Figures
Abstract
Mutations in the orphan gene C19orf12 were identified as a genetic cause in a subgroup of patients with NBIA, a neurodegenerative disorder characterized by deposits of iron in the basal ganglia. C19orf12 was shown to be localized in mitochondria, however, nothing is known about its activity and no functional link exists to the clinical phenotype of the patients. This situation led us to investigate the effects of C19orf12 down-regulation in the model organism Drosophila melanogaster. Two genes are present in D. melanogaster, which are orthologs of C19orf12, CG3740 and CG11671. Here we provide evidence that transgenic flies with impaired C19orf12 homologs reflect the neurodegenerative phenotype and represent a valid tool to further analyze the pathomechanism in C19orf12-associated NBIA.
Citation: Iuso A, Sibon OCM, Gorza M, Heim K, Organisti C, Meitinger T, et al. (2014) Impairment of Drosophila Orthologs of the Human Orphan Protein C19orf12 Induces Bang Sensitivity and Neurodegeneration. PLoS ONE 9(2): e89439. https://doi.org/10.1371/journal.pone.0089439
Editor: Udai Pandey, Louisiana State University Health Sciences Center, United States of America
Received: July 5, 2013; Accepted: January 21, 2014; Published: February 21, 2014
Copyright: © 2014 Iuso et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was funded by the NBIA Disorders Association Grant 2011 (AI), by the VICI grant from the Dutch organization of Scientific Research, NOW (OS), and by the European Commission’s Seventh Framework Program (FP7/2007–2013, HEALTH-F2-2011, grant agreement No. 277984, TIRCON) (OS, HP, TM). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
NBIA refers to a heterogeneous group of rare (1–3 cases/1 million population) inherited neurological disorders whose hallmark is iron deposition in the basal ganglia. Currently, nine different subtypes of NBIA have been recognized and associated to their genetic counterpart. PANK2, PLA2G6 and C19orf12 are hot spot genes, with C19orf12 accounting alone for up to 30% of cases. Most of the knowledge about C19orf12-associated NBIA refers to genetic, clinical and radiological features. So far, 67 patients have been reported in literature [1]–[9] but still no hypothesis has been made concerning the pathomechanism underlying this complex disorder. Two postmortem brain samples were examined and showed iron accumulation, Lewy bodies, tau pathology and spheroids with a strong immunoreactivity for ubiquitin. However, the scarcity of cases makes it difficult to state whether the overlap between C19orf12-associated NBIA and Parkinson’s disease is a rule or a private trait.
C19orf12 expression occurs mainly in brain, blood cells and adipocytes. During in vitro adipocyte differentiation C19orf12 expression increases constantly and is co-regulated with genes involved in the fatty acid metabolism suggesting a role for C19orf12 in lipid metabolism [1].
C19orf12 harbors two trans-membrane domains. Immunofluorescence experiments have shown that C19orf12 is localized in mitochondria. Based on these evidences, MPAN (Mitochondrial membrane Protein-Associated Neurodegeneration) has been proposed as acronym to refer to C19orf12-associated NBIA. Although C19orf12 is a mitochondrial protein, mutations in C19orf12 do not appear to affect the mitochondrial bioenergetics in fibroblasts under basal conditions [1].
The scarcity of data available from neuropathology, the limitations of investigating the biochemical basis of the disease directly in the brain, the absence of a phenotype in fibroblasts and the lack of homology to proteins with known function, led us to work on the creation of a model that would allow us to study the consequences of impaired C19orf12 in tissues which are primarily affected. We decided to set up a D. melanogaster model. Drosophila was successfully employed to study pantothenate kinase-associated neurodegeneration (PKAN) resulting from mutations in PANK2 [10], [11] and tested in rescue experiments with pantethine [12]. We identified two D. melanogaster orthologs of C19orf12, CG3740 and CG11671. We used double heterozygous deletion flies and an RNAi approach to down-regulate the expression of both genes providing evidence that the orthologs are required for the maintenance of the brain tissue and the normal locomotor function. Our results suggest that Drosophila can be used to gain further insight in MPAN disorder.
