to use the same approach to construct a single mutant of acmD in L. lactis IL1403, for unknown reasons this was not successful. Only first step integrants were obtained but excision resulted in all cases in reversion to the wild type.

SDS-PAGE, zymography, Western hybridization and in-gel fluorescence detection

AcmA and AcmD activity was detected by a zymogram staining technique using SDS-polyacrylamide (PAA) (12.5%) gels containing 0.15% autoclaved, lyophilized Micrococcus lysodeikticus ATCC 4698 cells (Sigma Chemicals Co.), as described previously [7]. SDS-PAA gels without cells were stained with Coomassie brilliant blue (Bio-Rad Laboratories Inc). For Western hybridizations proteins were transferred from (2D)SDS-PAA gels to polyvinylidene difluoride membranes (Roche Diagnostics GmbH) as described by Towbin et al. [44]. MSA2-LysM_AcmA and MSA2-LysM_AcmD antigens were detected with a rabbit polyclonal anti-MSA2 antiserum [35] diluted 10000-fold and horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibodies (Pharmacia, Uppsala, Sweden). The c-Myc epitope was detected with 1:5000-diluted monoclonal mouse anti-c-myc antibodies (Amersham Biosciences, Piscataway, NJ) and 1:5000-diluted HRP conjugated anti-mouse antibodies. AcmA was detected with 1:5000-diluted polyclonal rabbit anti-AcmA active site antibodies [42] and 1:5000-diluted HRP conjugated anti-rabbit antibodies (GE Healthcare UK Ltd, Buckinghamshire, England). In all three cases, the Enhanced chemiluminescence detection system and protocol (Amersham Biosciences) was used.

LysM_AcmD-GFP-His₁₀ protein samples were subjected to SDS-PAGE with a 15% PAA gel and in-gel GFP fluorescence was visualized using a Gel Documentation System (Bio-Rad Laboratories Inc.). Bands obtained by Western hybridization were semi-quantified using the Quantity One program (Bio-Rad Laboratories B.V., Veenendaal, the Netherlands).

Protein expression, isolation and purification

E. coli MC1061 bearing the desired plasmids (pBADcLIC-GFP-LysM_AcmA or pBADcLIC-GFP-LysM_AcmD) were grown until an OD₆₀₀ of 0.6-0.8 and induced with 0.2% arabinose (Merck KGaA) for 2 h. The cells were harvested at 5000 X g for 20 min at 4° C and the cell pellet was resuspended in lysis buffer (50 mM NaH₂PO₄ pH 8.0, 300 mM NaCl, 20 mM imidazole). Cell extract was obtained by sonication at 4° C using three cycles of 30 s pulses at 70% amplitude with 1 min intervals (Vibra Cell, Sonics & Materials, Newton, CT) followed by centrifugation at 20800 X g for 30 min at 4° C. LysM fusion protein was isolated and purified by Ni-NTA affinity chromatography as recommended by the manufacturer (Qiagen GmbH, Hilden, Germany).

Two-dimensional (2D)-gel electrophoresis

Overnight cultures of L. lactis IL1403acmA::ISS1 and IL1403acmA::ISS1acmD::myc were diluted to an OD₆₀₀ of 0.05 in fresh GM17 medium and incubated at 30° C until an OD₆₀₀ of 1.0 was reached. Subsequently, the cultures were centrifuged and proteins in the supernatant fractions were precipitated overnight at 4° C with TCA at a final concentration of 10%. Proteins were collected by centrifugation at 20000 X g for 20 min; the protein pellet was washed three times with acetone, air-dried and dissolved in a solution containing 8 M Urea, 2% CHAPS, 2 mM TBP, 0.2% ampholytes. The amount of protein loaded for 2D-gel electrophoresis was equal to that in 100 ml of supernatant fraction of GM17 cultures with an OD₆₀₀ of 1.0. Isoelectric focusing (IEF) strips (Bio-Rad Ready Strips IPG; pH 4 to 7, 11 cm) were passively rehydrated overnight with the sample to be analyzed. IEF was performed with a Bio-Rad Protean IEF cell (Bio-Rad). The voltage was step-wise increased from 150 V (0.5 h) to 300 V (1 h) and 600 V (1 h), while the voltage was raised linearly to 8000 V until 25000 Vh. Subsequently, the strips were equilibrated twice for 15 min with 5 ml equilibration buffer (0.05 M Tris-HCl pH 8.8, 6 M Urea, 30% (w/v) glycerol, 2% SDS), the first time containing with 1% DTT, the second time with 4% iodoacetamide. The equilibrated strips were loaded on a standard SDS-(12%) PAA gel and run for 2.5 h at 100 V and 15^° C. The proteins in the gel were fixed by washing with a solution of 40% ethanol and 10% acetic acid. Staining was performed overnight with colloidal Coomassie brilliant blue (0.1% CBB G-250, 2% phosphoric acid, 20% ethanol); destaining was with distilled water. PDQuest 2D analysis software (Bio-Rad Laboratories Inc.) was used for comparison between gels and analysis of the 2D gel data.

