Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Correction

Correction: Multi-Level Interactions between the Nuclear Receptor TRα1 and the WNT Effectors β-Catenin/Tcf4 in the Intestinal Epithelium

  • The PLOS ONE Staff
  • Article
  • Metrics
  • Comments
  • Media Coverage

In sub-table S1A of Table S1, the nucleotide sequence of Tcf7l2 (Tcf4) should read: “F: CACAGCTCAAAGCATCAGGA R: CTGCATGTGAAGCTGTCGTT.” The length of the amplicon should be indicated as: “242bp.”

Reference

  1. 1. Sirakov M, Skah S, Lone IN, Nadjar J, Angelov D, et al. (2012) Multi-Level Interactions between the Nuclear Receptor TRα1 and the WNT Effectors β-Catenin/Tcf4 in the Intestinal Epithelium. PLoS ONE 7(4): e34162

Citation: The PLOS ONE Staff (2014) Correction: Multi-Level Interactions between the Nuclear Receptor TRα1 and the WNT Effectors β-Catenin/Tcf4 in the Intestinal Epithelium. PLoS ONE 9(3): e93418. https://doi.org/10.1371/journal.pone.0093418

Published: March 20, 2014

Copyright: © 2014 The PLOS ONE Staff. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.