Trx2p-dependent Regulation of Saccharomyces cerevisiae Oxidative Stress Response by the Skn7p Transcription Factor under Respiring Conditions

Rocío Gómez-Pastor; Elena Garre; Roberto Pérez-Torrado; Emilia Matallana

doi:10.1371/journal.pone.0085404

Abstract

The whole genome analysis has demonstrated that wine yeasts undergo changes in promoter regions and variations in gene copy number, which make them different to lab strains and help them better adapt to stressful conditions during winemaking, where oxidative stress plays a critical role. Since cytoplasmic thioredoxin II, a small protein with thiol-disulphide oxidoreductase activity, has been seen to perform important functions under biomass propagation conditions of wine yeasts, we studied the involvement of Trx2p in the molecular regulation of the oxidative stress transcriptional response on these strains. In this study, we analyzed the expression levels of several oxidative stress-related genes regulated by either Yap1p or the co-operation between Yap1p and Skn7p. The results revealed a lowered expression for all the tested Skn7p dependent genes in a Trx2p-deficient strain and that Trx2p is essential for the oxidative stress response during respiratory metabolism in wine yeast. Additionally, activity of Yap1p and Skn7p dependent promoters by β-galactosidase assays clearly demonstrated that Skn7p-dependent promoter activation is affected by TRX2 gene deficiency. Finally we showed that deleting the TRX2 gene causes Skn7p hyperphosphorylation under oxidative stress conditions. We propose Trx2p to be a new positive efector in the regulation of the Skn7p transcription factor that controls phosphorylation events and, therefore, modulates the oxidative stress response in yeast.

Citation: Gómez-Pastor R, Garre E, Pérez-Torrado R, Matallana E (2013) Trx2p-dependent Regulation of Saccharomyces cerevisiae Oxidative Stress Response by the Skn7p Transcription Factor under Respiring Conditions. PLoS ONE 8(12): e85404. https://doi.org/10.1371/journal.pone.0085404

Editor: Reiko Sugiura, Kinki University School of Pharmaceutical Sciences, Japan

Received: July 15, 2013; Accepted: December 4, 2013; Published: December 23, 2013

Copyright: © 2013 Gómez-Pastor et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work has been supported by grants AGL 2008-00060 and AGL2011-24353 from the Spanish Ministry of Education and Science (MEC) to EM. EG was a predoctoral fellow of the FPI program from the MEC (Spanish Ministry of Education). RG-P was a predoctoral fellow of the I3P program from the CSIC (Spanish National Research Council). RP-T was a postdoctoral fellow of the JAEDOC program from the CSIC. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The TRX2 gene encodes the cytoplasmic thioredoxin II in Saccharomyces cerevisiae, which is a small protein (11 kDa) with thiol-disulfide oxidoreductase activity [1]. It was one of the first identified gene targets of Yap1p, the main oxidative stress transcriptional factor belonging to the Yap-βZIP (Yeast activator proteins) family [2,3], and it is also among the most highly induced genes in response to oxidative stress [4]. During yeast growth, the presence of at least one thioredoxin (TRX1 or TRX2) is important for redox homeostasis maintenance [5]. However, Trx2p is more specialized in protection against ROS as sensitivity to H₂O₂ increases in the trx2 but not in the trx1 mutant [2].

Thioredoxins are involved in protein protection against oxidative and reductive stresses [6,7], and are responsible for the negative regulation of Yap1p activity [8]. In vitro analyses have indicated that the reduced form of Trx2p can also act as a reducing agent for Yap1p disulfide linkages, thus inactivating its transcription factor function [9]. Furthermore, they participate in the catalytic cycle of Orp1p (GPX3), which is a positive regulator of Yap1p activity [9–12]. Due to their oxidoreductase activity, thioredoxins can also regulate other proteins such as: (i) thioredoxin peroxidases (ii), 3´-phosphoadenosine 5´-phosphosulfate reductase (PAPS) [13], (iii) ribonucleotide reductase [14], (iiii) hexokinase II [15], and several proteins in E. coli and plants [16,17].

Under non stressed conditions, Yap1p exists in the cytoplasm and the nucleus, but it rapidly localizes only in the nucleus after oxidative stress [10,18] by activating many oxidative stress response (OSR) genes either itself [19,20] or by cooperation with other transcription factor Skn7p [21–24]. The Skn7p transcription factor constitutively localizes in the nucleus and regulates both osmotic and oxidative stress response gene expression [23,25]. However, the molecular mechanisms underlying these two regulatory functions differ. Skn7p activity under osmotic stress depends on the phosphorylation of the receiver domain aspartate, D427, by the Sln1p histidine kinase, whereas its activity under oxidative stress depends on serine/threonine (S/T) phosphorylation [23]. Oxidant-dependent Skn7p activation seems to be regulated by Yap1p as the strains lacking the Yap1p transcription factor do not show S/T Skn7p phosphorylation. It has been postulated that the oxidant-dependent phosphorylation of Skn7p is required to produce a strong association with Yap1p and an efficient transcriptional activation of several OSR genes [23]. However, very little is known about the molecular mechanism of Skn7p regulation under oxidative stress conditions [23,24].

The molecular model for oxidative stress regulation is still far from being solved and the role of thioredoxins on regulating Yap1p and Skn7p functions is difficult to assess if based on the phenotypes observed in different mutants, various studied strains and under treatment with distinct oxidant compounds. It is known that the transcriptional response differs for several reactive oxygen species and oxidant doses [11]. In addition, the nuclear localization of Yap1 per se does not ensure good tolerance to oxidative stress. For instance, by affecting the C-terminal region, which contains the nuclear export signal (NES), the constitutive nuclear localization of Yap1p increased tolerance to diamide, but caused hypersensitivity to H₂O₂ [11]. Furthermore, it has been recently published that H₂O₂ and diamide trigger Yap1p nuclear localization differently, therefore they promote distinct antioxidant responses [26]. Further evidence that supports the existence of different antioxidant transcriptional responses yet to be described is that Tsa1p deficiency alters the expression of several Yap1p-targeted genes (TRX2, SOD2, CTT1) in the presence of H₂O₂ without affecting Yap1p nuclear localization [27]. Hence, all these reports suggest that alternative mechanisms for the oxidative stress response still to be described may exist, which coordinate Trx2p, Tsa1p, Yap1p, Skn7p, and other putative regulatory proteins.

Studies into oxidative stress response regulation in S. cerevisiae have been carried out only with laboratory yeast strains mainly at low H₂O₂ doses. However, very little is known about the oxidative stress regulation in natural wine yeast strains, which are much more resistant than laboratory strains. Our wine strains studies done under industrial conditions in molasses medium have shown how the TRX2 gene overexpression (TTRX2) increases biomass yield under respiratory conditions by not only improving the oxidative stress response, but also by preventing protein damages from carbonylation events [7,28,29]. Furthermore, a global transcriptional analysis of wine yeast strain under industrial conditions has demonstrated that TRX2 gene manipulation affects the expression of several oxidative stress response genes during industrial performance [15]. Therefore, the comprehension of the molecular basis of oxidative stress in wine yeasts can help design new strategies to improve industrial processes. However, molasses are complex rich media with an unknown composition, a high sucrose concentration and other carbon sources, which make understanding the participation of Trx2p in oxidative stress response regulation very difficult.

In this study, we analyzed the involvement of Trx2p in the transcriptional response to oxidative stress at high H₂O₂ doses using different carbon source media in natural wine yeasts. We outline that Trx2p is involved mainly in the oxidative stress response under respiratory conditions by modulating Skn7p transcription factor activity by hyper-phosphorylation events to thus regulate the OSR gene expression.

Materials and Methods

Yeast strains and cultivation conditions

All the plasmids and Saccharomyces cerevisiae strains used in this study are described in Tables 1 and 2, respectively. We used the S. cerevisiae natural wine yeast strain T73 (CECT 1894) [30] as a yeast model. This strain has been previously modified to T73ura3∆ [31] to construct other strains (Table 2) given the absence of auxotrophies in natural yeasts. All the modified yeast strains were obtained following the lithium acetate procedure as modified by [32].

Plasmid	Reference
pFA6a-13Myc-KanMX6	(Longtine et al., 1998)
GCRE_GPX2-CYC1_TATA-lacZ	(Tsuzi et al., 2004) From Dr Inoue
YRE_TRX2-CYC1_TATA-lacZ	(Gulshan et al., 2005) From Dr Moye-Rowley

Table 1. Plasmids used in this study.

CSV

Download CSV

Strain	Description	Reference
T73	WT	(Querol et al., 1992)
T73ura3∆	URA3 gene disruption	(Puig et al., 1998)
T73trx2∆	TRX2 gene deletion	(Gómez-Pastor et al., 2012)
T73trx2∆ura3∆	TRX2 gene deletion and URA3 gene disruption	(Gómez-Pastor et al., 2012)
T73-GCRE	GCRE_GPX2-CYC1_TATA-lacZ	This study
trx2∆-GCRE	GCRE_GPX2-CYC1_TATA-lacZ	This study
T73-pCEP12	YRE_TRX2-CYC1_TATA-lacZ	This study
trx2∆-pCEP12	YRE_TRX2-CYC1_TATA-lacZ	This study
T73-SKN7 (myc_13x)^{^a}	SKN7-13Myc KanMX	This study
trx2∆-SKN7 (myc_13x)	SKN7-13Myc KanMX	This study

Table 2. Strains used in this study.

^a myc13x, thirteen copies of the myc epitope tag

CSV

Download CSV

Plasmid YRE_TRX2-CYC1_TATA-lacZ (pCEP12) contains a modified TRX2 promoter regulated by Yap1p [26]. This plasmid was constructed by subcloning the region from -181 to -155 corresponding to the YRE sequence of the TRX2 promoter into BglII-digested p314ClZ containing CYC1_TATA-lacZ [26] for Yap1p promoter recognition. Plasmid GCRE_GPX2-CYC1_TATA-lacZ contains a modified GPX2 promoter regulated by the combined action of Yap1p and Skn7p. This plasmid was constructed using the region from -284 to -269 of the GPX2 promoter, which contains only the GCRE sequence (GC Rich Element) that is essential for Skn7p promoter recognition [33]. The PCR product was subcloned into the XhoI site of pTBA30, which contains CYC1_TATA-lacZ that lacks its original upstream activation site (UAS) [33] for Skn7p-Yap1p recognition. Both plasmids have an URA3 gene as a selectable marker.

To construct the SKN7-(myc_13x) strains, complementary oligonucleotides to the tagging cassette (pFA6a-13Myc-KanMX6) were fused to the 3´end sequence of the target open reading frame with no stop codon (underlined sequence) for C-terminal tagging by PCR (F1;GCAATTACCACAATCTACACTTCAAGAAAACCAGCTATCACGGATCCCCGGGTTAATTAA and R2; GTCCTCTGCTAACTTAGACGCAAGGCTATTTGTAAAATTGAATTCGAGCTCGTTATAAAC), as described by Longtine et al., [34]. The amplified PCR product was used for yeast modification by homologous recombination.

