Twist1 knockdown decreases Tie2 expression in vitro

Twist1 is a b-HLH transcription factor which binds to the E-box promoter region [18,29]. Since the Tie2 promoter has E-box consensus sequences [30], we first examined whether Twist1 controls Tie2 expression in lung human microvascular endothelial (L-HMVE) cells in vitro. Knockdown of Twist1 using siRNA (#1) transfection, which decreased Twist1 expression levels by half, downregulated mRNA levels of Tie2 in L-HMVE cells by half (Figure 1A). Knockdown of Twist1 also downregulated protein levels of Twist1 and Tie2 in L-HMVE cells when analyzed using immunoblotting (Figure 1B). Similar knockdown effects on Tie2 were obtained using a second Twist1 siRNA (#2), suggesting that the knockdown effect of Twist1 is not an off-target effect of siRNA (Figure 1A, B). Since Twist1 is a transcription factor, we next examined whether Twist1 binds the Tie2 promoter region in L-HMVE cells using chromatin immunoprecipitation (ChIP) assay [34] (Figure 1C). ChIP analysis showed that Twist1 binds the Tie2 promoter region (-666--455), which includes the E-box, and Twist1 knockdown using siRNA (#1) transfection resulted in decreased binding, indicating that Twist1 binds the Tie2 promoter. Control IgG did not immunoprecipitate these DNAs in L-HMVE cells (Figure 1C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Twist1 controls Tie2 expression in microvascular endothelial cells.

A) Graph showing Twist1 and Tie2 mRNA levels in L-HMVE cells treated with Twist1 siRNA #1 or #2 (* p<0.01). As a control, cells were treated with siRNA duplex with an irrelevant sequence. Error bars represent s.e.m. of at least three independent experiments. B) Immunoblots showing Twist1, Tie2, and GAPDH protein levels in L-HMVE cells treated with Twist1 siRNA #1 or #2. C) ChIP analysis showing Tie2 promoter co-immunoprecipitating (IP) with control IgG or Twist1 antibody in L-HMVE cells transfected with Twist1 siRNA #1. Ct, control.

https://doi.org/10.1371/journal.pone.0073407.g001

Twist1 knockdown increases vascular permeability in vitro

Since Tie2 is known to control vascular permeability [3,12] and our in vitro results indicate that Twist1 controls Tie2 expression (Figure 1), we next explored the possibility that Twist1 might be involved in control of vascular barrier function. VE-cadherin-containing cell-cell junctions resist the traction forces generated in the contractile actin cytoskeleton in cells, and hence control vascular permeability [3]. Immunocytochemical analysis revealed that normally well-defined, linear cell-cell junctions were disrupted when Twist1 mRNA and protein levels were knocked down in cultured L-HMVE cells using two distinct siRNAs (#1 and #2) (Figures 1 and 2A). Quantitative results revealed that the discontinuous area was increased by 3 times in Twist1 knockdown cells compared to L-HMVE cells treated with control siRNA with irrelevant sequence (Figure 2B). Twist1 knockdown also increased vascular permeability by 1.3-fold as measured by quantitating the flux of fluorescently-labeled albumin across the cell monolayer cultured in a Transwell chamber in vitro (Figure 2C) [3]. These knockdown effects were obtained by two distinct siRNAs against Twist1, suggesting that these knockdown effects of Twist1 siRNA on cell-cell junction integrity are not off-target effects of siRNA (Figure 2A–C) and we used Twist1 siRNA #1 for the rest of the experiments. It has been reported that phosphorylation of the Tie2 receptor and subsequent change in Rho small GTPase activity control vascular permeability in both cultured endothelial cells in vitro and in vivo in lungs [3,12,35]. Thus, we next examined whether Twist1 controls Tie2 phosphorylation and RhoA activity in L-HMVE cells. Twist1 knockdown significantly decreased Tie2 expression as well as Tie2 phosphorylation in L-HMVE cells (Figure 2D). When we examined RhoA activity using a rhotekin pull down assay, RhoA activity was three times higher in Twist1-knocked down L-HMVE cells compared to cells treated with control siRNA with irrelevant sequence (Figure 2E). Importantly, when we over-expressed Tie2 in HUVE cells using DNA transfection, the Twist1 knock down-induced vascular leakage was partially inhibited (Figure 2F). These results indicate that Twist1 regulates vascular permeability by changing the expression levels and associated phosphorylation status of Tie2 and changing RhoA activity in microvascular endothelial cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. Twist1 controls the integrity of endothelial cell-cell junction in microvascular endothelial cells in vitro.