Results and Discussion
Drosophila has Two Orthologs of the Human C19orf12
Comparative genomics revealed that the human C19orf12 gene has two orthologs in D. melanogaster, CG3740 and CG11671, which share 63% and 55%, respectively, of similarity at protein level with C19orf12 (NP_001026896.2) (Figure 1). CG3740 is localized on the X-chromosome in position 2B5–2B5 while CG11671 maps to chromosome 3R in position 84F8–84F8. The two Drosophila genes are proposed to originate by a duplication event at the speciation node explaining their 72% similarity. The transmembrane domain is the only feature of C19orf12 that is predicted by the primary amino acidic sequence. PolyPhobius program [13] predicted two transmembrane domains for CG3740, similar to the human protein, and one long one for CG11671. Aside the prediction, it is also possible that CG11671 has two transmembrane domains which would also fit with the length of the predicted domain (Figure 1). CG3740 and CG11671 are differentially expressed (Figure 2). The analysis of the mRNA expression pattern in head, thorax and abdomen of adult w1118 flies revealed that expression levels of CG3740 are comparable among the tissues tested, while CG11671 expression is low in head and high in abdomen.
Proteins have been aligned using Clustal 2.1 multiple alignment tool. Stars (*) indicate identities and dots indicate a higher (:) and a lower (.) degree of similarity. The two D. melanogaster proteins are 63% and 55% similar to C19orf12 and share 72% similarity with each other. The transmembrane domains predicted by PolyPhobius are marked in yellow.
The analysis has been performed on total RNA extracted from adult w1118 flies using the same number of males and females (n = 4). The Ribosomal Protein 49 has been used as endogenous control to normalize CG3740 and CG11671 expression level. The level of CG11671 in the abdomen has been set to 1 and the expression of CG3740 and CG11671 in the other tissues expressed relatively.
Generation of Double RNAi and Double Heterozygous Deletion Flies
In order to analyze the consequences of impaired activity we made use of the bipartite GAL4-UAS system. Transgenic lines carrying the yeast Upstream Activating Sequence (UAS) in front of the RNAi constructs for both CG3740 and CG11671 were available at the Vienna Drosophila RNAi stock collection [14]. Both RNAi lines were separately crossed with specific driver lines expressing GAL4 under the control of elav, tubulin or actin promoters, enabling knockdown of CG3740 and CG11671 gene products at the neuronal level (elav) or in the whole body (actin, tubulin). Quantitative PCR performed in RNA isolated from heads of 10 days-old flies revealed that the strongest knockdown was induced under the actin promotor expression, leaving mRNAs levels of only 25% for CG3740 or 10% for CG11671 (Figure 3A). However, down-regulation of the product of each single gene did not result in any significant difference in lifespan or climbing activity compared to control flies (data not shown).
The Ribosomal Protein 49 has been used as endogenous control to normalize CG3740 and CG11671 expression level. (A) CG3740 and CG11671 have been measured in single RNAi flies (CG3740 RNAi and CG11671 RNAi) and in double RNAi flies (CG3740; CG11671 RNAi) using the same number of males and females (n = 4). The level of CG3740 and CG11671 in control flies has been set to 1 and the expression of both genes in down-regulated flies expressed relatively. (B) CG3740 and CG11671 have been measured in single heterozygous deletion flies (Df(1)BSC589/+ and Df(3L)BSC579/+) and in double heterozygous deletion flies (Df(1)BSC589/+; Df(3L)BSC579/+) using female flies (n = 4). The level of CG3740 and CG11671 in control flies has been set to 1 and the expression of both genes in heterozygous deletion flies expressed relatively. Data refer to the average of three independent experiments ± SD.
Based on the homology between CG3740 and CG11671 and the overlapping expression pattern, we hypothesized a compensative mechanism between the two genes that can justify the absence of any pathological phenotype. Hence we generated a stock carrying both RNAi transgenes and crossed these flies with the driver line act-GAL4 in order to reduce compensatory effects between CG3740 and CG11671 (Figure S1). Quantitative PCRs performed on heads of 10 days-old flies showed a reduction of at least 40% for CG3740 and 75% for CG11671 in double RNAi transgenic flies (Figure 3A).