For all experiments, cells were cultivated previously in SD minimal medium (2% glucose, 0.5% ammonium sulfate, 0.15% yeast nitrogen base) and a mixture of amino acids at 30°C, and were then inoculated in YPD (1% yeast extract, 2% bacto-peptone, 2% glucose) or YPG (1% yeast extract, 2% bacto-peptone, 2% glycerol) media. To test sensitivity to different oxidant compounds, cells from an overnight culture were diluted to 1.0 OD₆₀₀ nm and spotted on YPD and YPG plates containing 5 mM H₂O₂, 0.1 mM menadione, 1.2 mM diamide or 16.5% ethanol, and plates were incubated between 3 and 5 days. The oxidative stress experiments in liquid were carried out by adding different H₂O₂ concentrations (range 0.4-5 mM) for 1 h at 30°C to the culture growth in the mid-log phase. Afterward, cells were harvested by centrifugation and frozen in N₂ liquid. For the viability assays, cells were exposed to different H₂O₂ concentrations (0.4-5.0 mM) for 1 h and were then plated onto YPD or YPG medium. The number of viable cells was counted after 2 days at 30°C.

Catalase activity determination

The cell extracts employed for enzymatic determination were prepared using glass beads and were assayed as described for catalase [35]. Catalase activity was assayed spectrophotometrically by adding 10-50 µg of protein sample to 0.2 mL of 50 mM phosphate buffer pH 7.0 and 80 mM H₂O₂. The decrease in absorbance at 240 nm due to H₂O₂ consumption was measured and enzyme activity was calculated using an extinction coefficient of 43.66 M^-1cm^-1. Catalase activity was expressed as µmol of H₂O₂ min^-1 mg of protein^-1 (U mg prot^-1). Three independent experiments were done.

Quantification of lipid peroxidation

Quantification of lipid peroxidation was carried out in a reaction of thiobarbituric acid with the malondialdehide (MDA) product of the oxidized fatty acid breakage [36]. Cells (50 mg) were collected, washed twice with distilled water and then extracted by vortexing with 0.3 g glass beads in 0.5 ml of 50 mM sodium phosphate buffer, pH 6.0, 10% trichloroacetic acid (TCA), in three 1-minute series alternated with a 1-minute incubation on ice. After centrifugation at 13000 rpm for 10 min, 300 µl of the supernatants were mixed to 100 µl of 0.1 M EDTA and 600 µl 1% thiobarbituric acid (Sigma Aldrich Co., St. Louis, MO) in 0.05 M NaOH, which were then incubated at 100°C for 15 min. After cooling on ice and centrifugation to eliminate precipitates, MDA was measured by reading absorbance at 535 nm. The molar absorptivity of MDA (1.56 ×10⁵ M^-1 cm^-1) was used to express the lipid peroxidation levels as pmoles of MDA per mg of cells.

Glutathione determination

Glutathione was determined as previously described [37]. Collected cells (100 mg) were washed twice with phosphate-buffer saline (PBS pH 7.4) and suspended in 1 ml ice-cold 8 mM HCl, 1.3% (w/v) 5-sulphosalicylic acid (Fluka-Chemika, Switzerland). Cells were broken in Fast Prep at 4°C with 0.5 g of glass beads in three series of 30 s alternated with a 1-minute incubation on ice. All material-like tips and Eppendorf tubes were kept cold during glutathione extraction. Cell debris and proteins were pelleted in a microcentrifuge for 15 min (13000 rpm at 4°C), and supernatants were used for glutathione determination. For total glutathione determination, the supernatant was used directly in 200 µl of total volume reaction, while oxidized glutathione (GSSG) determination was carried out in the same volume reaction with 2 µl of 1 M 2-vinyl-piridine (Sigma Aldrich Co., St. Louis, MO, USA) for 1 h at room temperature. All the samples were incubated in the darkness with the enzyme cocktail (glutathione reductase 1.92 U/mL, glucose-6-phosphate dehydrogenase 0.125 mg/mL, NAPDH 16 mg/mL, glucose-6-phosphate 6.4 mg/mL) for 20 min at room temperature and shaking 125 rpm in the presence of 200 µM of 5, 5'-dithio-bis-(2-nitrobenzoic acid). Reduced glutathione level (GSH) was obtained as the difference between total glutathione and oxidized glutathione (GSSG). The positive control samples for total glutathione determination were fortified with different concentrations of GSH. The negative control samples for the GSSG assay were treated with 0.1 mM DTT prior to 2-vinyl-piridine. Finally an aliquot of each sample was treated with only phosphate buffer under the same conditions as described above for glutathione determination and were then used as an internal absorbance control. Data were expressed as the ratio between the GSH/GSSG levels.

Analysis and quantification of mRNA

Total yeast RNA was obtained from yeast cells (50 mg) by two methods. In the antioxidant gene analysis, RNA was obtained by the hot phenol method [38]. For the Heat Shock Proteins (HSPs) mRNA analysis, total RNA was obtained by resuspending cells in LETS buffer (200 mm LiCl, 20 mm EDTA, 20 mm Tris-HCl (pH 8.0), 0.4% SDS), and was transferred to an Eppendorf screw-cap tube containing 0.5 ml of phenol and 0.5 ml of glass beads (acid-washed, 0.4 mm diameter). Equal amounts of RNA (20 µg) were separated in 1% (w/v) agarose gels containing formaldehyde (2.5% v/v) and were transferred to a Hybond nylon membrane (Amersham Biotech, GE Healthcare, Germany). The specific primers for the PCR synthesis of the DNA probes are provided in Table S1. The probes for the antioxidant gene analysis were labeled by random priming (High Prime, Roche Diagnostics, Indianapolis, IN) using [α³²P]-dCTP (Amersham Biotech, GE Healthcare, Germany). For the GLR1, GTT1 and TRX1 genes, further mRNA quantification was performed by a qPCR analysis using RNeasy kit (Quiagen) for RNA extraction. Primers used for qPCR analysis (GTT1-F: GTCCATTGGTTGGCCATTC, GTT1-R: TGCAATATCAGCATCTTCGC, GLR1-F: ATTTTCCCCGAAAACATTCC, GLR1-R: AATTACCAAGTGCGTTTCGG, TRX1-F: AGCGAATTCGACTCTGCAAT, TRX1-R: TTGTGCAACATCACCCAAT). Obtained data was normalized using Actin (ACT1-F: TGTCACCAACTGGGACGATA, ACT1-R: AACCAGCGTAAATTGGAACG) as a control and normalized to control conditions in YPD.

The HSPs analysis probes were labeled with the non-radioactive PCR digoxigenin probe synthesis kit (Roche Diagnostics, Indianapolis, IN). Membrane pre-hybridizations and hybridizations were also performed with Digoxigenin Easy Hyb solution (Roche Diagnostics, Indianapolis, IN). After two stringent washes with 2X SSC (3 M NaCl, 0.3 M sodium citrate) 0.1% (w/v) SDS for 15 min at 65°C and 25°C, respectively, blots were subjected to immunological detection using an anti-digoxigenin antibody conjugated with alkaline phosphatase (Roche Diagnostics, Indianapolis, IN, USA), followed by CDP-Star detection (Roche Diagnostics, Indianapolis, IN). Images were captured with the LAS-1000 Plus imaging system (Fuji, Kyoto, Japan). For the radioactive membranes, images were captured and quantified with an Instant Imager FLA-5000 and the Image Gauge software (FujiFilm, USA). Sample data were normalized in relation to rRNA. An internal control gene was used for the consecutive membrane hybridizations. Gene expression experiments were performed in triplicate.

The β-galactosidase assay

Cells were cultured in YPD or YPG medium until the log phase and were treated with H₂O₂ for 1 h. The cell extracts and assays of β-galactosidase activity were prepared as described by Miller [39]. One unit of activity was defined as the amount of enzyme that increased the OD₄₂₀ by 1000 per hour at 30°C. Protein concentration was determined in a Nanodrop ND-1000 UV/Vis Spectrophotometer.

Western blot analysis of Skn7p phosphorylation

Trichloroacetic acid (TCA) extracts were prepared from the cultures harvested in the log phase and were treated, where indicated, with H₂O₂ (0.4 and 5mM) for 1 h. Cell pellets were frozen and were then disrupted by vortexing in water and glass beads. TCA was added to 20% and 10 cycles of a 30-second vortex and 1-minute incubation on ice were performed. After adding 1 ml ice-cold 5% TCA, samples were centrifuged at high speed for 15 min at 4°C. The protein pellet was washed twice with cold acetone and was allowed to dry at room temperature for 5 min. Protein pellets were resuspended in protein buffer (20 mM HEPES, pH 8.0, 5 mM EDTA, 20% glycerol, 7 mM β-mercaptoethanol, and a mix of protease inhibitors (Roche Diagnostics, Indianapolis, IN, USA). Lambda phosphatase (New England Biolabs Gmbh, Frankfurt, Germany) was added to 100 U and samples were incubated for 30 min at 30°C. When required, 1X Phosphatase inhibitor cocktail 3 (Sigma Aldrich Co., St. Louis, MO) was also added before incubation. Samples were subjected to 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) for 2.5 h at 200 V. Separated proteins were transferred onto PVDF membranes (Amersham Biotech, GE Healthcare, Germany). The Skn7-Myc fusion protein expression was examined by an immunoblot analysis with an anti-Myc antibody [40] followed by a goat anti-mouse secondary antibody (1:2.500; Amersham Biotech, GE Healthcare, Germany). The immune complexes were visualized by chemiluminescence using the Las1000 software (Fujifilm, USA) and the ECL Advance Detection Kit (Amersham Biotech, GE Healthcare, Germany).

Immunoprecipitation

Cell lysates were prepared in Urea buffer (50 mM Tris-HCl [pH 8], 5 mM EDTA, 6 M urea, 1% SDS) and a mixture of commercial proteases (Roche Diagnostics, Indianapolis, IN, USA). Cells were disrupted with glass beads at 4°C. The obtained lysates were cleared by centrifugation and normalized to an equal amount of protein by a DC protein assay (Bio-Rad). Cell lysates were diluted with a 10x volume of immunoprecipitation (IP) buffer (50 mM Tris-HCl [pH 8], 5 mM EDTA, 1% Triton X-100, 150 mM NaCl) and a mixture of protease and phosphatase inhibitors. Lysates were rotated overnight at 4°C with anti-Myc agarose beads (A7470; Sigma). After washing with IP buffer 3 times, beads were incubated with SDS sample buffer for 30 min at 37°C and protein samples were subjected to SDS-PAGE. The antibodies used for the Skn7p post-translational modification analysis were anti-phosphoserine (Abcam, ab9332), anti acetyl-lysine (Biomol SA-440) and anti-sumo1 (Abcam ab32058).