A) Immunofluorescence micrographs showing cell-cell junction structure by VE-cadherin staining in L-HMVE cells treated with Twist1 siRNA #1 or #2 (bar, 50 µm). DAPI staining shows the nuclei of cells. Arrows show the region where cell-cell junctions are disrupted. As a control, cells were treated with siRNA duplex with an irrelevant sequence. B) Graph showing the quantitation of the total discontinuous area of at least 10 fields (*, p<0.01). C) Graph showing endothelial permeability in L-HMVE cells treated with control siRNA, Twist1 siRNA #1 or #2 (*, p<0.05). Permeability (Pa) values were evaluated after 6 h and are expressed as percentage of control cells. D) Immunoblots showing tyrosine phosphorylated Tie2 detected by phosphotyrosine antibody (4G10) and total Tie2 immunoprecipitated with Tie2 antibody from total cell lysates in Twist1 knockdown (siRNA #1 treated) L-HMVE cells. E) Levels of active RhoA in Twist1 knockdown (siRNA #1 treated) L-HMVE cells. Quantitative results (ratio of active RhoA to total RhoA) were normalized to control siRNA treated cells (*, p<0.01). F) Graph showing endothelial permeability in HUVE cells treated with Twist1 siRNA #1, Tie2 DNA, or in combination (*, p<0.05). As a control, cells were treated with siRNA duplex with an irrelevant sequence and/or control DNA (vector only). Immunoblots showing Twist1, Tie2, and GAPDH protein levels in HUVE cells treated with Twist1 siRNA #1, Tie2 DNA, or in combination. All error bars are s.e.m.

https://doi.org/10.1371/journal.pone.0073407.g002

Twist1 knockdown increases vascular permeability in the mouse lung in vivo

To further evaluate the role of Twist1 in vascular permeability in vivo, we created Tie2-specific conditional Twist1 knockout mice (Tie2-Twist1^KO) by crossing Tie2-Cre expressing mice with Twist1^flox|flox mice exhibiting floxed disruption in the Twist1 gene. Histology (H & E staining) of lung sections revealed that the interstitial wall is thicker throughout the lungs of Tie2-Twist1^KO mice (Figure 3A, 6 weeks old) compared to the lungs of age matched control Twist1^flox|flox mice. Twist1 and Tie2 mRNA expression decreased by 50% and 20% respectively in the whole lungs of Tie2-Twist1^KO mice (Figure 3B), which is consistent with the in vitro data showing that knockdown of Twist1 decreases Tie2 expression (Figure 1). The expression of the Tie2 ligands, Ang1 and 2, was not altered in the lungs of Tie2-Twist1^KO mice compared to that in control Twist1^flox|flox mice (Figure 3B). We also examined the degree of Twist1 and Tie2 inhibition in endothelial cells of Tie2-Twist1^KO mouse lungs using laser capture microdissection (LCM) on unfixed frozen sections of lung tissue. We collected concanavalin A labeled endothelial cells and measured mRNA levels of Twist1 and Tie2 in endothelial cells using qRT-PCR. Twist1 and Tie2 expression were lower by 90% and 75%, respectively in lung endothelial cells from Tie2-Twist1^KO mice compared to that in control Twist1^flox|flox mice (Figure 3C). We also enzymatically digested lungs of these mice and isolated endothelial cells by incubating these cells with CD31-coated beads and analyzed the protein levels of Twist1 and Tie2 in the cells using immunoblotting. Consistent with the results obtained by LCM, Twist1 and Tie2 expression were lower by 98% and 65%, respectively in lung endothelial cells collected from Tie2-Twist1^KO mice compared to cells from control Twist1^flox|flox mice (Figure 3D). We further confirmed the results using immunohistochemical analysis, showing that Twist1 and Tie2 expression were lower in CD31-positive endothelial cells of Tie2-Twist1^KO mouse compared to those of control Twist1^flox|flox mouse (Figure 3E). The junctional integrity and endothelial microstructure of the lungs were also analyzed in control Twist1^flox|flox and Tie2-Twist1^KO mouse lungs using transmission electron microscopy (TEM). Junctions between pulmonary endothelial cells were tight and characterized by closely apposed membranes in randomly sampled regions of lungs from control Twist1^flox|flox mice. In contrast, in lungs from Tie2-Twist1^KO mice, endothelial cells were swollen with cubical shape and cell-cell junctions appeared to be disrupted with increased space appearing between adjacent cell membranes (Figure 3F). These findings support the hypothesis that Twist1-Tie2 signaling plays a key role in endothelial cell structure and junctional integrity in vivo.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Twist1 regulates endothelial microstructure and cell-cell junctional integrity in the mouse lung in vivo.