In a second approach, heterozygous deletion strains for CG3740 and CG11671 were generated to validate RNAi fly phenotypes. For this purpose, w1118 flies were crossed with Df(1)BSC589 and Df(3)BSC579 flies, two lines carrying macro deletions encompassing CG3740 and CG11671 respectively and several other genes. Moreover, Df(1)BSC589 and Df(3)BSC579 lines were crossed between each other in order to generate double heterozygous deletion flies (Figure S2). All heterozygous deletion flies were morphologically normal. Quantitative PCRs performed showed expression levels comparable to RNAi transgenes (Figure 3B).
Double RNAi Flies Have Reduced Median Lifespan
The lifespan of control w1118 and double RNAi flies was determined under standard growth conditions by counting the number of dead flies every second day. Down-regulated flies revealed a significantly reduced median lifespan of about 8 days at 50% survival (Figure 4).
The median lifespan is 33 days for control flies vs. 25 days for down-regulated flies. The difference was statistically evaluated by Log Rank test (p = 0.02).
Double RNAi and Double Heterozygous Deletion Flies Show Defective Climbing
NBIA patients with defective C19orf12 display spasticity and progressive cognitive decline. Onset generally occurs in childhood up to early adulthood with slow progression and survival well into adulthood [1], [15]. Although double RNAi and double deletion flies are able to walk, climb and fly, we noticed that they recovered more slowly after the application of a force by tapping them to the lower part of the vial. Those flies able to recover and climb were slower than the controls. We quantified the behavioral defects. Since locomotion can be affected by the age, we tested flies of two different ages using age-matched controls for all tests. In addition, two different control strains were used in the assay, the canonical wild-type w1118 and the act-GAL4/+ flies obtained by backcrossing act-GAL4 for 6 generations with w1118 (Text S1). When analyzing young flies no differences between double RNAi, double deletion and control flies were observed. However, 4-weeks-old double RNAi and double deletion flies performed poorly in the climbing assay compared to controls (Figure 5). Only few down-regulated flies were able to reach the end point fixed at the 150 ml line (17.5 cm) of a cylinder in fifteen seconds. The majority only initiated climbing and stopped before the endpoint was reached, fell back or did not initiate climbing. This behavior suggested a neuromuscular phenotype in double RNAi and double heterozygous deletion flies.
The average is given for 50 animals in each group.
Double RNAi Flies Present Vacuoles in the Brain
Since the hallmark of NBIA is iron accumulation in the brain, we searched for iron accumulation in fly brains of double RNAi flies. The presence of iron deposits was investigated using the standard Prussian blue staining on paraffin-embedded brains of aged flies using sections of mouse spleen as a positive control for the staining. Under our experimental conditions we could not find iron deposits (Figure 6).
The staining was performed on paraffin-embedded sections of 28 days-old flies. No iron deposits were detected in the medulla or retina of either controls or double RNAi flies. Clear iron inclusions were present in paraffin-embedded sections of mouse spleen (positive control).
We morphologically analyzed brains for signs of neurodegeneration in order to investigate whether the defective climbing coincided with abnormalities in the nervous system. In Drosophila, the tissue loss is typically detected as accumulation of degenerative vacuoles or holes in the brain [16], [17]. For this we analyzed the morphology of brains from 28 days-old double RNAi and age-matched control flies. A high number of vacuoles with an area up to 30 µm2 was found in the brain and in the optical lobe of all investigated down-regulated flies suggesting a neurodegenerative process. Few small vacuoles below 2 µm2 were also found in one control fly as a normal result of the aging process [18] (Figure 7A–B).
A) Horizontal head sections from 28 days-old control (w1118) and down-regulated (CG3740; CG11671 RNAi) flies. B) Number and size of vacuoles have been quantified with Image J running the applications “Find Edges” and “Analyze Particles” on thresholded 8-bit pictures. Particle size was imposed bigger than 20 pixels2 and with a circularity factor between 0,5 and 1. Detected vacuoles were displayed using “Overlay Mask”. Data were manually validated to exclude artifacts. Brains analyzed for each fly strain: n = 3. Scale bar: 100 µm.