Bacterial growth, enzyme assays, and microscopy

OD₆₀₀’s of cultures were measured in a Novaspec II spectrophotometer (Pharmacia Biotech AB, Uppsala, Sweden). To measure cellular lysis of L. lactis, cells were grown in GM17 at 30° C for 50 h. Subsequently, as a measure of the extent of culture lysis, release of intracellular X-prolyl dipeptidyl aminopeptidase (PepX) was measured using the chromogenic substrate Ala–Pro-p-nitroanilid (Bachem Feinchemicalien AG, Bubendorf, Switzerland) as described earlier [42].

The sample/substrate mixture was pipetted into a microtiter plate well, and color development was monitored in a THERMOmax microtiter plate reader (Molecular Devices Corporation, Menlo Oaks, CA) at 405 nm for 145 min at 37° C. The slope of the substrate hydrolysis/color development was calculated for two independent experiments.

Light microscopy pictures of L. lactis were made with a Zeiss microscope (Carl Zeiss, Thornwood, CA) and an Axiovision digital camera (Axion Technologies, Houston, TX). A fluorescence microscope (Zeiss Axiophot) fitted with a digital camera and a green filter was used to view GFP fluorescence.

For electron microscopic analysis, L. lactis MG1363 cells were treated with TCA (as described below) and incubated with MSA2, MSA2-LysM_AcmA or MSA2-LysM_AcmD as described above for untreated cells. The antibodies against MSA2 were diluted 1:1000 in PBS-containing 0.15 M glycine. Immunogold labeling was performed using Auroprobe 15 nm goat anti-rabbit IgG gold marker (Amersham Biosciences) using preparations of glutaraldehyde-fixed cells on Formvar-carbon-coated nickel grids. The labeled samples were stained with 0.1% uranyl acetate (w/v in water) and examined in a Philips CM10 transmission electron microscope at 100 kV.

To measure the influence of AcmD on cellular lysis, cells of L. lactis NZ9000 (pNGacmD) or NZ9000acmAΔ1 (pNGacmD), both with or without nisin-induced AcmD, were mixed with AcmA and/or AcmD. Cells from 10 ml of culture of L. lactis NZ9000 (pNGacmD) or NZ9000acmAΔ1 (pNGacmD), both either or not induced with nisin at an OD₆₀₀ of 0.6, were collected by centrifugation at 5000 X g 2 h after induction. The cell pellets were resuspended in 10 ml of the supernatants of the L. lactis MG1363 (which contains both AcmA and AcmD) or L. lactis MG1363acmAΔ1 (which contains AcmD) cultures and incubated at 30° C for 2.5 h (OD₆₀₀ ~1.8). Subsequently, supernatant samples were collected and used to measure the extent of culture lysis by measuring PepX activity.

Binding of fusion proteins to lactococcal cells

MSA2-LysM_AcmA and MSA2-LysM_AcmD binding studies were performed by mixing equal amounts of L. lactis cells (the amount of cells present in 1 ml of culture with an OD₆₀₀ of 1.0) or with L. lactis cells that had been treated with trichloroacetic acid by boiling 25 µl of cell culture in 1 ml of 10% trichloroacetic acid (TCA) with 1 ml of supernatant of a nisin-induced L. lactis NZ9000 acmAΔ1 (pNG3041, producing MSA2-LysM_AcmA) or NZ9000 acmAΔ1 (pNG3042, expressing MSA2-LysM_AcmD) cultures. The suspensions were incubated at room temperature for 5 min, centrifuged (1 min at 20000 X g) and washed once with M17 broth. The pellets were subsequently resuspended in SDS sample buffer, boiled for 5 min, and subjected to SDS-PAGE.

Purified LysM_AcmA-GFP-His₁₀ and LysM_AcmD-GFP-His₁₀ purified proteins (3 µM each) were added to L. lactis cells in 50 mM NaH₂PO₄ (pH 4.0, 6.0 and 8.0), 50 mM NaCl buffer at room temperature and incubated for 30 min. Cells were centrifuged at 20000 X g for 1 min and the pellet was washed three times with the same buffer containing 150 mM NaCl to remove un-specifically bound proteins. Finally the washed pellet was resuspended in the same buffer and observed under a fluorescence microscope. To rule out the possibility of GFP interaction with lactis cells, GFP, purified by Hydrophobic Interaction Chromatography was used as a control.

