iRhom2 Mutation Leads to Aberrant Hair Follicle Differentiation in Mice

Yang Leilei; Liu Bing; Li Yang; Wang Shaoxia; Xu Yuan; Wang Dongping; Ye Huahu; Shang Shichen; Zhang Guangzhou; Peng Ruiyun; Zeng Lin; Li Wenlong

doi:10.1371/journal.pone.0115114

Abstract

iRhom1 and iRhom2 are inactive homologues of rhomboid intramembrane serine proteases lacking essential catalytic residues, which are necessary for the maturation of TNFα-converting enzyme (TACE). In addition, iRhoms regulate epidermal growth factor family secretion. The functional significance of iRhom2 during mammalian development is largely unclear. We have identified a spontaneous single gene deletion mutation of iRhom2 in Uncv mice. The iRhom2^Uncv/Uncv mice exhibit hairless phenotype in a BALB/c genetic background. In this study, we observed dysplasia hair follicles in iRhom2^Uncv/Uncv mice from postnatal day 3. Further examination found decreased hair matrix proliferation and aberrant hair shaft and inner root sheath differentiation in iRhom2^Uncv/Uncv mutant hair follicles. iRhom2 is required for the maturation of TACE. Our data demonstrate that iRhom2^Uncv cannot induce the maturation of TACE in vitro and the level of mature TACE is also significantly reduced in the skin of iRhom2^Uncv/Uncv mice. The activation of Notch1, a substrate of TACE, is disturbed, associated with dramatically down-regulation of Lef1 in iRhom2^Uncv/Uncv hair follicle matrix. This study identifies iRhom2 as a novel regulator of hair shaft and inner root sheath differentiation.

Citation: Leilei Y, Bing L, Yang L, Shaoxia W, Yuan X, Dongping W, et al. (2014) iRhom2 Mutation Leads to Aberrant Hair Follicle Differentiation in Mice. PLoS ONE 9(12): e115114. https://doi.org/10.1371/journal.pone.0115114

Editor: Andrzej T. Slominski, University of Tennessee, United States of America

Received: June 26, 2014; Accepted: November 18, 2014; Published: December 29, 2014

Copyright: © 2014 Leilei et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.

Funding: This work was supported by the National Natural Science Foundation of China (31030058). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

iRhom1 and iRhom2, which are inactive homologues of the rhomboid intramembrane serine proteases that lack the essential catalytic residues [1]. iRhom1 and iRhom2 regulate the secretion of the epidermal growth factor (EGF) family by endoplasmic reticulum-associated degradation [2]. iRhom2 is required for the release of tumor necrosis factor α (TNFα) in macrophages by controlling the maturation of TNFα-converting enzyme (TACE, also called ADAM17) [3]–[5]. Moreover, iRhom2 controls the activation and substrate selectivity of TACE-dependent shedding events [6]. Dominant mutations of iRhom2 is the cause of human tylosis esophageal cancer [7], [8]. In addition, iRhom2 plays an important role in inflammatory arthritis [9]. iRhom2 knockout mice could survive in a lethal lipopolysaccharide dose [5]. However, the functional significance of iRhom2 during mammalian skin development is unclear.

In the developing hair follicle, signals from adjacent mesenchymal dermal papilla cells instruct the overlying epithelium to form hair placodes [10], [11]. The placode proliferates to form a larger bulb (matrix) and further differentiates into a central hair shaft consisting of the medulla, cortex and hair shaft cuticle surrounded by the inner root sheath (IRS), which consists of the inner root sheath cuticle and Huxley's and Henle's layers. The outer root sheath (ORS) is outside the IRS, is contiguous with the interfollicular epidermis and contains a reservoir of quiescent SCs that are known as the bulge. The bone morphogenetic protein (BMP), Notch and Wnt/β-catenin signaling pathways allow the normal differentiation of matrix cells into the hair shaft and the IRS envelope [12]–[15]. Gata3 is expressed in IRS, the Gata3 mutant mice generate primary IRS defects, which lead to alterations in the shaft [16], [17]. Foxn1 and Hoxc13, which are important hair shaft gene regulators, both of which cause hair defects when mutated [18], [19].

Here, we report a role for iRhom2 in mouse skin development. In a BALB/c genetic background, homozygous uncovered (Uncv, MGI: 1261908) mice have a hairless phenotype [20], [21]. We identified a spontaneous non-frameshift deletion mutation in the N-terminal cytoplasmic domain of of iRhom2 (iRhom2^Uncv) in Uncv mice by sequence capture array and sequencing platform. iRhom2^Uncv could not induce the maturation of TACE, and dcresease the level of NICD and Lef1. This study suggests that iRhom2 regulates hair shaft and IRS differentiation by specifically modulating Notch1 and Wnt signaling pathway which maybe mediated by TACE.