Double RNAi and Double Heterozygous Deletion Flies Present Bang Sensitivity
In order to further analyze possible locomotor defects, we subjected young and adult double RNAi and double heterozygous flies to mechanical stress by vortexing them shortly and banging the vial against a hard surface. Often, a compromised mitochondrial metabolism generates bang sensitive mutants which respond to the mechanical boost with a temporary paralysis [19]. Control flies restored the upright position instantly and climbed the vial (Movie S1; Movie S2). Double RNAi flies failed to recover a correct body position promptly even if no signs of paralysis or failure of movements were present (Movie S3; Movie S4). They frantically moved their legs and bodies and jumped repeatedly from one side to the other of the vial before getting the upright position and climbing the tube. Double heterozygous deletion flies actually restored the upright position instantly, like controls, but ceased moving. No flies climbed up (Figure 8; Movies S1, S2, S3, and S4).
A) Flies have been vortexed twice (Bang I and II) with 10 minutes in between and the time needed to upright recorded. A) Representative trajectories are reported for aged control (green), double RNAi (red) and for double heterozygous (blue) flies.
Concluding Remarks
Drosophila models have been successfully applied as a tool to unravel basic mechanisms underlying a large number of human neurodegenerative disorders such as Parkinson’s disease [20], Alzheimer [21], [22], Non-coding Trinucleotide Repeat diseases [23] and PKAN [10], [11]. Here we provide compelling evidence that an in vivo model for MPAN has been generated by down-regulating the two homologues of C19orf12. The uncoordinated behavior or lack of orientation in the bang test, the impaired climbing activity as well as the shorter lifespan and the morphological alterations in brain suggest that double RNAi flies can be used as a model for MPAN. The presence of locomotor impairment and bang sensitivity also in double heterozygous deletion flies provides additional genetic evidence that the phenotypes detected in double RNAi flies are due to the knock-down of CG3740 and CG11671 rather than due to off-target effects. The availability of CG3470; CG11671 down-regulated flies provide affected tissues, like brain or muscles which are the main targets of NBIA disorders but seldom available for functional studies, and may represent a valid tool for the screening of therapeutics.
Materials and Methods
Drosophila Genetics
Fly stocks were maintained routinely in our lab at 22°C according to standard protocols. As wild type stock w1118 and act-GAL4/+ were used. UAS-CG3740 (FBst0477282), UAS-CG11671 (FBst0463955) transgenic lines were obtained from Vienna Drosophila RNAi Center (Vienna, Austria); w1118 (BL5905), act5C-GAL4/CyO (BL4414), CyO/snaSco (BL2555), CyO/snaSco; TM6B/MKRS (BL2551), Df(1)BSC589 w1118/FM7h/Dp(2;Y)G, P{hs-hid}Y (BL25423), w1118; Df(3L)BSC579/TM6C, cu1 Sb1 (BL25413) were from Bloomington Drosophila Stock Centre (Indiana University, USA). UAS-CG3740/CyO; UAS-CG11671/TM6B strain, Df(1)BSC589/+, Df(3L)BSC579/+ and Df(1)BSC589/+; Df(3L)BSC579/+ were generated in this work. Chromosomes 1, 3, 4 of the driver line act5C-GAL4/CyO were isogenized to the genetic background of control w1118 flies by back crossing it for 6 generations. Control act-GAL4/+ flies were obtained by back crossing w1118 with act-GAL4 flies for 6 generations (Text S1).
RNA Extraction and qPCR
Flies were cut in three parts: head, thorax and abdomen. Four specimens from each part were collected, resuspended in 500 µl of Trizol (Invitrogen) and homogenized using a teflon pestle. Total RNA was isolated using the Trizol method. One microgram of RNA was reversely transcribed using the M-MLV Reverse Transcriptase (Promega) and oligo dT. CG3740 and CG11671 expression were evaluated in comparison to the ribosomal protein 49. The following primers were used:
CG3740_F: 5′ GGCTGTGCTTAACACTGTCAT 3′.