A) H&E staining of the lungs from control Twist1^flox|flox or Tie2-Twist1^KO mice. Scale bar, 50 µm. B) Graph showing Twist1, Tie2, and Ang1, 2 mRNA levels in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice (n=8, * p<0.05). Error bars are s.e.m. C) Graph showing Twist1 and Tie2 mRNA levels in the lung blood vessels of Twist1^flox|flox or Tie2-Twist1^KO mice isolated using LCM (* p<0.05). Error bars are s.e.m. D) Immunoblots showing Twist1, Tie2 and GAPDH protein levels in CD31 positive cells isolated from Twist1^flox|flox or Tie2-Twist1^KO mice (left). Graphs showing the quantitative results of protein levels of Twist1 and Tie2 normalized to GAPDH protein levels (right). E) Immunofluorescence micrographs showing expression and distribution of Twist1, Tie2 and CD31-stained blood vessels in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice (bar, 20 µm). F) TEM images showing endothelial microstructure and cell-cell junctional integrity in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice (bar, 500 nm). E: endothelial cells. Arrowheads show the region of cell-cell junctions.

https://doi.org/10.1371/journal.pone.0073407.g003

To further determine whether changes in Twist1 expression regulate pulmonary vascular permeability in vivo, we measured vascular permeability in Tie2-Twist1^KO mouse lungs by measuring leakage of Evans blue dye (Figure 4A) or fluorescently labeled low molecular weight (LMW) dextran (Figure 4B). The leakage of Evans blue dye into lung extravascular space was 1.8 times higher in Tie2-Twist1^KO mouse lungs compared to that in Twist1^flox|flox control mice (Figure 4A). The leakage of fluorescently labeled LMW dextran into lung alveolar spaces also increased by 2.5-fold in Tie2-Twist1^KO mouse lungs compared to that in control Twist1^flox|flox mice (Figure 4B). In addition, Twist1 knockdown in Tie2-Twist1^KO mouse lungs increased the number of immune cells in bronchoalveolar lavage (BAL) fluid by approximately 3-fold, further indicating that vascular permeability is increased in Tie2-Twist1^KO mouse lungs (Figure 4C). Exercise capacity as measured by the total distance mice were able to run using a rodent treadmill exercise protocol, was decreased by 25% in Tie2-Twist1^KO mice compared to control Twist1^flox|flox mice (Figure 4D), indicating that Twist1 plays a key role in physiological lung function. Consistent with the data from in vitro study, Tie2 overexpression using retro-orbital injection of cationic DNA [7,36,37], which increases Tie2 protein levels in the lungs (Figure S1A), partially restored lung vascular leakage in Tie2-Twist1^KO mice (Figure 4E), confirming that Twist1-Tie2 signaling controls lung vascular barrier function in vivo.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Twist1 regulates lung vascular permeability in vivo.

A) Graph showing vascular permeability in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice. Vascular permeability is detected by Evans blue dye leakage in the lungs and extracted dye contents are quantified by measuring at 620 nm (n=9, *, p<0.05). B) Immunofluorescence micrographs showing LMW fluorescently labeled dextran leakage (green) and blood vessel formation (CD31 staining; magenta) in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice (bar, 20 µm). Graph showing the leaked dextran density normalized to vessel density in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice (n=7, *, p<0.05). C) Micrographs showing the immune cells in BAL fluid from the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice detected by Wright-Giemsa staining (Upper, bar, 50 µm). Graph showing the immune cell count in BAL fluid from the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice (Lower, n=8, *, p<0.05). D) Exercise capacity of Twist1^flox|flox or Tie2-Twist1^KO mice assessed by total running distance according to a predetermined protocol (n=15, *, p<0.05). E) Graph showing vascular permeability detected by Evans blue dye leakage in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice treated with Tie2 DNA (left; n=9, *, p<0.05). Immunofluorescence micrographs showing LMW fluorescently labeled dextran leakage (green) and blood vessel formation (CD31 staining; magenta) in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice treated with Tie2 DNA (right; bar, 20 µm). Graph showing the leaked dextran density normalized to vessel density in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice treated with Tie2 DNA (n=7). As a control, mice were treated with control DNA (vector only). All error bars are s.e.m.