Results

Effects of TRX2 gene manipulation and growth medium on the oxidative stress response

Recent studies have shown that laboratory strains are genetically very distant to any other S. cerevisiae strains and suggest the use of strains from a different source to study yeast physiology [41,42]. Thus we selected T73 for our study, a widely used wine yeast model strain, and we analyzed the effects of TRX2 gene deficiency on the oxidative stress response. We used a defined medium under either fermenting conditions with glucose as a carbon source (YPD) or respiratory conditions in glycerol (YPG).

We tested different oxidative stress conditions in T73 and T73trx2∆ in either YPD or YPG medium (Figure 1). As seen in Figure 1A the absence of TRX2 gene showed no significant differences when compared with the control strain in YPD. In fact, both strains showed high resistance to all the tested conditions in high glucose media. However, when cells were spotted on YPG (Figure 1B) and were grown under respiratory conditions, the absence of the TRX2 gene dramatically increased sensitivity to H₂O₂ and menadione, although no differences in diamide and only a slight decrease in sensitivity to ethanol were observed. Afterward, we focused our experiments on analyzing H₂O₂ toxicity in wine strains as a common oxidant compound. When we analyzed the growth rate in the different carbon source media for 24 h (Figure 1C), we observed that the T73trx2∆ mutant showed similar growth to the control strain in YPD, but that it significantly lowered in YPG medium at 24 h (p = 0.00197). The number of viable cells after a 1-hour exposure to different H₂O₂ concentrations (Figure 1D) also demonstrated that Trx2p deficiency was more important at a high H₂O₂ dose (2.5-5 mM) under respiratory conditions. These results reveal the involvement of Trx2p in the oxidative stress response in wine yeasts under respiratory conditions at a high H₂O₂ dose.

Download:

Figure 1. Comparison of the sensitivity of strains T73 and T73trx2Δ to different stressful conditions.

Growth of strains T73 and T73trx2∆ indicated on YPD (A) or YPG plates (B) containing no chemicals as a control, 5 mM H₂O₂, 0.1 mM menadione, 1.2 diamide, 16.5 % ethanol. For each strain, 5 µL of the overnight culture diluted to 1.0 OD_600nm units and seven subsequent dilutions (10^-1 dilution factor) were spotted on plates. Growth was monitored after 2 days for YPD plates and 3 days for YPG plates. (C) The growth rate for strains T73 and T73trx2∆ over 25 h in distinct carbon source media. (D) Viable cells after 1 h exposure to different H₂O₂ doses in various media. Three independent experiments were carried in all conditions.

https://doi.org/10.1371/journal.pone.0085404.g001

To test the effect of Trx2p deficiency on the cellular redox state, we analyzed some oxidative-stress biochemical markers, such as catalase activity, lipid peroxidation and the glutathione levels in the exponentially grown cells of strains T73 and T73trx2∆ after exposure to 5 mM H₂O₂ for 60 min (Table 3). The results obtained in YPD medium revealed that catalase activity was greater in the T73trx2∆ strain than in the T73 strain. After H₂O₂ addition, catalase activity increased in both strains, but was significantly higher in T73trx2∆ than in T73. Conversely, catalase activity in YPG medium was significantly lower in T73trx2∆ than in T73 after H₂O₂ addition, which could explain the deficiency in growth rate observed for T73trx2∆ under fermenting conditions. However no significant differences were observed in the lipid peroxidation levels and the GSH/GSSG ratio under either the control or stressful conditions in any carbon source media.

	Catalase activity (U/mg prot)		Lipid peroxidation (pmol/mg prot)		Ratio GSH/GSSG
	T73	T73trx2∆	T73	T73trx2∆	T73	T73trx2∆
YPD
Control	5.12±0.85	7.12±0.85 *	12.21±0.29	11.85±0.52	55.1±5.2	48.3±4.1
H₂O₂	6.60±0.86	10.18±1.7 *	17.60±2.68	21.19±0.48	31.0±5.4	23.1±6.2
YPG
Control	93.17±5.27	86.91±6.52*	3.15±0.69	3.48±0.35	17.5±2.3	15.2±1.7
H₂O₂	107.99±5.13	79.59±4.51*	11.36±1.94	10.92±2.46	15.0±2.1	14.3±4.4

Table 3. Biochemical redox parameters for wine yeast strains.

Experiments were carried out in triplicate and presented error corresponds to SD. Statistical analyses were performed using a Student´s t-test between samples in the same growth media, YPD or YPG (* p< 0.05).

CSV

Download CSV

Expression of the Yap1p-Skn7p-regulated antioxidant genes is dependent on the presence of TRX2 under respiratory conditions

It has been reported for laboratory yeast strains that thioredoxins are negative regulators of the main antioxidant transcription factor Yap1p as it is constitutively active in the double mutant trx1∆trx2∆ [8]. However, the absence of one thioredoxin does not seem to alter the gene expression in laboratory yeast strains, although it does in a T73trx2∆ strain under industrial propagation conditions in molasses medium [15]. In addition, very little is known about the regulatory mechanisms controlling other important transcription factors like Skn7p, which co-operate with Yap1p to better respond to oxidative stress. Thus, we evaluated the influence of TRX2 gene manipulation on the expression of a set of selected antioxidant genes regulated by either Yap1 or the co-operation between Yap1 and Skn7 under oxidative stress conditions using different carbon source media. Quantification of the mRNA levels from the northern signals (Figure S1) of three independent experiments is shown in Figure 2. We selected a set of genes belonging to the glutathione-glutaredoxin system (GSH1, GLR1, GTT1 and GRX5), to the thioredoxin system (TRX1, TRX2, TRR1 and TSA1) and other gene coding for the antioxidant enzyme superoxide dismutase, SOD2. Among all the selected genes, some were regulated by Yap1p alone (GLR1, GTT1 and TRX1) and others jointly by Yap1p and Skn7p (GSH1, TSA1, TRR1, TRX2 and SOD2), as previously described [21,22,43].

Download:

Figure 2. Antioxidant gene expression levels in strains T73 and T73trx2∆ cultured in YPD or YPG medium to the mid-log phase and treated with 5 mM H₂O₂ for 60 min.

The relative expression levels of each antioxidant gene were quantified from the Northern image analysis using the Image Gauge software (FujiFilm, USA). The data for each gene were normalized to the rRNA levels. Experiments were carried out in triplicate and the error bars corresponding to SD are shown. Statistical analyses were performed using a Student´s t-test between samples in the same growth media, YPD or YPG (* p< 0.05, ** p< 0.01). The Yap1p and the Yap1p-Skn7p-dependent gene groups were formed according to the previously described information [21, 22, 43] and from the Yeastract web site (http://www.yeastract.com).

https://doi.org/10.1371/journal.pone.0085404.g002

Figure 2A shows the mRNA expression levels for the Yap1p-dependent genes for strains T73 and T73trx2∆. We observed that strain T73trx2∆ displayed significantly higher expression levels for GTT1 and TRX1 in YPG medium after exposure to 5 mM H₂O₂, but no differences were observed in YPD as compared with the control strain. The gene expression for GTT1, GLR1 and TRX1 was validated by a qPCR analysis, which obtained similar results (Figure S2). These data indicate that the absence of Trx2p can activate Yap1p-dependent genes, but only under respiratory conditions and in the presence of H₂O₂, and then that Trx2p might be involved in negative regulation of Yap1p activity under those conditions.

When we analyzed the expression levels for the Yap1p-Skn7p-dependent genes (Figure 2B), we observed the opposite effect as T73trx2∆ showed a significant decrease in the mRNA expression levels for genes TRR1, TSA1 and GSH1 in YPG medium plus H₂O₂. In addition, the putative Yap1p and Skn7p-dependent GRX5 gene expression also significantly lowered in T73trx2∆ under all the tested conditions (Figure 2C). All these results suggest an involvement of Trx2p in Skn7p regulation activity, especially under respiratory conditions.

Trx2p is involved in the promoter regulation by the Skn7p transcription factor

To study the involvement of TRX2 in Skn7p-mediated transcriptional regulation, we used two different plasmid constructs (Figure 3A and 3B), both containing the URA3 auxotrophic marker. Plasmid YRE_TRX2-CYC1_TATA-lacZ (pCEP12) contains a modified TRX2 promoter regulated by Yap1p, whereas plasmid GCRE_GPX2-CYC1_TATA-lacZ contains a modified GPX2 promoter regulated by the combined action of Yap1p and Skn7p.

Download:

Figure 3. Promoter regulation by the Yap1p and Skn7p transcriptional factors in strains T73 and T73trx2∆.

(A) The cells carrying the depicted modification of the TRX2 promoter fused to the LacZ vector construction (T73-YRE and T73trx2∆-YRE) for Yap1p recognition or (B) the cells carrying the depicted modification of the GPX2 promoter fused to the LacZ vector construction (T73-GCRE and T73 trx2∆-GCRE) for Yap1p-Skn7p recognition were cultured in YPD (C, D) or YPG medium (E, F) until the mid-log phase and were treated with different H₂O₂ concentrations (0.4, 1, 2.5 and 5 mM) for 60 min. Experiments were carried out using three biological replicates and the error bars corresponding to SD are shown. Statistical analyses were performed using a Student´s t-test between samples in the same growth media, YPD or YPG (* p< 0.05, ** p< 0.01).

https://doi.org/10.1371/journal.pone.0085404.g003

Strains T73ura3∆ and T73trx2∆ura3∆ were transformed with both plasmids separately to give strains T73-YRE and T73-GCRE, and strains T73trx2∆-YRE and T73trx2∆-GCRE. The cells from these strains were exponentially grown in YPD and YPG media at different H₂O₂ concentrations ranging from 0.4 to 5 mM. β-galactosidase activity was assayed after a 1-hour stress exposure. For the Yap1p-dependent promoter using the YRE_TRX2-CYC1_TATA-lacZ construction, we did not observe any significant differences in β-galactosidase activity between strains T73 and T73trx2∆ under either the YPD or YPG conditions (Figure 3C and 3E). However, when we analyzed the Yap1p-Skn7p-dependent promoter using the GCRE_GPX2-CYC1_TATA-lacZ construction, we observed a significant decrease in the β-galactosidase levels for strain T73trx2∆ as compared with the control strain in both growth media. Nevertheless, differences were much greater in YPG medium (Figure 3D and 3F) due to the strong induction of the GCRE promoter caused by growth on glycerol in strain T73 (Figure S3). In order to validate the involvement of Trx2p in the promoter regulation by Skn7p, we did similar experiments using the laboratory BY4741 and BY4741trx2∆ strains transformed with the above-described constructions to obtain identical results (Figure S4). All together, these results demonstrate that the absence of the TRX2 gene negatively affects the activation of the Yap1p-Skn7p-dependent promoter, but not the Yap1p-dependent promoters, and they suggest a new relationship between Trx2p and Skn7p activity.