Results

Pattern of iRhom2 expression in the mouse

In a BALB/c genetic background, homozygous Uncv mice are hairless; heterozygous Uncv mice have a sparse hair coat (Figure A in S1 Fig.). A previous study demonstrated that the Uncv mouse hair abnormalities were linked to a single autosomal gene mutation and incomplete dominant inheritance [20]. Uncv mice with heterozygous parents exhibited the expected Mendelian ratio (wild-type:heterozygous:homozygous = 105∶191∶103). These results show that Uncv/Uncv mice only have a single gene mutation. Using a genetic linkage analysis of Uncv mice, the mutated gene was mapped to a region between markers D11mit338 and D11mit337 on mouse chromosome 11 [20], [22]. We identified a 309 bp spontaneous non-frameshift deletion mutation in the N-terminal cytoplasmic domain of iRhom2 (iRhom2^Uncv) in Uncv mice by sequence capture array and sequencing platform (Figure B in S1 Fig.). PCR analysis showed that each hairless mouse's genotype is iRhom2^Uncv/Uncv, each sparse mouse's genotype is iRhom2^Uncv/+. The hair phenotype of mouse is depended on the dose of iRhom2. All the results indicated that iRhom2 mutation leads to the hairless in mice.

The pattern of iRhom2 mRNA expression was analyzed in 8-week-old mice. iRhom2 was expressed at high levels in the lung and spleen and at moderate levels in the skin (Fig. 1A). Next, we examined the expression of iRhom2 mRNA during skin development. iRhom2 was found to be specifically expressed at high levels on postnatal days (P) 2–15 and P28–35 (Fig. 1B), which corresponds well with the hair follicle growth phase (anagen). The expression of iRhom2 was detected at much lower levels in the hair follicle morphogenesis stage [embryonic day (E) 13.5-P0] and telogen stage (P21) (Fig. 1B). The cyclic expression pattern of iRhom2 implies that it maybe play a role in the progression of anagen in hair follicles. The strong ubiquitous cellular expression of iRhom2 is detected in the hair follicles (Fig. 1C–E and Figure B in S2 Fig.). Double immunofluorescence staining demonstrated that iRhom2 and K14 (marker for the ORS), AE13 (marker for the hair shaft cuticle and cortex keratins) or AE15 (marker for the the IRS and medulla of the hair shaft) were colocalized in the hair follicles (Fig. 1C–E). iRhom2 was not expressed in dermal papilla cells (Fig. 1E). Moreover, iRhom2 was also expressed in basal layer of epidermis (Figure C in S2 Fig.). There is a non-frameshift deletion mutation of iRhom2 in Uncv mice, the antibody we used could not discriminate iRhom2 and iRhom2^Uncv, so iRhom2 expression could still be detected in iRhom2^Uncv/Uncv mice (Figure E in S2 Fig.). However, we performed real-time PCR analysis of iRhom2 and iRhom2^# (The PCR primers were located in the deletion region of iRhom2^Uncv) in wild type and iRhom2^Uncv/Uncv mice, the results showed that iRhom2^# could not be detected in iRhom2^Uncv/Uncv mice (Figure A in S2 Fig.). To confirm whether iRhom2 was expressed in the dermis, the expression of iRhom2 was separately assessed in the epidermis and dermis at P5 using real-time PCR. The results indicated that the dermis expresses very little iRhom2 (Fig. 1F).

Download:

Figure 1. Pattern of iRhom2 expression in mice.

(A) Real-time PCR analysis of iRhom2 expression in 2-month-old mice. (B) Real-time PCR analysis of iRhom2 expression during development in the mouse dorsal skin. (C–E) Immunofluorescence staining of iRhom2, K14, AE15 and AE13 in the dorsal skin of wild-type mice at P9. (F) Real-time PCR analysis of iRhom2 mRNA expression in the epidermis and dermis of wild-type mice at P5. E: embryonic day; P: postnatal day. Green arrow in C indicates the ORS, green arrow in D indicates the IRS and medulla of the hair shaft, green arrow in E indicates the hair shaft cuticle and cortex keratins. White arrow in E indicates the dermal papilla. Scale bars: (C–E), 25 µm.