https://doi.org/10.1371/journal.pone.0073407.g004

Twist1-Tie2 signaling mediates endotoxin-induced lung injury

Circulating serum Ang2 is elevated in humans with various pathological conditions such as ARDS, cancer and inflammation, in which vascular permeability is elevated [12,13,38–41]. Although Twist1 knockdown using siRNA transfection disrupted cell-cell junctional integrity in L-HMVE cells, when cells were treated with Ang2, Twist1 knockdown failed to disrupt cell-cell junctional integrity (Figure 5A). Quantitative results revealed that the discontinuous area was increased by 3-fold in Twist1 knockdown L-HMVE cells, which was restored to the levels of untreated control cells when treated with Ang2 (Figure 5B). Consistently, Twist1 knockdown failed to increase vascular permeability, measured using a transwell vascular permeability assay, under Ang2 treatment in L-HMVE cells (Figure 5C). When we measured the mRNA and protein levels of Twist1 and Tie2 in L-HMVE cells, they were 60-70% lower in Twist1-knocked down Ang2-treated L-HMVE cells, which were identical to untreated cells (Figure 5D), suggesting that Ang2 does not affect the Twist1 knockdown-induced decrease in Tie2 expression. We also examined whether Twist1 controls RhoA activity in Ang2-treated L-HMVE cells. When we examined RhoA activity using a rhotekin pull down assay, RhoA activity was lower by 30% in Twist1-knocked down Ang2-treated L-HMVE cells compared to the cells treated with Ang2 and control siRNA with irrelevant sequence (Figure 5E).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Twist1 knockdown fails to disrupt endothelial cell-cell junction integrity in L-HMVE cells under Ang2 treatment in vitro.

A) Immunofluorescence micrographs showing cell-cell junction structure by VE-cadherin staining in L-HMVE cells treated with Twist1 siRNA (#1), Ang2, or both in combination (bar, 50 µm). DAPI staining shows the nucleus of each cell. Arrows show the region where cell-cell junctions are disrupted. As a control, cells were treated with siRNA duplex with an irrelevant sequence. B) Graph showing the quantitation of the total discontinuous area in L-HMVE cells treated with Twist1 siRNA (#1), Ang2, or both in combination in at least 10 fields (*, p<0.05). C) Graph showing endothelial permeability in L-HMVE cells treated with Twist1 siRNA (#1), Ang2, or both in combination (*, p<0.05). Permeability (Pa) values are expressed as percentage of control cells. D) Graphs showing Twist1 and Tie2 mRNA levels in L-HMVE cells treated with Twist1 siRNA (#1), Ang2, or both in combination (top, * p<0.01). Immunoblots showing Twist1, Tie2, and GAPDH protein levels in L-HMVE cells treated with Twist1 siRNA (#1), Ang2, or both in combination (bottom). E) Immunoblots showing levels of active RhoA in L-HMVE cells treated with Twist1 siRNA (#1), Ang2, or both in combination (top). Quantitative results (ratio of active RhoA to total RhoA) were normalized to control siRNA treated Ang2-untreated cells (*, p<0.05). All error bars are s.e.m.