The Skn7p-dependent heat shock gene expression under oxidative stress is affected by the absence of TRX2

It has been described that Skn7p is required for the full induction of the heat shock gene expression by hydrogen peroxide since the skn7∆ mutation significantly lowers the mRNA level for several heat shock proteins, such as Hsp12p, Hsp26p, Hsp70p and Hsp104p, thus aggravating oxidative stress [44]. In order to check whether TRX2 gene deficiency affects Skn7p activity under oxidative stress or not, we analyzed the mRNA expression levels of HSP70, HSP26, HSP12 and HSP104 in the TRX2 gene-modified wine strain under the same growth and stress conditions as in the previous experiments (Figure 4 and Figure S5). All the genes exhibited a significantly increased expression at 5 mM H₂O₂ in control strain T73, with the highest expression levels noted in YPG medium. In the T73trx2∆ mutant, the expression level of HSP70 was significantly reduced in both the growth media plus H₂O₂ if compared with the T73 control strain, while other heat shock proteins, like HSP12, HSP26 and HSP104, also significantly decreased in the T73trx2∆ mutant in YPG medium after H₂O₂ exposure.

Download:

Figure 4. The expression analysis of the heat shock protein genes after exposure to oxidative stress conditions.

(A) Northern blot analysis of HSP12, HSP26, HSP70 and HSP104 in strains T73 and T73trx2∆ grown on YPD or YPG to the mid-log phase and treated with 5 mM H₂O₂ for 60 min. (B) Relative expression levels were quantified by an image analysis. The data for each gene were normalized to the expression levels of the control strain in YPD medium under non stressed conditions. Three independent experiments were carried and the error bars corresponding to SD are shown. Statistical analyses were performed using a Student´s t-test between samples in the same growth media, YPD or YPG (* p< 0.05, ** p< 0.01).

https://doi.org/10.1371/journal.pone.0085404.g004

These results indicate that the absence of the TRX2 gene negatively affects the induction of other Skn7-dependent genes under oxidative stress conditions, similarly to the phenotype of the skn7∆ mutant [44]. Therefore, Trx2p may play a role in Skn7p activity regulation.

Thioredoxin deficiency increases Skn7p phosphorylation under oxidative stress

It has been recently described that the Skn7p transcription factor is specifically phosphorylated under oxidative stress conditions, which facilitates and stabilizes its interaction with Yap1p during the antioxidant gene expression [23]. However, very little is known about the regulatory mechanism controlling Skn7p phosphorylation and transcriptional activation.

To investigate the putative role of thioredoxin II in Skn7p activity regulation, we analyzed the phosphorylation event on this transcription factor in strains T73 and T73trx2∆. We constructed a Skn7p-(myc_13x) tagged variant by genome integration to analyze Skn7p phosphorylation at low and high H₂O₂ doses in strains T73 and T73trx2∆ (Figure 5). The loading controls for the gels in Figure 5 are shown in Figure S6. We initially confirmed Skn7p phosphorylation by observing an electrophoretic shift in the Skn7p band after 0.4 mM hydrogen peroxide treatment in the T73-SKN7(myc_13x) strain (Figure 5A), as previously described for laboratory yeast [23]. The Skn7p band displayed a poorer mobility shift when samples were treated with 100 U of λ phosphatase for 30 min at 30°C. The protein shift observed at 0.4 mM H₂O₂ was maintained when the sample was treated with λ phosphatase in the presence of phosphatase inhibitors (Figure 5A). All together, these findings demonstrate that the Skn7p electrophoretic mobility shift corresponds to protein phosphorylation. A similar Skn7p phosphorylation pattern was observed between YPD and YPG medium for the T73 strain using 0.4 and 5 mM H₂O₂ (Figure 5B). Yet the Skn7p band corresponding to the cells growing in glycerol without H₂O₂ treatment was already retarded if compared to the growth on glucose, which is likely due to endogenous ROS generation by a respiratory metabolism that increases the phosphorylation state of Skn7p as a result of stressful conditions. Despite this phenomenon, Skn7p phosphorylation increased in both growth media when increasing the H₂O₂ dose, although phosphorylation was higher in YPG than in YPD.

Download:

Figure 5. The Skn7p phosphorylation pattern after exposure to different H₂O₂ concentrations.

(A) Cells from the T73-SKN7 (myc_13x) control strain grown in YPD medium until the mid-log phase were exposed to 0.4 mM for 60 min. Lambda phosphatase (Ph) and phosphatase inhibitors (Iph) were added to the protein extracts as indicated and samples were incubated for 30 min at 30°C, following the manufacturer´s recommendations. Skn7p-myc western blotting was performed after protein separation in 8% SDS-PAGE. (B) The T73-SKN7 (myc_13x) strain was cultivated in YPD and YPG medium until the mid-log phase and cells were exposed to 0 (-), 0.4 mM (+) and 5 mM (++) H₂O₂ for 1 h. (C and D) The Skn7p phosphorylation pattern in the TRX2 gene-modified strain under oxidative stress, 0.4 mM and 5 mM H₂O₂ for 60 min. (D) The protein extracts from the cells grown on YPD and exposed to 0.4 mM H₂O₂ for 1 h were treated with lambda-phosphatase, as indicated. (E) Analysis of the different post-transcriptional modifications using Skn7-Myc-tagged immunoprecipitation. Cells were cultivated in YPD medium and 0.4 mM H₂O₂ was added for 1 h. Representative experiments from five replicates are shown. A dashed gray line was added to the figure based on the migration of the untreated wild-type samples for each analyzed gel.

https://doi.org/10.1371/journal.pone.0085404.g005

Figure 5C shows the Skn7p phosphorylation state at different H₂O₂ doses in strains T73 and T73trx2∆ in YPD and YPG media. As seen in the representative experiment of three independent replicates, the electrophoretic shift of Skn7p was greater in the T73trx2∆ mutant than in the control strain, especially in the presence of 5 mM H₂O₂ in both growth media. We also observed that Skn7p showed retarded migration in the trx2∆ mutant and that it grew in both media without H₂O₂ treatment when compared with the T73 wild type, which is likely due to a higher level of endogenous oxidative stress as a result of thioredoxin II being absent. These results indicate that the Skn7p phosphorylation state might be affected by both the fermentative or respiratory metabolism and by Trx2p, thus altering the antioxidant transcriptional response. Figure 5D illustrates increased Skn7p mobility after λ phosphatase treatment in both strains, indicating that the Skn7p mobility shift in the modified strain was due, at least in part, to protein phosphorylation. To better demonstrate that the altered Skn7p electrophoretic mobility in the T73trx2∆ mutant was due to phosphorylation events, we immunoprecipitated the Skn7 13xMyc-tagged protein using anti-Myc agarose beads and probed for several post-translational modifications (PTMs) (Figure 5E). The anti-acetyl-lysine blot showed that the samples treated with H₂O₂ decreased Skn7p acetyl-lysine levels, suggesting a possible role in Skn7p activation, but no differences were observed between the T73 and T73trx2∆ mutant strains. Another PTM that can affect electrophoretic mobility is sumoylation, which has been shown to play important roles in protein activity and stability. However no differences were observed in the sumoylation state between the analyzed samples. Finally we probed for the phosphor-serine levels and we observed that the T73trx2∆ mutant showed higher Ser phosphorylation levels than the control strain.

All these results suggest that phosphorylation, and possibly other post-translational modifications still to be tested, regulate Skn7p activity under oxidative stress caused by exogenous H₂O₂ addition, and that thioredoxins modulate this phenomenon. These regulatory modifications in Skn7p are also dependent on the fermentative or respiratory metabolic state, which reinforces the relevance of this transcriptional factor under different oxidative stresses. In addition, these results also indicate an inverse correlation between the increased Skn7p phosphorylation levels in the T73trx2∆ mutant and the lower expression of the Yap1p-Skn7p-regulated antioxidant genes.

Discussion

Wine Saccharomyces cerevisiae strains, adapted to anaerobic must fermentations, undergo oxidative stress when grown under aerobic conditions, especially during biomass propagation in the industrial active dry yeast (ADY) production process [28,45]. The problem lies in that the oxidative metabolism of sugars favors high biomass yields, but also causes increased oxidative damage of cell components. The importance of the TRX2 gene in the oxidative stress response under industrial conditions has been evidenced by the improved phenotype of a wine yeast strain overexpressing the TRX2 gene [7,29]. Thus, the comprehension of the regulatory mechanisms controlling the oxidative stress response in wine yeasts under aerobic conditions can be used as a potential biotechnology improvement tool.

In this study, we have analyzed the biochemical, transcriptional and post-translational effects of TRX2 gene deficiency on the oxidative stress response, especially at high H₂O₂ doses, and its dependence on the different carbon source media in natural wine yeasts. Our results reveal that wine yeasts are more resistant to several oxidant compounds under fermenting conditions than under respiratory conditions, which contrasts with previous data for lab yeasts [46,47]. These results can be explained by the ¨domestication¨ and adaptation of wine yeast to the fermentative metabolism of sugars over centuries, which has made them more resistant to different stresses under fermenting conditions [45,48]. Thus the specific study of the oxidative stress response in industrial yeasts is necessary.

We observe that the absence of Trx2p causes growth defects only under respiratory metabolism, showing increased sensitivity to H₂O₂ under these conditions. Studies using glucose as a carbon source with the individual and double mutants of thioredoxins have shown that Trx2p accordingly plays a more important role than Trx1p, which indicates that the two thioredoxins do not perform overlapping functions exactly [6,49]. Our results demonstrate that Trx2p is essential only for the wine yeasts growing on glycerol. This effect has also been observed for other antioxidant defenses which are significantly influenced by the growth medium used for the experiments done [47]. When we analyzed different redox parameters, unexpectedly we did not observe any significant differences in either lipid peroxidation or the GSH/GSSG ratio, as previously shown for the W303trx2∆ lab strain [5], but we noted lower catalase levels in YPG after hydrogen peroxide exposure, which can be related directly to growth defects and stress sensitivity [35].

Although the biochemical parameters did not undergo major modifications in the T73trx2∆ strain, we searched for a differential antioxidant transcriptional response based on our previous work. We show that TRX2 deficiency alters several oxidative stress-related genes under industrial propagation conditions [15]. As thioredoxins have been postulated to be the negative regulators of the Yap1p function [8,9], we went on to analyze the expression levels of several oxidative stress-related genes regulated by Yap1p, as well as others regulated by the cooperation between Yap1p and Skn7p [21,22]. We selected these genes to correlate variations in their expression levels with increased stress sensitivity under aerobic conditions. Laboratory strains are genetically very distant to any other S. cerevisiae strains [41,42], and this genetic distance and the complexity of Yap1p and Skn7p gene regulation suggest the need to study other S. cerevisiae strains from different sources to completely understand oxidative stress regulation.