https://doi.org/10.1371/journal.pone.0115114.g001

Aberrant hair shaft and inner root sheath differentiation in iRhom2^Uncv/Uncv mice

In mice, the development of the primary hair follicles is initiated at approximately E13 and extends to P16 [10]. To determine whether the deletion mutation in iRhom2 affects hair follicle morphogenesis, we examined the dorsal skin histology of iRhom2^Uncv/Uncv and wild-type mice at E15.5, E17.5, P0, P3 and P9. At hair follicle morphogenesis stage (E15.5, E17.5 and P0), the follicles of iRhom2^Uncv/Uncv were histologically similar to wild-type mice (Fig. 2A–F). Skin follicle density was not significantly different in iRhom2^Uncv/Uncv mice compared to the wild-type at E17.5 (12±2 compared to 12±1 follicles per mm, respectively; P = 0.543, n = 8, Fig. 2S). At P3, the differentiating stage, iRhom2^Uncv/Uncv mice showed slightly shorter hair follicles (Fig. 2G and H). However, the skin of iRhom2^Uncv/Uncv mice displayed striking defects in hair follicle morphology at later postnatal stages. By P9, the hair follicles of wild-type mice were in mid-anagen become fully differentiated with large hair bulbs that had descended deep into the fat layer of the skin. In contrast, the hair follicles of iRhom2^Uncv/Uncv mice were smaller and misshapen, and the majority of follicles failed to produce hair shafts (Fig. 2I and J). Few apoptotic cells were detected by TUNEL staining in wildtype and iRhom2^Uncv/Uncv hair follicle matrix of P9 (2.94±1.12 vs. 3.49±1.49, P = 0.42, n = 8, Fig. 2K and L). At P18, hair follicles of both wildtype and mutant mice entered catagen [23] (Figure A and B in S3 Fig.), and subsequently entered telogen stage at P22. At the telogen stage, the hair follicles shortened and condensed in the dermis (Figure C and D in S3 Fig.). At P32, the second anagen, both wildtype and mutant hair follicles elongated and reentered subcutis, however, hair follicles of iRhom2^Uncv/Uncv mice were still misshapen compared with the wildtye mice (Figure E and F in S3 Fig.). Thus the iRhom2^Uncv/Uncv hair follicle cycled normally and the marked shrinkage of the hair follicle matrix in mutant mice is not due to premature catagen development.

Download:

Figure 2. Dysplasia hair follicles in iRhom2^Uncv/Uncv mice.

(A–J) Histology of the dorsal skin from wild-type and iRhom2^Uncv/Uncv mice at E15.5, E17.5, P0, P3 and P9, respectively. (K, L) TUNEL staining in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P9. (M–R) Immunofluorescence staining of Ki67 in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P0, P3 and P9, respectively. (S) Number of hair follicles per mm at E17.5; n = 6. (T) Number of Ki67-positive cells per hair follicle matrix at P0, P3 and P9; n = 8, **P<0.01. WT, wildtype; HO, homozygous. Stars indicate the hair placodes. Scale bars: (A–F, M, N), 25 µm; (K, L), 12.5 µm; (G, H, O–R), 50 µm; (I–J), 100 µm.

https://doi.org/10.1371/journal.pone.0115114.g002

During follicle maturation, hair matrix keratinocytes rapidly propagate and differentiate, forming columns of cells that become the hair shaft and IRS [17]. To investigate hair follicular proliferation in iRhom2^Uncv/Uncv mice, we performed Ki67 immunofluorescence staining. In normal hair follicles, a large number of Ki67-positive cells was concentrated in the hair matrix at P0 and P3. A similar number of Ki67-positive cells was observed in iRhom2^Uncv/Uncv mouse follicles at P0 (21.13±2.38 in wild-type follicles compared to 20.75±3.19 in mutant follicles; P = 0.82, n = 8, Fig. 2M, N and T) and P3 (43.88±9.03 in wild-type follicles compared to 38.13±8.72 in mutant follicles; P = 0.22, n = 8, Fig. 2O, P and T). However, compared to P9 wild-type mice, the number of Ki67-positive cells was significantly lower in iRhom2^Uncv/Uncv mice (40.50±7.39 in wild-type follicles compared to 15.38±11.45 in mutant follicles, P = 1.31E-4, n = 8, Fig. 2Q, R and T).