https://doi.org/10.1371/journal.pone.0073407.g005

To determine whether Twist1-Tie2 signaling mediates lung vascular permeability in sepsis-induced lung injury in vivo, we exposed whole lung of living adult mice to the endotoxin, lipopolysaccharide (LPS), which induces the development of pulmonary edema and ARDS in humans with sepsis [3,42]. Systemic LPS treatment is a widely accepted physiological animal model for sepsis-induced ARDS [3,7,31,43]. Consistent with previous reports [3,7], LPS treatment for 24 hours in control Twist1^flox|flox mice increased lung vascular permeability by 2.5-fold compared to untreated control mice when measured using Evans blue dye leakage (Figure 6A). LPS-induced increase in lung vascular permeability was significantly suppressed in Tie2-Twist1^KO mice, in which Tie2 expression in lungs was decreased (Figure 3B–E), compared to control Twist1^flox|flox mice (Figure 6A). We also confirmed the effects of LPS treatment in Tie2-Twist1^KO mice using fluorescent-labeled LMW dextran leakage, showing that increased dextran leakage into alveolar spaces was 15% lower in Tie2-Twist1^KO mice compared to Twist1^flox|flox mice (Figure 6B). Consistently, the number of immune cells in the BAL fluid increased by 4.5-fold in the LPS-treated control Twist1^flox|flox mice, while this effect was attenuated in the Tie2-Twist1^KO mice (Figure 6C, D). These results suggest that down-regulated Twist1-Tie2 signaling suppresses endotoxin-induced vascular leakage in mouse lungs. Consistent with in vitro results (Figure 5D), the mRNA and protein levels of Twist1 and Tie2 in the lungs were 30-70% lower in Tie2-Twist1^KO mice regardless of LPS treatment (Figure 6E, Figure S2). Importantly, LPS treatment significantly increased the protein levels of Ang2 in the lungs, while it did not change Ang1 levels (Figure 6E), suggesting that downregulation of Twist1-Tie2 signaling prevents the LPS-induced increase in lung vascular permeability by suppressing the effects of its ligand, Ang2, on endothelial cell-cell junctional integrity. Although basal exercise capacity measured using a rodent treadmill exercise protocol was significantly lower in LPS-treated Twist1^flox|flox mice compared to untreated mice, when evaluated 1 week after the LPS treatment, the running ability was partially reversed in LPS-treatedTwist1^flox|flox mice (Figure 6F). These findings suggest that down-regulation of Twist1-Tie2 signaling attenuates the endotoxin-induced increase in vascular permeability and restores lung function.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Twist1 mediates lung vascular permeability in endotoxin-induced lung injury in vivo.

A) Vascular permeability detected by Evans blue dye leakage in the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice treated with LPS for 1 day (n=10, *, p<0.05). B) Immunofluorescence micrographs showing LMW fluorescently labeled dextran leakage (green) and blood vessel formation (CD31 staining; magenta) in LPS-treated lungs of Twist1^flox|flox or Tie2-Twist1^KO mice (bar, 20 µm). Graph showing the leaked dextran density normalized to vessel density in the lungs of LPS-treated Twist1^flox|flox or Tie2-Twist1^KO mice (n=7, *, p<0.05). C) Micrographs showing the immune cells in BAL fluid from the lung of Twist1^flox|flox or Tie2-Twist1^KO mice treated with LPS for 1 day, detected by Wright-Giemsa staining (bar, 50 µm). D) Graph showing the immune cell count in BAL fluid from the lungs of Twist1^flox|flox or Tie2-Twist1^KO mice treated with LPS for 1 day (n=8, *, p<0.05). E) Immunoblots showing Twist1, Tie2, and β-actin protein levels in the lungs of Twist1^flox|flox (Ct) or Tie2-Twist1^KO mice (T) treated with LPS for 1 day (left). Graphs showing Ang1 and Ang2 protein levels in the lungs of Twist1^flox|flox (Ct) or Tie2-Twist1^KO mice (T) treated with LPS for 1 day (right, n=8, * p<0.05). F) Exercise capacity of Twist1^flox|flox or Tie2-Twist1^KO mice treated with LPS for 1 day assessed by total running distance according to a predetermined protocol (n=15, *, p<0.05). All error bars are s.e.m.

https://doi.org/10.1371/journal.pone.0073407.g006

Materials

Anti -CD31 and –VE-cadherin monoclonal antibodies were from Transduction Laboratories (Lexington, KY). Anti-GAPDH monoclonal antibody was from Chemicon (Temecula, CA). Anti-β actin monoclonal antibody was from Sigma. Anti–Twist1 monoclonal and -RhoA polyclonal antibodies were from Abcam. Anti–Twist1 polyclonal antibody was from Santa Cruz Biotechnology (Dallas, TX). Anti-Tie2 monoclonal antibody and anti-phosphotyrosine (4G10) were from Upstate (Lake Placid, NY). Anti-VEGFR2 polyclonal antibody was from Cell Signaling (Danvers, MA). LPS was from Sigma. L-HMVE cells and HUVE cells (Lonza, Walkersville, MD) were cultured as described before [3,14].