The expression analyses in the T73 control strain showed that only the genes belonging to the thioredoxin system (TRX1, TRX2 and TRR1) are significantly induced under 5 mM H₂O₂ under high glucose conditions, whereas a broader and more intense response in several genes is produced by this same treatment under respiratory growth conditions. Interestingly when we analyzed the antioxidant gene expression levels for the T73trx2∆ strain in YPD and YPG medium, we generally observed significant differences in gene expression only under respiratory conditions. We noted the up-regulation of the Yap1p- dependent genes after hydrogen peroxide treatment, which correlates with the Yap1 negative regulation by thioredoxins [8]. We also saw a down-regulation of the antioxidant genes regulated by the cooperation between Yap1p and Skn7p (such as GSH1, TSA1 and TRR1) and putative Yap1p and Skn7p-dependent gene GRX5 (www.yeastract.com). These results suggest a relationship between Trx2p and the Skn7p transcription factor, which are supported by the fact that although a W303skn7∆ mutant does not show increased TRX2 gene expression after hydrogen peroxide exposure, it does in a yap1∆ mutant [50].

The analysis of the Yap1p and Skn7p-dependent promoters regulation by β-galactosidase assays clearly demonstrates Skn7p-dependent promoter activation is affected by the TRX2 gene in wine strains. In contrast, the Yap1p-dependent promoter activation by the β-galactosidase assays does not vary in the absence of TRX2 in natural yeasts, but the Yap1p-dependent genes are up-regulated by the Northern blot experiments. These results suggest another putative mechanism to activate the oxidative stress response in S. cerevisiae at a high H₂O₂ dose, one that is not exclusively related to Yap1p. This hypothesis is also supported by the fact that the activated expression of TRX2 is observed under oxidative stress conditions in a skn7∆yap1∆ mutant [21], suggesting the existence of another minor induction mechanism.

The involvement of Trx2p in the regulation of Skn7p transcription factor activity is reinforced by the negative effect of TRX2 deletion on the expression of several heat shock protein genes like HSP70, HSP12, HSP26 and HSP104. They are induced mainly by the Heat Shock Factor (Hsf1p) under heat shock stress, but are regulated by Skn7p under oxidative stress conditions [44]. Our T73trx2∆ strain data demonstrate similar defects on the HSPs expression levels after oxidative stress to those observed in a skn7∆ mutant [44].

We finally demonstrate that Trx2p regulates Skn7p phosphorylation events, and therefore modulates Skn7p-dependent promoter activation. It has been recently demonstrated that the Ser/Thr phosphorylation of Skn7p is required for the antioxidant gene activation and strong interaction with Yap1p [23,24], which is also phosphorylated inside the nucleus [10]. In fact, Skn7p phosphorylation requires the presence of Yap1p because a yap1∆ mutant does not show oxidant-dependent Skn7p phosphorylation [23]. In addition, it has been postulated that Skn7p can be regulated by the Ras/PKA and MAPK pathway under oxidative stress conditions [51]. However, very little is known about the components involved in oxidant-dependent Skn7p phosphorylation. We report that transcription factor Skn7p is hyperphosphorylated in the T73trx2∆ strain after H₂O₂ exposure. Hyperphosphorylation might cause Skn7p inactivation as the down-regulation of Yap1p-Skn7p-regulated genes and no activation of the Skn7p-dependent promoter in β-galactosidase assays were observed for the T73trx2∆ mutant. There are several putative residues in Skn7p than can participate in phosphorylation activation, such as T437, T449, I428 and V429 [23], and it is possible that different phosphorylation states of important residues can positively or negatively regulate Skn7p activity. Therefore, it is feasible that Trx2p can indirectly modulate the Skn7p phosphorylation state by regulating other components, like the kinases/phosphatases involved in the MAPK cascade and oxidative stress response. Interestingly, it has been described that thioredoxin modulates mammalian ASK1 kinase activity by non-covalent interactions to then participate in the regulation of the apoptosis signal [52]. Further evidence that thioredoxin regulates other protein activities is that TRX2 manipulation directly affects PAPS [13], ribonucleotide reductase [14] and hexokinase II [15].

All together, these results match a tentative regulatory model where Trx2p acts not only via its oxidoreductase activity on Yap1p in regulating the response to hydrogen peroxide dose, but it can also be a novel Skn7p modulator by regulating its phosphorylation state. Thus, Trx2p may perform dual functions in controlling oxidative stress response by negatively regulating Yap1p and positively modulating Skn7p activity. However, very little is known about the complex molecular response to oxidative stress in yeast, and Skn7p activity regulation by Trx2p is a mechanism that merits further research.

Conclusions

This study demonstrates the involvement of Trx2p in oxidative stress response regulation on wine yeasts under respiring conditions. TRX2 gene deficiency increases H₂O₂ sensitivity, causes the down-regulation of the Yap1p-Skn7p-dependent genes and produces Skn7p hyperphosphorylation. Based on these results, we propose Trx2p to be a novel regulator of the oxidant-dependent Skn7p phosphorylation by hydrogen peroxide in wine yeasts.

Supporting Information

Figure S1.

The antioxidant genes in the wild-type T73- and TRX2-modified strains exposed to oxidative stress.Northern blot analysis of the RNA isolated by the hot acid method from yeast strains T73 and T73trx2∆ grown on YPD or YPG to the mid-log phase, and treated for 60 min with 5 mM H₂O₂. The Yap1p and the Yap1p-Skn7p-dependent gene groups were formed following the previously described information [21, 22, 43] and from the Yeastract web site (http://www.yeastract.com). Three independent experiments were carried out for each analyzed gene and one representative experiment is shown.

https://doi.org/10.1371/journal.pone.0085404.s001

(TIF)

Figure S2.

mRNA expression levels of GLR1, GTT1 and TRX1 by qPCR analysis in YPD and YPG medium and under the presence of 5 mM H₂O₂ for 1 h. Expression levels were normalized using actin gene expression as control and normalized to control conditions in YPD medium. One representative experiment was analyzed by qPCR using three technical replicates.

https://doi.org/10.1371/journal.pone.0085404.s002

(TIF)

Figure S3.

(A) GPX2 gene expression analysis by Northern blot experiments in the T73 and T73trx2∆ grown on YPD or YPG to the mid-log phase, and treated for 60 min with 5 mM H₂O₂. (B) mRNA quantification by an image analysis from one representative experiment.

https://doi.org/10.1371/journal.pone.0085404.s003

(TIF)

Figure S4.

Promoter regulation by the Yap1p and Skn7p transcriptional factors in strains BY and BYtrx2∆. (A) The cells carrying the depicted modification of the TRX2 promoter fused to the LacZ vector construction (BY-YRE and BYtrx2∆-YRE) for Yap1p recognition or (B) the cells carrying the depicted modification of the GPX2 promoter fused to the LacZ vector construction (BY-GCRE and by BYtrx2∆-GCRE) for Yap1p-Skn7p recognition were cultured in YPD (C, E) or YPG medium (D, F) until the mid-log phase and were treated with different H₂O₂ concentrations (0.4, 1, 2.5 and 5 mM) for 60 min. Three independent experiments were carried out and the error bars corresponding to SD are shown.

https://doi.org/10.1371/journal.pone.0085404.s004

(TIF)

Figure S5.

The HSPs genes in the wild-type T73- and TRX2-modified strains exposed to oxidative stress. Northern blot analysis of the RNA isolated by the hot acid method from yeast strains T73 and T73trx2∆ grown on YPD or YPG to the mid-log phase, and treated for 60 min with 5 mM H₂O₂. One representative experiment from three independent experiments is shown.

https://doi.org/10.1371/journal.pone.0085404.s005

(TIF)

Figure S6.

Loading controls from Figure 5. Membranes were stained with Coomassie blue to demonstrate a similar migration pattern in the total protein load.

https://doi.org/10.1371/journal.pone.0085404.s006

(TIF)

Table S1.

Genes and primers used for the amplification of DNA probes.

https://doi.org/10.1371/journal.pone.0085404.s007

(DOC)

Author Contributions

Conceived and designed the experiments: RG-P EG RP-T EM. Performed the experiments: RG-P EG RP-T. Analyzed the data: RG-P EG RP-T EM. Contributed reagents/materials/analysis tools: RG-P EG RP-T EM. Wrote the manuscript: RG-P EG RP-T EM.