Comparison of AcmA and AcmD

A comparison between AcmA [GenBank AAK04370] and AcmD [GenBank AAK04639] of L. lactis IL1403 was performed to pinpoint the differences between both proteins. Both have a similar modular structure (Figure 1): a signal sequence is followed by an active site domain (Glucosaminidase family, pfam PF01832) and a C-terminal LysM domain with three LysM repeats (pfam PF01476). The homology between the two proteins is around 58%. AcmD differs from AcmA in the length of the signal sequence (26 versus 57 amino acid residues), the presence of shorter amino acid sequences separating the repeats, while the protein has a pI of 4.3 instead of 10.3 for AcmA (Figure 1 and Table 1). His-tagged purified AcmD showed PGH activity only at pH 4 while AcmA is active at pH 4 to 8 [16,43].

AcmD of L. lactis subsp. lactis strains KF147 [38] and IL1403 [4] are identical while those of strains IO-1 [19] and CV56 [12] are 99% identical. The AcmD proteins of the L. lactis subsp. cremoris A76 [3], UC509.9 [1], MG1363 [50] and SK11 [32] are around 95% identical to IL1403 AcmD, respectively. The differences are mainly located between the active site domain and the LysM domain and in the intervening sequences separating the LysM repeats. No proteins homologous to AcmD that share the same low pI are encoded by the genomes of the other bacteria sequenced to date.

AcmD contributes to cell separation and autolysis

A c-myc epitope was inserted in frame in the active site of AcmD to be able to follow expression and localization of the AcmD fusion protein and to make an acmD mutant by chromosomal integration. The chromosomal acmD gene in IL1403acmA::ISS1 was replaced by acmD::myc via replacement recombination, resulting in an acmAacmD double mutant. However for yet unknown reasons the integration of acmD::myc into the genome of IL1403 failed. The effects of mutation of acmD on protein secretion by and autolysis and cell separation of L. lactis were investigated. Activity of AcmD could not be detected when cell-free extracts of L. lactis NZ9000, L. lactis IL1403, or IL1403acmA::ISS1 all carrying an intact copy of the acmD gene in their chromosomes, were subjected to zymography using cell wall fragments of M. lysodeikticus or L. lactis, even after renaturation of the proteins in the gel at pH 4 (results not shown).

The protein patterns of culture supernatant fractions from the acmA and acmAacmD mutants did not differ significantly, as judged by 2D-gel electrophoresis. Two proteins were present in higher amounts in either the supernatant of the acmA strain or the acmAacmD double mutant while 4 proteins were detected only in the supernatant of the acmA mutant. The main difference was the expected shift in size of the secreted AcmD protein in the double mutant as a consequence of the c-myc epitope (from 34.9 to 36.6 kDa; Figure S1).

Cellular autolysis was examined by following the release of the cytoplasmic peptidase Pep-X into the culture supernatant [9]. No difference in lysis was observed between the acmAacmD double mutant and the acmA single mutant of L. lactis IL1403 (Figure S2).

Nisin-induced overexpression of AcmD has previously been shown to result in increased lysis of L. lactis MG1363 in the presence of AcmA while no additional lysis was obtained for the empty plasmid control [43]. Knowing that AcmD is secreted into the culture supernatant even though no activity could be detected, we investigated whether the contribution of AcmD activity to lysis occurs by peptidoglycan degradation during passage of the protein through the cell wall. Because a single acmD mutant could not be obtained the following approach was used to examine AcmD-mediated lysis: L. lactis strains NZ9000 (pNGacmD) and NZ9000acmAΔ1 (pNGacmD) were grown in the presence of nisin to induce the expression of AcmD. Cell pellets were collected two hours after induction and resuspended in cell free supernatants of L. lactis MG1363, containing both AcmA and AcmD, or L. lactis MG1363acmAΔ1, containing only AcmD. Un-induced cells were used as controls. Using this approach the influence of AcmD when produced from the inside or added from the outside could be separately measured. The cells of the strains NZ9000 (pNGacmD) and NZ9000acmAΔ1 (pNGacmD) released significantly more PepX and thus lysed to a larger extent when AcmD expression was induced (Figure 2, compare un-induced with induced). This was only the case when AcmA activity was present, upon suspension of the cells in the AcmA-containing MG1363 supernatant (Figure 2, see dark grey bars), showing that AcmD contributes to autolysis by its action within the cell wall.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. AcmD contributes to cell autolysis.