CG3740_R: 5′ CTACACTGATCACAAAGGTTTC 3′.
CG11671_F: 5′ CAGGGCCATATCCGAAGTTA 3′.
CG11671_R: 5′ TGGTCATTCCCATACGATCA 3′.
Rp49_F: 5′ ATCGGTTACGGATCGAACA 3′.
Rp49_R: 5′ ACAATCTCCTTGCGCTTCTT 3′.
DyNAmo Flash SYBR Green qPCR kit (Finzymes) was used for qPCR and the reactions were run on ABI7900HT instrument (Applied Biosystem). qPCRs have been performed in triplicate on RNA isolated each time from 4 flies.
Behavioral Assays
Two groups of flies, corresponding to “young” (i.e. 24 h after eclosion) and “aged” (i.e. 4 weeks after eclosion) populations of wild-type, double RNAi and double heterozygous deletion flies, were tested in the behavioral assays. Assays were carried out with male and female down-regulated flies and with female double heterozygous deletion flies. Flies were CO2-treated and separated into groups with the same number of individuals per vial one day before the test. Hence flies were subjected to the climbing assay and to the bang test.
The climbing assay was performed according to a modified version of Benzer [24]. 50 flies were placed in a 250-ml glass graduated cylinder that was sealed at the top with parafilm to prevent escape. The flies were gently knocked to the bottom of the cylinder and the number of flies able to cross the 150-ml line (17.5 cm) in 15 seconds was recorded.
The test for bang sensitivity was performed as described by Zhang [25]. Flies were vortexed at maximum setting for 10 sec (Bang I) and the time until all flies upright themselves was recorded. To test for refractory period, the flies were vortexed again 10 min later to see if the flies were still bang sensitive (Bang II). For control as well as mutants, 50 flies were tested for each age.
Statistical analyses were performed using Student’s t-test. Data are presented as mean ± Standard Deviation.
Longevity Test
100 males for control and mutant were collected immediately after eclosion. Every 2 or 3 days flies were passed on fresh food and the number of survived flies plotted in an excel graph until their death.
Brain Histology
Analysis of heads from 28-day-old double RNAi flies and aged matched controls were fixed in 0.1M sodium cacodylate, 2.5% paraformaldehyde, 2.5% gluteraldehyde and embedded in epon. One micrometer horizontal sections were cut for each head. Section from different brain depths were checked for the presence of vacuoles. Sections were stained with 1% toluidine-blue and 1% borax and investigated with an Olympus BX50 light microscope. The number and size of vacuoles was quantified with Image J.
For detection of ferric iron, paraffin embedded sections were incubated for 45 minutes with Prussian blue stain (10% K4Fe(CN)6: 20% HCl, 1∶1) prior to de-paraffinization. Three washes with water followed and staining was enhanced using DAB following standard procedures. Afterwards, the sections were de-paraffinized using ascending gradients of ethanol to xylene and preparation were mounted in Permount mounting medium (Fisher Scientific) and imaged on a Olympus BX50 light microscope.
Supporting Information
Figure S1.
Generation of double RNAi Flies. UAS-CG3740 and UAS-CG11671 flies have been crossed respectively with the double balancer CyO/snaSco; TM6B/MKRS to block any recombination on the second and on the third chromosome. Hence selected parental lines have been crossed between each other in order to get the double balanced stock UAS-CG3740/CyO; UAS-CG11671/TM6. The homozygous stock UAS-CG3740/UAS-CG3740; UAS-CG11671/UAS-CG11671, produced by backcrossing balanced males and females, has been crossed with act-GAL4 driver line to get the double RNAi flies.
https://doi.org/10.1371/journal.pone.0089439.s001
(TIF)
Figure S2.
Generation of double heterozygous deletion Flies. Flies carrying deficiencies on chromosomes 1 (BL25423) and 3 (BL25413) have been crossed with wild type flies w1118 to generate single heterozygous deletion flies for CG3740 and CG11671. Then deficiency stocks have been crossed between each other in order to get the double heterozygous deleted stock Df(1)BSC589/+; Df(3L)BSC579/+.
https://doi.org/10.1371/journal.pone.0089439.s002
(TIF)
Text S1.