References

1. Holmgren A (1989) Thioredoxin and glutaredoxin systems. J Biol Chem 264: 13963-13966. PubMed: 2668278.
- View Article
- Google Scholar
2. Kuge S, Jones N (1994) YAP1 dependent activation of TRX2 is essential for the response of Saccharomyces cerevisiae to oxidative stress by hydroperoxides. EMBO J 13: 655-664. PubMed: 8313910.
- View Article
- Google Scholar
3. Fernandes L, Rodrigues-Pousada C, Struhl K (1997) Yap, a novel family of eight bZIP proteins in Saccharomyces cerevisiae with distinct biological functions. Mol Cell Biol 17: 6982-6993. PubMed: 9372930.
- View Article
- Google Scholar
4. Godon C, Lagniel G, Lee J, Buhler JM, Kieffer S et al. (1998) The H₂O₂ stimulon in Saccharomyces cerevisiae. J Biol Chem 273: 22480-22489. doi:https://doi.org/10.1074/jbc.273.35.22480. PubMed: 9712873.
- View Article
- Google Scholar
5. Drakulic T, Temple MD, Guido R, Jarolim S, Breitenbach M et al. (2005) Involvement of oxidative stress response genes in redox homeostasis, the level of reactive oxygen species, and ageing in Saccharomyces cerevisiae. FEMS Yeast Res 5: 1215-1228. doi:https://doi.org/10.1016/j.femsyr.2005.06.001. PubMed: 16087409.
- View Article
- Google Scholar
6. Trotter EW, Grant CM (2002) Thioredoxins are required for protection against a reductive stress in the yeast Saccharomyces cerevisiae. Mol Microbiol 46: 869-878. doi:https://doi.org/10.1046/j.1365-2958.2002.03216.x. PubMed: 12410842.
- View Article
- Google Scholar
7. Gómez-Pastor R, Pérez-Torrado R, Cabiscol E, Ros J, Matallana E (2012) Engineered Trx2p industrial yeast strain protects glycolysis and fermentation proteins from oxidative carbonylation during biomass propagation. Microb Cell Fact 11: 4-19. doi:https://doi.org/10.1186/1475-2859-11-4. PubMed: 22230188.
- View Article
- Google Scholar
8. Izawa S, Maeda K, Sugiyama K, Mano J, Inoue Y et al. (1999) Thioredoxin deficiency causes the constitutive activation of Yap1, an AP-1-like transcription factor in Saccharomyces cerevisiae. J Biol Chem 274: 28459-28465. doi:https://doi.org/10.1074/jbc.274.40.28459. PubMed: 10497208.
- View Article
- Google Scholar
9. Wood MJ, Storz G, Tjandra N (2004) Structural basis for redox regulation of Yap1 transcription factor localization. Nature 430: 917-921. doi:https://doi.org/10.1038/nature02790. PubMed: 15318225.
- View Article
- Google Scholar
10. Delaunay A, Isnard AD, Toledano MB (2000) H2O2 sensing through oxidation of the Yap1 transcription factor. EMBO J 19: 5157-5166. doi:https://doi.org/10.1093/emboj/19.19.5157. PubMed: 11013218.
- View Article
- Google Scholar
11. Temple MD, Perrone GG, Dawes IW (2005) Complex cellular responses to reactive oxygen species. Trends Cell Biol 15: 319-326. doi:https://doi.org/10.1016/j.tcb.2005.04.003. PubMed: 15953550.
- View Article
- Google Scholar
12. Mason JT, Kim SK, Knaff DB, Wood MJ (2006) Thermodynamic basis for redox regulation of the Yap1 signal transduction pathway. Biochemistry 45: 13409-13417. doi:https://doi.org/10.1021/bi061136y. PubMed: 17087494.
- View Article
- Google Scholar
13. Muller EG (1991) Thioredoxin deficiency in yeast prolongs S phase and shortens the G1 interval of the cell cycle. J Biol Chem 266: 9194-9202. PubMed: 2026619.
- View Article
- Google Scholar
14. Koc A, Mathews CK, Wheeler LJ, Gross MK, Merrill GK (2006) Thioredoxin is required for deoxyribonucleotide pool maintenance during S phase. J Biol Chem 281: 15058-15063. doi:https://doi.org/10.1074/jbc.M601968200. PubMed: 16574642.
- View Article
- Google Scholar
15. Gómez-Pastor R, Pérez-Torrado R, Matallana E (2012) Modification of the TRX2 gene dose in Saccharomyces cerevisiae affects hexokinase 2 gene regulation during wine yeast biomass production. Appl Microbiol Biotechnol 94: 773-787. doi:https://doi.org/10.1007/s00253-011-3738-9. PubMed: 22223102.
- View Article
- Google Scholar
16. Kumar JK, Tabor S, Richardson CC (2004) Proteomic analysis of thioredoxin-targeted proteins in Escherichia coli. Proc Natl Acad Sci U S A 101: 3759-3764. doi:https://doi.org/10.1073/pnas.0308701101. PubMed: 15004283.
- View Article
- Google Scholar
17. Montrichard F, Alkhalfioui F, Yano H, Vensel WH, Hurkman WJ et al. (2009) Thioredoxin targets in plants: the first 30 years. J Proteomics 72: 452-474. doi:https://doi.org/10.1016/j.jprot.2008.12.002. PubMed: 19135183.
- View Article
- Google Scholar
18. Kuge S, Jones N, Nomoto A (1997) Regulation of yAP-1 nuclear localization in response to oxidative stress. EMBO J 16: 1710-1720. doi:https://doi.org/10.1093/emboj/16.7.1710. PubMed: 9130715.
- View Article
- Google Scholar
19. Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB et al. (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol Cell 11: 4241-4257. doi:https://doi.org/10.1091/mbc.11.12.4241. PubMed: 11102521.
- View Article
- Google Scholar
20. Moye-Rowley WS (2002) Transcription factors regulating the response to oxidative stress in yeast. Antioxid Redox Signal 4: 123-140. doi:https://doi.org/10.1089/152308602753625915. PubMed: 11970849.
- View Article
- Google Scholar
21. Morgan BA, Banks GR, Toone WM, Raitt D, Kuge S et al. (1997) The Skn7 response regulator controls gene expression in the oxidative stress response of the budding yeast Saccharomyces cerevisiae. EMBO J 16: 1035-1044. doi:https://doi.org/10.1093/emboj/16.5.1035. PubMed: 9118942.
- View Article
- Google Scholar
22. Lee J, Godon C, Lagniel G, Spector D, Garin J et al. (1999) Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J Biol Chem 274: 16040-16046. doi:https://doi.org/10.1074/jbc.274.23.16040. PubMed: 10347154.
- View Article
- Google Scholar
23. He XJ, Mulford KE, Fassler JS (2009) Oxidative stress function of the Saccharomyces cerevisiae Skn7 receiver domain. Eukaryot Cell 8: 768-778. doi:https://doi.org/10.1128/EC.00021-09. PubMed: 19304952.
- View Article
- Google Scholar
24. Mulford KE, Fassler JS (2011) Association of the Skn7 and Yap1 transcription factors in the Saccharomyces cerevisiae oxidative stress response. Eukaryot Cell 10: 761-769. doi:https://doi.org/10.1128/EC.00328-10. PubMed: 21478431.
- View Article
- Google Scholar
25. Lu JM, Deschenes RJ, Fassler JS (2003) Saccharomyces cerevisiae histidine phosphotransferase Ypd1p shuttles between the nucleus and cytoplasm for SLN1-dependent phosphorylation of Ssk1p and Skn7p. Eukaryot Cell 2: 1304-1314. doi:https://doi.org/10.1128/EC.2.6.1304-1314.2003. PubMed: 14665464.
- View Article
- Google Scholar
26. Gulshan K, Lee SS, Moye-Rowley WS (2011) Differential Oxidant Tolerance Determined by the Key Transcription Factor Yap1 Is Controlled by Levels of the Yap1-binding Protein Ybp1. J Biol Chem286: 34071-34081. doi:https://doi.org/10.1074/jbc.M111.251298. PubMed: 21844193.
- View Article
- Google Scholar
27. Demasi AP, Pereira GA, Netto LE (2006) Yeast oxidative stress response. Influences of cytosolic thioredoxin peroxidase I and of the mitochondrial functional state. FEBS J 273: 805-816. doi:https://doi.org/10.1111/j.1742-4658.2006.05116.x. PubMed: 16441666.
- View Article
- Google Scholar
28. Pérez-Torrado R, Gómez-Pastor R, Larsson C, Matallana E (2009) Fermentative capacity of dry active wine yeast requires a specific oxidative stress response during industrial biomass growth. Appl Microbiol Biotechnol 81: 951-960. doi:https://doi.org/10.1007/s00253-008-1722-9. PubMed: 18836715.
- View Article
- Google Scholar
29. Gómez-Pastor R, Pérez-Torrado R, Cabiscol E, Ros J, Matallana E (2010a) Reduction of oxidative cellular damage by overexpression of the thioredoxin TRX2 gene improves yield and quality of wine yeast dry active biomass. Microb Cell Fact 9: 9-23. doi:https://doi.org/10.1186/1475-2859-9-9. PubMed: 20152017.
- View Article
- Google Scholar
30. Querol A, Barrio E, Huerta T, Ramón D (1992) Molecular monitoring of wine fermentations conducted by active dry yeast strains. Appl Environ Microbiol 58: 2948-2953. PubMed: 16348768.
- View Article
- Google Scholar
31. Puig S, Ramón D, Pérez-Ortín JE (1998) Optimized method to obtain stable food-safe recombinant wine yeast strains. J Agric Food Chem 46: 1689-1693. doi:https://doi.org/10.1021/jf9706538.
- View Article
- Google Scholar
32. Gietz RD, Schiestl RH, Willems AR, Woods RA (1995) Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11: 355-360. doi:https://doi.org/10.1002/yea.320110408. PubMed: 7785336.
- View Article
- Google Scholar
33. Tsuzi D, Maeta K, Takatsume Y, Izawa S, Inoue Y (2004) Regulation of the yeast phospholipid hydroperoxide glutathione peroxidase GPX2 by oxidative stress is mediated by Yap1 and Skn7. FEBS Lett 565: 148-154. doi:https://doi.org/10.1016/j.febslet.2004.03.091. PubMed: 15135069.
- View Article
- Google Scholar
34. Longtine MS, McKenzie A, Demarini DJ, Shah NG, Wach A et al. (1998) Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953-961. doi:https://doi.org/10.1002/(SICI)1097-0061(199807)14:10. PubMed: 9717241.
- View Article
- Google Scholar
35. Jakubowski W, Biliński T, Bartosz G (2000) Oxidative stress during aging of stationary cultures of the yeast Saccharomyces cerevisiae. Free Radic Biol Med 28: 659-664. doi:https://doi.org/10.1016/S0891-5849(99)00266-X. PubMed: 10754260.
- View Article
- Google Scholar
36. Espindola AS, Gomes DS, Panek AD, Araujo EC (2003) The role of glutathione in yeast dehydration tolerance. Cryobiology 47: 236-241. doi:https://doi.org/10.1016/j.cryobiol.2003.10.003. PubMed: 14697735.
- View Article
- Google Scholar
37. Griffith OW (1980) Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal Biochem 106: 207-212. doi:https://doi.org/10.1016/0003-2697(80)90139-6. PubMed: 7416462.
- View Article
- Google Scholar
38. Kohrer K, Domdey H (1991) Preparation of high molecular weight. RNA - Methods Enzymol 194: 398-405. doi:https://doi.org/10.1016/0076-6879(91)94030-G.
- View Article
- Google Scholar
39. Miller JH (1972) Experiments in Molecular Genetics, second ed.. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
40. Alepuz PM, de Nadal E, Zapater M, Ammerer G, Posas F (2003) Osmostress-induced transcription by Hot1 depends on a Hog1-mediated recruitment of the RNA Pol II. EMBO J 22: 2433-2442. doi:https://doi.org/10.1093/emboj/cdg243. PubMed: 12743037.
- View Article
- Google Scholar
41. Warringer J, Zörgö E, Cubillos FA, Zia A, Gjuvsland A et al. (2011) Trait variation in yeast is defined by population history. PLoS Genet 7 (6) e1002111. PubMed: 21698134.
- View Article
- Google Scholar
42. Liti G, Carter DM, Moses AM, Warringer J, Parts L et al. (2009) Population genomics of domestic and wild yeasts. Nature 458: 337-341. doi:https://doi.org/10.1038/nature07743. PubMed: 19212322.
- View Article
- Google Scholar
43. Fomenko DE, Agisheva N, Jacobsen M, Naya A, Malinouski M, et al. (2011) Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide. Proc of the Natl Acad of Sciences of the USA 108: 2729-2734. doi:https://doi.org/10.1073/pnas.1010721108. PubMed: 21282621.
- View Article
- Google Scholar
44. Raitt DC, Johnson AL, Erkine AM, Makino K, Morgan B et al. (2000) The Skn7 response regulator of Saccharomyces cerevisiae interacts with Hsf1 in vivo and is required for the induction of heat shock genes by oxidative stress. Mol Biol Cell 11: 2335-2347. doi:https://doi.org/10.1091/mbc.11.7.2335. PubMed: 10888672.
- View Article
- Google Scholar
45. Gómez-Pastor R, Pérez-Torrado R, Cabiscol E, Matallana E (2010b) Transcriptomic and proteomic insights of the wine yeast biomass propagation process. FEMS Yeast Res 10: 870-884. doi:https://doi.org/10.1111/j.1567-1364.2010.00667.x. PubMed: 20738407.
- View Article
- Google Scholar
46. Cabiscol E, Piulats E, Echave P, Herrero E, Ros J (2000) Oxidative stress promotes specific protein damage in Saccharomyces cerevisiae. J Biol Chem 275: 27393-27398. PubMed: 10852912.
- View Article
- Google Scholar
47. Macierzyńska E, Grzelak A, Bartosz G (2007) The effect of growth medium on the antioxidant defense of Saccharomyces cerevisiae. Cell Mol Biol Lett 12: 448-456. doi:https://doi.org/10.2478/s11658-007-0017-y. PubMed: 17361365.
- View Article
- Google Scholar
48. Querol A, Fernández-Espinar MT, del Olmo Ml, Barrio E (2003) Adaptive evolution of wine yeast. Int J Food Microbiol 86: 3-10. doi:https://doi.org/10.1016/S0168-1605(03)00244-7. PubMed: 12892918.
- View Article
- Google Scholar
49. Ocón-Garrido E, Grant CM (2002) Role of thioredoxins in the response of Saccharomyces cerevisiae to oxidative stress induced by hydroperoxides. Molecular Microbiol 43: 993-1003. doi:https://doi.org/10.1046/j.1365-2958.2002.02795.x.
- View Article
- Google Scholar
50. Veal EA, Ross SJ, Malakasi P, Peacock E, Morgan BA (2003) Ybp1 is required for the hydrogen peroxide-induced oxidation of the Yap1 transcription factor. J Biol Chem 278: 30896-30904. doi:https://doi.org/10.1074/jbc.M303542200. PubMed: 12743123.
- View Article
- Google Scholar
51. Charizanis C, Juhnke H, Krems B, Entian KD (1999) The oxidative stress response mediated via Pos9/Skn7 is negatively regulated by the Ras/PKA pathway in Saccharomyces cerevisiae. Mol Gen Genet 261: 740-752. doi:https://doi.org/10.1007/s004380050017. PubMed: 10394911.
- View Article
- Google Scholar
52. Saitoh M, Nishitoh M, Fujii M, Takeda K, Tobiume K (1998) Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1. EMBO J 17: 2596-2606. doi:https://doi.org/10.1093/emboj/17.9.2596. PubMed: 9564042.
- View Article
- Google Scholar