Determination of cell lysis upon induced expression of AcmD. Cultures of L. lactis NZ9000 (pNGacmD) or L. lactis NZ9000acmA∆1 (pNGacmD) were grown until an OD₆₀₀ of 0.6 was reached. Both cultures were split in two. Expression of AcmD was induced in one half of each culture by the addition of nisin (10 ng/ml), the other halves were left un-induced. The cells of the four cultures were collected after 2 h and mixed with the cell-free culture supernatant of L. lactis MG1363 (dark grey bars) or L. lactis MG1363acmA∆1 (grey bars). After 1 h incubation at 30° C, supernatants were analyzed for PepX activity (in arbitrary units (AU)). The slope of the substrate hydrolysis/color development was determined and is indicated as PepX activity (AU)/min. The average was calculated from two independent experiments.

https://doi.org/10.1371/journal.pone.0072167.g002

After overnight growth at 30° C in GM17 broth differences in cell sedimentation were observed between the L. lactis strains IL1403, IL1403acmA::ISS1 and IL1403acmA::ISS1acmD::myc. The wild type IL1403 strain did not sediment whereas the acmA mutant did and the acmAacmD double mutant even more (Figure 3). Light microscopic analysis revealed that the latter strain formed very long chains in comparison to the other two (Figure 3B). The chains formed by the double mutant were calculated to be on average 2 to 3 times longer than those of IL1403acmA::ISS1 (Figure 3D). Further, complementation of AcmD expression in the acmAacmD double mutant resulted in a decrease in the length of the chains to a length resembling that of the acmA single mutant (Figure 3C and D). This data indicates that AcmD, like AcmA, is involved in cell separation.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. AcmD of L. lactis is involved in cell separation.

(a) Turbidity and cell sedimentation of L. lactis IL1403 (1), IL1403acmA::ISS1 (2) and IL1403acmA::ISS1acmD::myc (3) after overnight growth at 30° C in GM17 broth. (b) Light microscopic views of L. lactis IL1403, IL1403acmA::ISS1 and IL1403acmA::ISS1acmD::myc after overnight growth at 30° C as standing cultures in GM17 medium. Magnification: 1250x in all three frames; representative views. (c) Phase contrast microscopic views of uninduced (left) and nisin (10 ng/ml)-induced (right) IL1403acmA::ISS1acmD::myc harboring plasmids pNGAcmD (AcmD) and pNZ9530 (nisRK). (d) Quantification of chain length in L. lactis IL1403, IL1403acmA::ISS1, IL1403acmA::ISS1acmD::myc, and nisin (10 ng/ml)-induced IL1403acmA::ISS1acmD::myc (pNGacmD) (the complemented double mutant). Number of diplococci per chain was counted and the mean of 30 chains were depicted. Standard deviation (***) indicates the significance as analyzed by Bonferroni’s multiple comparison test (p<0.05) using one-way ANOVA.

https://doi.org/10.1371/journal.pone.0072167.g003

LysM_AcmD binds to lactococcal cells preferably at low pH

As peptidoglycan binding of AcmD is difficult to examine because its activity is not detectable and antibodies are not available, LysM_AcmD (pI=4.2, see column pI LysM in Table 1 and Figure 1) was fused to the MSA2 reporter protein, for which an antibody is available [35]. The fusion protein, MSA2-LysM_AcmD, is secreted by fusing the signal sequence of the lactococcal proteinase PrtP to its N-terminal. Western detection revealed that MSA2-LysM_AcmD is secreted from L. lactis NZ9000acmAΔ1 (pNG3042) upon nisin induction (results not shown). When a supernatant containing MSA2-LysM_AcmD was mixed with L. lactis MG1363 cells poor binding of the fusion protein was observed at pH 6.2 (Figure 4A). A similar result was obtained when L. lactis MG1363 cells were mixed with the supernatant of L. lactis NZ9000acmAΔ1 (pNG3041), containing the MSA2-LysM_AcmA fusion protein [41]. Although previously we have shown that MSA2 alone cannot bind lactococcal cells [41] we did observe binding of the MSA2 protein in this study. When the binding of the three proteins was repeated with TCA-pretreated L. lactis cells a substantial increase in binding was observed for the MSA2-LysM_AcmA and MSA2-LysM_AcmD fusion proteins but not for the MSA2 protein (Figure 4A). To investigate whether the pI of MSA2-LysM_AcmD affects cell binding the binding to TCA-pretreated cells was repeated at pHs 3.2 and 6.2. Figure 4B clearly shows that MSA2-LysM_AcmD binds 2-fold more at pH 3.2 than at pH 6.2 (compare lanes 1 and 3). No detectable binding of MSA2-LysM_AcmA could be observed using electron microscopy (Figure 4C) while strong labeling signals was detected on TCA-treated cells. However, as for MSA2-LysM_AcmD, only minor labeling signals were observed (Figure 4C). These results suggest that LysM_AcmD has poor cell wall binding properties around neutral pH (pH 7.2) while its binding to the cell wall is increased at a pH closer to its pI, when the net charge of the protein is positive.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Binding of MSA2-LysM_AcmA and MSA2-LysM_AcmD to L. lactis cells.