Generation of act-GAL4/+ flies. Act5C-GAL4/CyO (BL4414) and CyO/snaSco (BL2555) flies, were backcrossed with w1118 flies for 6 generations to produce control flies isogenic with w1118 for chromosomes 1, 3, and 4.
https://doi.org/10.1371/journal.pone.0089439.s003
(DOCX)
Movie S1.
First bang test, bang I, in control w1118 flies. Males and females were contemporary vortexed for 10 seconds at maximum speed and the time required for recovering the upright position recorded.
https://doi.org/10.1371/journal.pone.0089439.s004
(MOV)
Movie S2.
Second bang test, bang II, in control w1118 flies. Males and females were contemporary vortexed, for 10 seconds at the maximum speed, 10 minutes after the first bang. The time required to recover the upright position recorded.
https://doi.org/10.1371/journal.pone.0089439.s005
(MOV)
Movie S3.
First bang test, bang I, in double RNAi flies. Males and females were contemporary vortexed for 10 seconds at maximum speed and the time required for recovering the upright position recorded.
https://doi.org/10.1371/journal.pone.0089439.s006
(MOV)
Movie S4.
Second bang test, bang II, in double RNAi flies. Males and females were contemporary vortexed, for 10 seconds at the maximum speed, 10 minutes after the first bang. The time required to recover the upright position recorded.
https://doi.org/10.1371/journal.pone.0089439.s007
(MOV)
Acknowledgments
We thank VDRC and the Bloomington stock centre for fly stocks, Prof. Klaus Förstemann for introduction to the fly work and support in the preliminary experiments and Mrs Elenore Samson for helping with the Prussian blue staining.
Author Contributions
Conceived and designed the experiments: AI OS HP. Performed the experiments: AI MG CO. Analyzed the data: AI OS KH TM HP. Contributed reagents/materials/analysis tools: AI OS MG CO. Wrote the paper: AI. Revised the paper: AI OS MG KH CO TM HP.
References
- 1. Hartig MB, Iuso A, Haack T, Kmiec T, Jurkiewicz E, et al. (2011) Absence of an orphan mitochondrial protein, c19orf12, causes a distinct clinical subtype of neurodegeneration with brain iron accumulation. Am J Hum Genet 89: 543–550.
- 2. Panteghini C, Zorzi G, Venco P, Dusi S, Reale C, et al. (2012) C19orf12 and FA2H mutations are rare in Italian patients with neurodegeneration with brain iron accumulation. Semin Pediatr Neurol 19: 75–81.
- 3. Hogarth P, Gregory A, Kruer MC, Sanford L, Wagoner W, et al. (2013) New NBIA subtype: genetic, clinical, pathologic, and radiographic features of MPAN. Neurology 80: 268–275.
- 4. Deschauer M, Gaul C, Behrmann C, Prokisch H, Zierz S, et al. (2012) C19orf12 mutations in neurodegeneration with brain iron accumulation mimicking juvenile amyotrophic lateral sclerosis. J Neurol 259: 2434–2439.
- 5. Dogu O, Krebs CE, Kaleagasi H, Demirtas Z, Oksuz N, et al. (2012) Rapid disease progression in adult-onset mitochondrial membrane protein-associated neurodegeneration. Clin Genet 84: 350–355.
- 6. Dezfouli MA, Alavi A, Rohani M, Rezvani M, Nekuie T, et al. (2013) PANK2 and C19orf12 mutations are common causes of neurodegeneration with brain iron accumulation. Mov Disord 28: 228–232.
- 7. Goldman JG, Eichenseer SR, Berry-Kravis E, Zimnowodzki S, Gregory A, et al. (2013) Clinical features of neurodegeneration with brain iron accumulation due to a C19orf12 gene mutation. Mov Disord 28: 1462–1463.
- 8.
Schottmann G, Stenzel W, Lutzkendorf S, Schuelke M, Knierim E (2013) A novel frameshift mutation of C19ORF12 causes NBIA4 with cerebellar atrophy and manifests with severe peripheral motor axonal neuropathy. Clin Genet.