Plasmid construction and gene knockdown

The full length Tie2 plasmid (pSPORT Tie2) was from Open Biosystems (Huntsville, AL) and transient transfection was performed using Superfect reagent (QIAGEN, Valencia, CA) according to the manufacturer’s directions [34]. As a control, plasmid with vector only was used. Gene knockdown was performed using the RNA interference technique [34]. siRNAs for human Twist1 #1 was 5’- UUGAGGGUCUGAAUCUUGCUCAGCU -3’ and 5’- AGCUGAGCAAGAUUCAGACCCUCAA -3’. #2 was 5’-ACUCCAAGAUGGCAA GCUG-3’ and 5’- CAGCUUGCCAUCUUGGAGU-3’ [77]. As a control, siRNA duplex with an irrelevant sequence (QIAGEN) was used.

Biochemical Methods

Rho activity assay was performed and quantified using the Rho activation assay kit based on rhotekin pull-down assay according to the manufacturer’s instruction (Cytoskeleton, Denver, CO) [78]. The ratio of rhotekin-bound RhoA and RhoA in the total cell lysate was analyzed using NIH ImageJ software [78]. The levels of Ang1 and Ang2 in the mouse lung homogenate were measured by ELISA (MyBioSource, San Diego, CA).

Molecular biological methods

Quantitative reverse transcription (qRT)-PCR was performed with the Quantitect SYBR, Green RT-PCR kit (Agilent) using the ABI 7300 real time PCR system (Applied Biosystems, Foster City, CA). β2 microglobulin or cyclophilin controlled for overall cDNA content. The primers used for human and mouse Tie2, mouse Ang1 and Ang2, human VEGFR2, human β2 microglobulin and mouse cyclophilin were previously described [14,34]. The primers for human Twist1 were 5’-GTCCGCAGTCTTACGAGGAG-3’, 5’- GCTTGAGGGTCTGAATCTTGCT-3’, mouse Twist1 were 5’-GGACAAGCTGAGCAAGATTCA-3’, 5’- CGGAGAAGGCGTAGCTGAG-3’. For ChIP assay, DNA from L-HMVE cells transfected with control or Twist1 siRNA #1 was immunoprecipitated with the Twist1 antibody or control immunoglobulin (Jackson Immuno Research), according to the manufacturer instructions (Active Motif, Carlsbad, CA) [34]. The Twist1-binding region was amplified using primers, 5’-TTGCTTTTCAGGTTGTATTTTC-3’ and 5’-agaataacaagccctccacc-3’.

Cell analysis methods

L-HMVE cell monolayer junction formation was analyzed using immunohistochemistry with VE-cadherin antibody staining [3,7,34]. L-HMVE cells were cultured for 12 h and immunostaining was performed and analyzed using confocal Leica SP2 microscope [34]. Discontinuous area was calculated using ImageJ software in ten random fields in three independent experiments [7]. L-HMVE cell monolayer permeability was determined with the use of FITC-labeled bovine serum albumin (Sigma) as described previously [3]. FITC-albumin (final concentration 1 mg/ml) was added to the luminal chamber for 6 h, and samples were taken from both the luminal and abluminal chamber for fluorometric analysis. Where indicated, vehicle or Ang2 (30 ng/ml, R&D systems) was added to the luminal chamber with FITC-labeled bovine serum albumin. Fluorescence readings were converted with the use of a standard curve to albumin concentration. These concentrations were used to determine the permeability coefficient of albumin (Pa) as described [3].