a. Anti-MSA2 antibody-treated Western blot showing binding of MSA2-LysM_AcmA, MSA2-LysM_AcmD and MSA2 to non-treated (lanes 1, 2 and 3) and TCA-treated (lanes 4, 5 and 6) L. lactis cells, respectively. b. Western blot treated with anti-MSA2 antibody. Lanes 1 and 3 indicate MSA2-LysM_AcmD bound to TCA-treated L. lactis cells at pH 6.2 and 3.2, respectively. The unbound protein at pH 6.2 and 3.2 is shown in lanes 2 and 4, respectively. Lane 5, positive control: MSA2-LysM_AcmA bound to L. lactis at pH 6.2. Arrow points out Pro-MSA2-LysM_AcmD and * indicates mature MSA2-LysM_AcmD. The percentage of both MSA2-LysM variants bound to L. lactis cells at pH 6.2 and 3.2 were semi-quantified (as the number of pixels present per mm² of both bands in lanes 1 or 3) divided by the total signal of the cell and supernatant fractions (number of pixels per mm² of all bands in lanes 1+2 or 3+4, respectively) is shown at the bottom of lanes 1 and 3. c. Transmission electron microscopic images of L. lactis incubated with MSA2 or MSA2 fusion proteins and subsequently incubated with rabbit anti-MSA2 antibodies and finally decorated with goat anti-rabbit IgG gold marker. Picture 1: non-treated L. lactis cells incubated with MSA2-LysM_AcmA. Pictures 2, 3 and 4 show TCA-treated L. lactis cells incubated with MSA2-LysM_AcmA, MSA2-LysM_AcmD and MSA2 proteins, respectively. Arrows indicate immunogold particles detected on the cells.

https://doi.org/10.1371/journal.pone.0072167.g004

LysM domains of AcmD and AcmA bind differently to lactococcal cells

The purified MSA2-LysM_AcmA fusion protein binds to the septum and poles of L. lactis cells when added from the outside to these cells [41]. Attempts to repeat these experiments with the MSA2-LysM_AcmD protein failed due to side effects of the immunodetection at pH 4. And because the MSA2 protein showed non-specific binding to L. lactis cells another approach was taken. To locate the sites of binding of LysM_AcmD on the cell, C-terminal GFP fusions of His₁₀-tagged LysM_AcmA (pI=10, see column pI LysM in Table 1) and LysM_AcmD were expressed in and purified from E. coli using Ni-NTA. SDS-PAGE with a 15% PAA gel followed by in-gel fluorescence detection showed that the fusion proteins are of the proper size and fluoresce (results not shown and Figure S3). Purified LysM_AcmD-GFP-His₁₀ (48.5 kDa; pI=5.6) only binds to L. lactis NZ9000 cells at pH 4, not at pH 6 or pH 8 (Figure 5A and Figure S5). Phase contrast and fluorescence analyses showed that L. lactis does not intrinsically fluorescence under the conditions used (Figure S4A). HIC-purified GFP protein did not bind to the L. lactis cells under any of the conditions tested (Figure S4B and results not shown). Unlike the LysM_AcmD fusion protein, LysM_AcmA-GFP-His₁₀ (51.4 kDa; pI=8.2) bound to L. lactis cells at pH 4, pH 6 and pH 8 (Figure 5B and C and results not shown).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Binding of LysM_AcmD-GFP-His₁₀ and LysM_AcmA-GFP-His₁₀ to L. lactis NZ9000 cells.

Phase contrast and fluorescence microscopy of L. lactis NZ9000 cells incubated with (a) LysM_AcmD-GFP-His₁₀ at pH 4.0 and (b and c) LysM_AcmA-GFP-His₁₀ at pH 4.0 and 8.0, respectively. Original magnification: 1250-fold in all frames.

https://doi.org/10.1371/journal.pone.0072167.g005