[ref1] 1. Holmgren A (1989) Thioredoxin and glutaredoxin systems. J Biol Chem 264: 13963-13966. PubMed: 2668278.
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Kuge S, Jones N (1994) YAP1 dependent activation of TRX2 is essential for the response of Saccharomyces cerevisiae to oxidative stress by hydroperoxides. EMBO J 13: 655-664. PubMed: 8313910.
View Article
Google Scholar

[5] View Article

[6] Google Scholar

[ref3] 3. Fernandes L, Rodrigues-Pousada C, Struhl K (1997) Yap, a novel family of eight bZIP proteins in Saccharomyces cerevisiae with distinct biological functions. Mol Cell Biol 17: 6982-6993. PubMed: 9372930.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref4] 4. Godon C, Lagniel G, Lee J, Buhler JM, Kieffer S et al. (1998) The H₂O₂ stimulon in Saccharomyces cerevisiae. J Biol Chem 273: 22480-22489. doi:https://doi.org/10.1074/jbc.273.35.22480. PubMed: 9712873.
View Article
Google Scholar

[11] View Article

[12] Google Scholar

[ref5] 5. Drakulic T, Temple MD, Guido R, Jarolim S, Breitenbach M et al. (2005) Involvement of oxidative stress response genes in redox homeostasis, the level of reactive oxygen species, and ageing in Saccharomyces cerevisiae. FEMS Yeast Res 5: 1215-1228. doi:https://doi.org/10.1016/j.femsyr.2005.06.001. PubMed: 16087409.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref6] 6. Trotter EW, Grant CM (2002) Thioredoxins are required for protection against a reductive stress in the yeast Saccharomyces cerevisiae. Mol Microbiol 46: 869-878. doi:https://doi.org/10.1046/j.1365-2958.2002.03216.x. PubMed: 12410842.
View Article
Google Scholar

[17] View Article

[18] Google Scholar

[ref7] 7. Gómez-Pastor R, Pérez-Torrado R, Cabiscol E, Ros J, Matallana E (2012) Engineered Trx2p industrial yeast strain protects glycolysis and fermentation proteins from oxidative carbonylation during biomass propagation. Microb Cell Fact 11: 4-19. doi:https://doi.org/10.1186/1475-2859-11-4. PubMed: 22230188.
View Article
Google Scholar

[20] View Article

[21] Google Scholar

[ref8] 8. Izawa S, Maeda K, Sugiyama K, Mano J, Inoue Y et al. (1999) Thioredoxin deficiency causes the constitutive activation of Yap1, an AP-1-like transcription factor in Saccharomyces cerevisiae. J Biol Chem 274: 28459-28465. doi:https://doi.org/10.1074/jbc.274.40.28459. PubMed: 10497208.
View Article
Google Scholar

[23] View Article

[24] Google Scholar

[ref9] 9. Wood MJ, Storz G, Tjandra N (2004) Structural basis for redox regulation of Yap1 transcription factor localization. Nature 430: 917-921. doi:https://doi.org/10.1038/nature02790. PubMed: 15318225.
View Article
Google Scholar

[26] View Article

[27] Google Scholar

[ref10] 10. Delaunay A, Isnard AD, Toledano MB (2000) H2O2 sensing through oxidation of the Yap1 transcription factor. EMBO J 19: 5157-5166. doi:https://doi.org/10.1093/emboj/19.19.5157. PubMed: 11013218.
View Article
Google Scholar

[29] View Article

[30] Google Scholar

[ref11] 11. Temple MD, Perrone GG, Dawes IW (2005) Complex cellular responses to reactive oxygen species. Trends Cell Biol 15: 319-326. doi:https://doi.org/10.1016/j.tcb.2005.04.003. PubMed: 15953550.
View Article
Google Scholar

[32] View Article

[33] Google Scholar

[ref12] 12. Mason JT, Kim SK, Knaff DB, Wood MJ (2006) Thermodynamic basis for redox regulation of the Yap1 signal transduction pathway. Biochemistry 45: 13409-13417. doi:https://doi.org/10.1021/bi061136y. PubMed: 17087494.
View Article
Google Scholar

[35] View Article

[36] Google Scholar

[ref13] 13. Muller EG (1991) Thioredoxin deficiency in yeast prolongs S phase and shortens the G1 interval of the cell cycle. J Biol Chem 266: 9194-9202. PubMed: 2026619.
View Article
Google Scholar

[38] View Article

[39] Google Scholar

[ref14] 14. Koc A, Mathews CK, Wheeler LJ, Gross MK, Merrill GK (2006) Thioredoxin is required for deoxyribonucleotide pool maintenance during S phase. J Biol Chem 281: 15058-15063. doi:https://doi.org/10.1074/jbc.M601968200. PubMed: 16574642.
View Article
Google Scholar

[41] View Article

[42] Google Scholar

[ref15] 15. Gómez-Pastor R, Pérez-Torrado R, Matallana E (2012) Modification of the TRX2 gene dose in Saccharomyces cerevisiae affects hexokinase 2 gene regulation during wine yeast biomass production. Appl Microbiol Biotechnol 94: 773-787. doi:https://doi.org/10.1007/s00253-011-3738-9. PubMed: 22223102.
View Article
Google Scholar

[44] View Article

[45] Google Scholar

[ref16] 16. Kumar JK, Tabor S, Richardson CC (2004) Proteomic analysis of thioredoxin-targeted proteins in Escherichia coli. Proc Natl Acad Sci U S A 101: 3759-3764. doi:https://doi.org/10.1073/pnas.0308701101. PubMed: 15004283.
View Article
Google Scholar

[47] View Article

[48] Google Scholar

[ref17] 17. Montrichard F, Alkhalfioui F, Yano H, Vensel WH, Hurkman WJ et al. (2009) Thioredoxin targets in plants: the first 30 years. J Proteomics 72: 452-474. doi:https://doi.org/10.1016/j.jprot.2008.12.002. PubMed: 19135183.
View Article
Google Scholar

[50] View Article

[51] Google Scholar

[ref18] 18. Kuge S, Jones N, Nomoto A (1997) Regulation of yAP-1 nuclear localization in response to oxidative stress. EMBO J 16: 1710-1720. doi:https://doi.org/10.1093/emboj/16.7.1710. PubMed: 9130715.
View Article
Google Scholar

[53] View Article

[54] Google Scholar

[ref19] 19. Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB et al. (2000) Genomic expression programs in the response of yeast cells to environmental changes. Mol Biol Cell 11: 4241-4257. doi:https://doi.org/10.1091/mbc.11.12.4241. PubMed: 11102521.
View Article
Google Scholar

[56] View Article

[57] Google Scholar

[ref20] 20. Moye-Rowley WS (2002) Transcription factors regulating the response to oxidative stress in yeast. Antioxid Redox Signal 4: 123-140. doi:https://doi.org/10.1089/152308602753625915. PubMed: 11970849.
View Article
Google Scholar

[59] View Article

[60] Google Scholar

[ref21] 21. Morgan BA, Banks GR, Toone WM, Raitt D, Kuge S et al. (1997) The Skn7 response regulator controls gene expression in the oxidative stress response of the budding yeast Saccharomyces cerevisiae. EMBO J 16: 1035-1044. doi:https://doi.org/10.1093/emboj/16.5.1035. PubMed: 9118942.
View Article
Google Scholar

[62] View Article

[63] Google Scholar

[ref22] 22. Lee J, Godon C, Lagniel G, Spector D, Garin J et al. (1999) Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J Biol Chem 274: 16040-16046. doi:https://doi.org/10.1074/jbc.274.23.16040. PubMed: 10347154.
View Article
Google Scholar

[65] View Article

[66] Google Scholar

[ref23] 23. He XJ, Mulford KE, Fassler JS (2009) Oxidative stress function of the Saccharomyces cerevisiae Skn7 receiver domain. Eukaryot Cell 8: 768-778. doi:https://doi.org/10.1128/EC.00021-09. PubMed: 19304952.
View Article
Google Scholar

[68] View Article

[69] Google Scholar

[ref24] 24. Mulford KE, Fassler JS (2011) Association of the Skn7 and Yap1 transcription factors in the Saccharomyces cerevisiae oxidative stress response. Eukaryot Cell 10: 761-769. doi:https://doi.org/10.1128/EC.00328-10. PubMed: 21478431.
View Article
Google Scholar