- 9. Schulte EC, Claussen MC, Jochim A, Haack T, Hartig M, et al. (2013) Mitochondrial membrane protein associated neurodegenration: a novel variant of neurodegeneration with brain iron accumulation. Mov Disord 28: 224–227.
- 10. Bosveld F, Rana A, van der Wouden PE, Lemstra W, Ritsema M, et al. (2008) De novo CoA biosynthesis is required to maintain DNA integrity during development of the Drosophila nervous system. Hum Mol Genet 17: 2058–2069.
- 11. Wu Z, Li C, Lv S, Zhou B (2009) Pantothenate kinase-associated neurodegeneration: insights from a Drosophila model. Hum Mol Genet 18: 3659–3672.
- 12. Rana A, Seinen E, Siudeja K, Muntendam R, Srinivasan B, et al. (2010) Pantethine rescues a Drosophila model for pantothenate kinase-associated neurodegeneration. Proc Natl Acad Sci U S A 107: 6988–6993.
- 13. Kall L, Krogh A, Sonnhammer EL (2007) Advantages of combined transmembrane topology and signal peptide prediction-the Phobius web server. Nucleic Acids Res 35: W429–432.
- 14. Dietzl G, Chen D, Schnorrer F, Su KC, Barinova Y, et al. (2007) A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448: 151–156.
- 15.
Gregory A, Hayflick S (2013) Neurodegeneration with Brain Iron Accumulation Disorders Overview. In: Pagon RA, Bird TD, Dolan CR, Stephens K, Adam MP, editors. GeneReviews Seattle (WA): University of Washington, Seattle; 1993–2013.
- 16. Wittmann CW, Wszolek MF, Shulman JM, Salvaterra PM, Lewis J, et al. (2001) Tauopathy in Drosophila: neurodegeneration without neurofibrillary tangles. Science 293: 711–714.
- 17. Muhlig-Versen M, da Cruz AB, Tschape JA, Moser M, Buttner R, et al. (2005) Loss of Swiss cheese/neuropathy target esterase activity causes disruption of phosphatidylcholine homeostasis and neuronal and glial death in adult Drosophila. J Neurosci 25: 2865–2873.
- 18. Kretzschmar D, Hasan G, Sharma S, Heisenberg M, Benzer S (1997) The swiss cheese mutant causes glial hyperwrapping and brain degeneration in Drosophila. J Neurosci 17: 7425–7432.
- 19. Jaiswal M, Sandoval H, Zhang K, Bayat V, Bellen HJ (2012) Probing mechanisms that underlie human neurodegenerative diseases in Drosophila. Annu Rev Genet 46: 371–396.
- 20. Auluck PK, Chan HY, Trojanowski JQ, Lee VM, Bonini NM (2002) Chaperone suppression of alpha-synuclein toxicity in a Drosophila model for Parkinson’s disease. Science 295: 865–868.
- 21. Cowan CM, Sealey MA, Quraishe S, Targett MT, Marcellus K, et al. (2011) Modelling tauopathies in Drosophila: insights from the fruit fly. Int J Alzheimers Dis 2011: 598157.
- 22. Soldano A, Okray Z, Janovska P, Tmejova K, Reynaud E, et al. (2013) The Drosophila homologue of the amyloid precursor protein is a conserved modulator of Wnt PCP signaling. PLoS Biol 11: e1001562.
- 23. Jackson GR, Salecker I, Dong X, Yao X, Arnheim N, et al. (1998) Polyglutamine-expanded human huntingtin transgenes induce degeneration of Drosophila photoreceptor neurons. Neuron 21: 633–642.
- 24. Benzer S (1967) Behavioral mutants of Drosophila isolated by countercurrent distribution. Proc Natl Acad Sci U S A 58: 1112–1119.
- 25. Zhang H, Tan J, Reynolds E, Kuebler D, Faulhaber S, et al. (2002) The Drosophila slamdance gene: a mutation in an aminopeptidase can cause seizure, paralysis and neuronal failure. Genetics 162: 1283–1299.