In Vivo Pulmonary Permeability Assay

The in vivo animal study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was reviewed and approved by the Animal Care and Use Committee of Boston Children’s Hospital (Protocol Number: 10-11-1818R). Mice with Tie2-specific knockdown of Twist1 (Tie2-Twist1^KO) were generated by cross-breeding Tie2-Cre expressing C57BL/6J mice (Jackson Laboratory stock #004128) with Twist1 floxed mice (Twist1^flox|flox) [79]. Mice (6–8 weeks old) were treated with LPS (2.5 mg/kg, intraperitoneally) and lung permeability was assessed 24 hours after injection [3,7]. For gene overexpression, delivery of DNA into mice was performed using retro-orbital injection of the mixture with Exgen (Fermentas) according to the manufacturer’s instructions [7,36,37]. Gene overexpression in the lung (2 days later) was confirmed by measuring protein levels using immunoblotting. The lung permeability was measured using Evans blue dye or LMW fluorescently labeled dextran (MW 4000, sigma) leakage [3,7]. Evans blue dye was extracted from the lung by incubation with formamide (70 °C for 24 h) and the absorbance of extracted dye was measured at 620 nm. Dextran leakage was quantified using a macro designed for NIH’s ImageJ software that counts colored pixels between thresholds selected to minimize background, yielding a percentage of total image area, which was then normalized to vessel density, with each parameter analyzed independently.

For TEM, small pieces (1-2 mm cubes) of lung tissue were fixed with 2.5% Glutaraldehyde and 2% Paraformaldehyde in 0.1 M sodium cacodylate buffer (pH 7.4) for at least 2 h at room temperature, washed in 0.1M cacodylate buffer and postfixed with 1% Osmium tetroxide (OsO4)/1.5% Potassiumferrocyanide (KFeCN6) for 1 h, washed in water and incubated in 1% aqueous uranyl acetate for 1 h followed by washes in water and subsequent dehydration in grades of alcohol. The samples were then put in propylene oxide for 1 hr and infiltrated ON in a 1:1 mixture of propylene oxide and TAAB Epon (Marivac Canada Inc, St.-Laurent, Canada). The samples were then embedded in TAAB Epon and polymerized at 60 °C for 48 hrs. Ultrathin sections (about 60 nm) were cut on a Reichert Ultracut-S microtome, picked up on to copper grids stained with lead citrate and examined in a TecnaiG² Spirit BioTWIN.

BAL was performed by instilling 0.9% NaCl in two separate 0.5 ml aliquots. The fluid was recovered by gentle suction and placed on ice for immediate processing. An aliquot of the BAL fluid was processed immediately for differential cell counts by performing cytospin preparations and staining with modified Wright-Giemsa stain (Diff-Quik; American Scientific Products, McGaw Park, IL) [7].

Laser-Capture Microdissection of Lung Vessels

Lung vessels were microdissected with laser capture in unfixed cross sections of lungs from Tie2-Twist1^KO and Twist1^flox|flox mice, as described previously [80–82]. Lungs from Tie2-Twist1^KO and Twist1^flox|flox mice were collected after injecting fluorescein-conjugated Concanavalin A into the retro-orbital vein to stain blood vessels [7,34]. Lungs were embedded in OCT, cut into 8-µm sections, and collected on RNase-free polyethylene naphthalate membrane slides (Leica). Blood vessels were microdissected on a LCM system (LMD-6000; Leica). RNA was extracted from microdissected tissues (RNeasy Micro Kit; Qiagen), and real-time PCR was performed.

Isolation of CD31-positive cells from mouse lungs

The lung was minced into small pieces and digested in a solution of 1 mg/ml collagenase (Sigma, St. Louis, MO) and 2.4 U/ml dispase solution (Collaborative Biomedical Products, Bedford, MA) for 40 min at 37 °C. Single-cell suspensions were incubated with anti-CD31 antibody-conjugated microbeads (Miltenyl Biotec, Auburn, CA, USA) on ice and the CD31-positive population was isolated according to the manufacturer’s instruction.

Exercise Capacity

Mice were run according to a predetermined protocol and we assessed the ability of untrained mice to run for distance [83,84]. The animals were initially acclimated to the treadmill environment for 30 min. For warm-up and for further familiarization with treadmill running, the mice were required to run at a relatively easy pace of 10 m/min for 30 min. Then the speed of the treadmill was increased to 20 m/min, and we recorded the exercise duration and distance the mice could run until exhaustion. Exhaustion was defined operationally as the time at which the mouse was unable, or refused, to maintain its running speed despite encouragement by mild electrical stimulation.

Statistical analysis

All phenotypical analysis was performed by masked observers unaware of the identity of experimental groups. All statistical data was analyzed using GraphPad Prism V 5.0. Error bars (SEM) and p values were determined from the results at least three or more independent experiments. The ANOVA with post-hoc student T test was used for analysis of statistical significance.