[71] View Article

[72] Google Scholar

[ref25] 25. Lu JM, Deschenes RJ, Fassler JS (2003) Saccharomyces cerevisiae histidine phosphotransferase Ypd1p shuttles between the nucleus and cytoplasm for SLN1-dependent phosphorylation of Ssk1p and Skn7p. Eukaryot Cell 2: 1304-1314. doi:https://doi.org/10.1128/EC.2.6.1304-1314.2003. PubMed: 14665464.
View Article
Google Scholar

[74] View Article

[75] Google Scholar

[ref26] 26. Gulshan K, Lee SS, Moye-Rowley WS (2011) Differential Oxidant Tolerance Determined by the Key Transcription Factor Yap1 Is Controlled by Levels of the Yap1-binding Protein Ybp1. J Biol Chem286: 34071-34081. doi:https://doi.org/10.1074/jbc.M111.251298. PubMed: 21844193.
View Article
Google Scholar

[77] View Article

[78] Google Scholar

[ref27] 27. Demasi AP, Pereira GA, Netto LE (2006) Yeast oxidative stress response. Influences of cytosolic thioredoxin peroxidase I and of the mitochondrial functional state. FEBS J 273: 805-816. doi:https://doi.org/10.1111/j.1742-4658.2006.05116.x. PubMed: 16441666.
View Article
Google Scholar

[80] View Article

[81] Google Scholar

[ref28] 28. Pérez-Torrado R, Gómez-Pastor R, Larsson C, Matallana E (2009) Fermentative capacity of dry active wine yeast requires a specific oxidative stress response during industrial biomass growth. Appl Microbiol Biotechnol 81: 951-960. doi:https://doi.org/10.1007/s00253-008-1722-9. PubMed: 18836715.
View Article
Google Scholar

[83] View Article

[84] Google Scholar

[ref29] 29. Gómez-Pastor R, Pérez-Torrado R, Cabiscol E, Ros J, Matallana E (2010a) Reduction of oxidative cellular damage by overexpression of the thioredoxin TRX2 gene improves yield and quality of wine yeast dry active biomass. Microb Cell Fact 9: 9-23. doi:https://doi.org/10.1186/1475-2859-9-9. PubMed: 20152017.
View Article
Google Scholar

[86] View Article

[87] Google Scholar

[ref30] 30. Querol A, Barrio E, Huerta T, Ramón D (1992) Molecular monitoring of wine fermentations conducted by active dry yeast strains. Appl Environ Microbiol 58: 2948-2953. PubMed: 16348768.
View Article
Google Scholar

[89] View Article

[90] Google Scholar

[ref31] 31. Puig S, Ramón D, Pérez-Ortín JE (1998) Optimized method to obtain stable food-safe recombinant wine yeast strains. J Agric Food Chem 46: 1689-1693. doi:https://doi.org/10.1021/jf9706538.
View Article
Google Scholar

[92] View Article

[93] Google Scholar

[ref32] 32. Gietz RD, Schiestl RH, Willems AR, Woods RA (1995) Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11: 355-360. doi:https://doi.org/10.1002/yea.320110408. PubMed: 7785336.
View Article
Google Scholar

[95] View Article

[96] Google Scholar

[ref33] 33. Tsuzi D, Maeta K, Takatsume Y, Izawa S, Inoue Y (2004) Regulation of the yeast phospholipid hydroperoxide glutathione peroxidase GPX2 by oxidative stress is mediated by Yap1 and Skn7. FEBS Lett 565: 148-154. doi:https://doi.org/10.1016/j.febslet.2004.03.091. PubMed: 15135069.
View Article
Google Scholar

[98] View Article

[99] Google Scholar

[ref34] 34. Longtine MS, McKenzie A, Demarini DJ, Shah NG, Wach A et al. (1998) Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953-961. doi:https://doi.org/10.1002/(SICI)1097-0061(199807)14:10. PubMed: 9717241.
View Article
Google Scholar

[101] View Article

[102] Google Scholar

[ref35] 35. Jakubowski W, Biliński T, Bartosz G (2000) Oxidative stress during aging of stationary cultures of the yeast Saccharomyces cerevisiae. Free Radic Biol Med 28: 659-664. doi:https://doi.org/10.1016/S0891-5849(99)00266-X. PubMed: 10754260.
View Article
Google Scholar

[104] View Article

[105] Google Scholar

[ref36] 36. Espindola AS, Gomes DS, Panek AD, Araujo EC (2003) The role of glutathione in yeast dehydration tolerance. Cryobiology 47: 236-241. doi:https://doi.org/10.1016/j.cryobiol.2003.10.003. PubMed: 14697735.
View Article
Google Scholar

[107] View Article

[108] Google Scholar

[ref37] 37. Griffith OW (1980) Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal Biochem 106: 207-212. doi:https://doi.org/10.1016/0003-2697(80)90139-6. PubMed: 7416462.
View Article
Google Scholar

[110] View Article

[111] Google Scholar

[ref38] 38. Kohrer K, Domdey H (1991) Preparation of high molecular weight. RNA - Methods Enzymol 194: 398-405. doi:https://doi.org/10.1016/0076-6879(91)94030-G.
View Article
Google Scholar

[113] View Article

[114] Google Scholar

[ref39] 39. Miller JH (1972) Experiments in Molecular Genetics, second ed.. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

[ref40] 40. Alepuz PM, de Nadal E, Zapater M, Ammerer G, Posas F (2003) Osmostress-induced transcription by Hot1 depends on a Hog1-mediated recruitment of the RNA Pol II. EMBO J 22: 2433-2442. doi:https://doi.org/10.1093/emboj/cdg243. PubMed: 12743037.
View Article
Google Scholar

[117] View Article

[118] Google Scholar

[ref41] 41. Warringer J, Zörgö E, Cubillos FA, Zia A, Gjuvsland A et al. (2011) Trait variation in yeast is defined by population history. PLoS Genet 7 (6) e1002111. PubMed: 21698134.
View Article
Google Scholar

[120] View Article

[121] Google Scholar

[ref42] 42. Liti G, Carter DM, Moses AM, Warringer J, Parts L et al. (2009) Population genomics of domestic and wild yeasts. Nature 458: 337-341. doi:https://doi.org/10.1038/nature07743. PubMed: 19212322.
View Article
Google Scholar

[123] View Article

[124] Google Scholar

[ref43] 43. Fomenko DE, Agisheva N, Jacobsen M, Naya A, Malinouski M, et al. (2011) Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide. Proc of the Natl Acad of Sciences of the USA 108: 2729-2734. doi:https://doi.org/10.1073/pnas.1010721108. PubMed: 21282621.
View Article
Google Scholar

[126] View Article

[127] Google Scholar

[ref44] 44. Raitt DC, Johnson AL, Erkine AM, Makino K, Morgan B et al. (2000) The Skn7 response regulator of Saccharomyces cerevisiae interacts with Hsf1 in vivo and is required for the induction of heat shock genes by oxidative stress. Mol Biol Cell 11: 2335-2347. doi:https://doi.org/10.1091/mbc.11.7.2335. PubMed: 10888672.
View Article
Google Scholar

[129] View Article

[130] Google Scholar

[ref45] 45. Gómez-Pastor R, Pérez-Torrado R, Cabiscol E, Matallana E (2010b) Transcriptomic and proteomic insights of the wine yeast biomass propagation process. FEMS Yeast Res 10: 870-884. doi:https://doi.org/10.1111/j.1567-1364.2010.00667.x. PubMed: 20738407.
View Article
Google Scholar

[132] View Article

[133] Google Scholar

[ref46] 46. Cabiscol E, Piulats E, Echave P, Herrero E, Ros J (2000) Oxidative stress promotes specific protein damage in Saccharomyces cerevisiae. J Biol Chem 275: 27393-27398. PubMed: 10852912.
View Article
Google Scholar

[135] View Article

[136] Google Scholar

[ref47] 47. Macierzyńska E, Grzelak A, Bartosz G (2007) The effect of growth medium on the antioxidant defense of Saccharomyces cerevisiae. Cell Mol Biol Lett 12: 448-456. doi:https://doi.org/10.2478/s11658-007-0017-y. PubMed: 17361365.
View Article
Google Scholar

[138] View Article

[139] Google Scholar

[ref48] 48. Querol A, Fernández-Espinar MT, del Olmo Ml, Barrio E (2003) Adaptive evolution of wine yeast. Int J Food Microbiol 86: 3-10. doi:https://doi.org/10.1016/S0168-1605(03)00244-7. PubMed: 12892918.
View Article
Google Scholar

[141] View Article

[142] Google Scholar

[ref49] 49. Ocón-Garrido E, Grant CM (2002) Role of thioredoxins in the response of Saccharomyces cerevisiae to oxidative stress induced by hydroperoxides. Molecular Microbiol 43: 993-1003. doi:https://doi.org/10.1046/j.1365-2958.2002.02795.x.
View Article
Google Scholar

[144] View Article

[145] Google Scholar

[ref50] 50. Veal EA, Ross SJ, Malakasi P, Peacock E, Morgan BA (2003) Ybp1 is required for the hydrogen peroxide-induced oxidation of the Yap1 transcription factor. J Biol Chem 278: 30896-30904. doi:https://doi.org/10.1074/jbc.M303542200. PubMed: 12743123.
View Article
Google Scholar

[147] View Article

[148] Google Scholar

[ref51] 51. Charizanis C, Juhnke H, Krems B, Entian KD (1999) The oxidative stress response mediated via Pos9/Skn7 is negatively regulated by the Ras/PKA pathway in Saccharomyces cerevisiae. Mol Gen Genet 261: 740-752. doi:https://doi.org/10.1007/s004380050017. PubMed: 10394911.
View Article
Google Scholar

[150] View Article

[151] Google Scholar

[ref52] 52. Saitoh M, Nishitoh M, Fujii M, Takeda K, Tobiume K (1998) Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1. EMBO J 17: 2596-2606. doi:https://doi.org/10.1093/emboj/17.9.2596. PubMed: 9564042.
View Article
Google Scholar

[153] View Article

[154] Google Scholar

Figures

Abstract

Introduction

Materials and Methods

Yeast strains and cultivation conditions

Catalase activity determination

Quantification of lipid peroxidation

Glutathione determination

Analysis and quantification of mRNA

The β-galactosidase assay

Western blot analysis of Skn7p phosphorylation

Immunoprecipitation

Results

Effects of TRX2 gene manipulation and growth medium on the oxidative stress response

Expression of the Yap1p-Skn7p-regulated antioxidant genes is dependent on the presence of TRX2 under respiratory conditions

Trx2p is involved in the promoter regulation by the Skn7p transcription factor

The Skn7p-dependent heat shock gene expression under oxidative stress is affected by the absence of TRX2

Thioredoxin deficiency increases Skn7p phosphorylation under oxidative stress

Discussion

Conclusions

Supporting Information

Author Contributions

References