Next, we examined the expression of several markers of differentiation in the hair follicle at P3 and P9. The ORS expresses keratin (K) 14. In iRhom2^Uncv/Uncv mouse follicles, K14 was expressed at normal levels (Fig. 3A, B, I and J). K6 was expressed in the companion layer of the hair follicle [24]. The expression of K6 was increased in iRhom2^Uncv/Uncv mouse hair follicles (Fig. 3C, D, K and L). In contrast, AE15, which is normally expressed in the IRS and medulla of the hair shaft [25], was markedly reduced in the majority of iRhom2^Uncv/Uncv mouse follicles and was absent from the most distorted follicles, indicating defective IRS differentiation and an absence of the hair shaft medulla (Fig. 3E, F, M and N). AE13, a specific marker for the hair shaft cuticle and cortex keratins [26], was absent in the majority of iRhom2^Uncv/Uncv mouse follicles (Fig. 3G, H, O and P). We confirmed these results by real-time PCR, and the results showed that the expression of IRS markers (K71 and K72) and the hair shaft marker (K85) was significantly decreased in iRhom2^Uncv/Uncv mouse follicles and that the expression of K6 was increased (Fig. 3Q). These results indicate that the hair matrix cells failed to differentiate toward the hair shaft and the IRS in iRhom2^Uncv/Uncv mouse follicles, suggesting a crucial role for iRhom2 in hair follicle differentiation.

Download:

Figure 3. Aberrant hair shaft and inner root sheath differentiation in iRhom2^Uncv/Uncv mice.

(A–P) Immunohistochemistry for K14, K6, AE15, AE13 in the dorsal skin of P3 and P9 wild-type and iRhom2^Uncv/Uncv mice. (Q) Real-time PCR analysis of K6, K71, K72 and K85 mRNA expression in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P9. n = 3, *P<0.05, **P<0.01. Scale bars: (A, B, K, L), 50 µm; (C–H), 25 µm. (I, J, M–P), 100 µm.

https://doi.org/10.1371/journal.pone.0115114.g003

The iRhom2^Uncv mutant protein cannot induce the maturation of TACE

iRhoms inhibits secretion of EGF family ligands by inducing degradation of epidermal growth factor receptor (EGFR) ligands in mammalian cells [2]. Therefore, we analyzed the expression of phospho-EGFR in P3 and P5 mouse skin. The expression of phospho-EGFR was similar in the iRhom2^Uncv/Uncv and the wild-type hair follicles (Fig. 4A–E), so was the expression of phospho-ERK (Fig. 4E). These data indicated that during hair follicle maturation the expression of phospho-EGFR and phospho-ERK were not altered in iRhom2^Uncv/Uncv mice. Furthermore, an in vitro EGF degradation assay showed that both wild-type iRhom2 and iRhom2^Uncv could promote EGF degradation (Fig. 4F). This degradation is dependent on the proteasome; the proteasome inhibitor MG132 could partly restore the expression of EGF (Fig. 4F). Therefore, the deleted region in the iRhom2^Uncv is not necessary for the iRhom2-mediated degradation of EGF.

Download:

Figure 4. The expression of phospho-EGFR is not affected during follicle differetiation in the iRhom2^Uncv mutation.

(A–D) Immunohistochemistry for phospho-EGFR in the dorsal skin of P3 and P5 wild-type and iRhom2^Uncv/Uncv mice. (E) Western blot analysis of phospho-EGFR and phospho-ERK expression in the dorsal skin of P3 wild-type and iRhom2^Uncv/Uncv mice. (F) 293T cells were transfected with the indicated constructs, and the cell lysates were then probed with anti-Flag, anti-Myc and anti-β-actin antibodies (white arrowhead is a non-specific band). Transfected cells were treated with 10 µM MG132 for 12 hours. Scale bars: (A–D), 25 µm.

https://doi.org/10.1371/journal.pone.0115114.g004

It was reported that iRhom2 interacts with TACE and promotes its maturation in macrophages [3]. Immunoprecipitation of iRhom2-overexpressing 293T cells followed by immunoblotting revealed that iRhom2^Uncv did not affect it's interaction with TACE (Fig. 5D). We expressed wild-type iRhom2 and iRhom2^Uncv in 293T cells and assayed its effect on the maturation of TACE. Consistent with previous reports [3], the overexpression of wild-type iRhom2 caused the excessive maturation of TACE; however, exogenous iRhom2^Uncv could not induce the maturation of TACE compared with the empty vector (Fig. 5A). Moreover, exogenous iRhom2^Uncv does not significantly affect the maturation of TACE that is induced by exogenous wild-type iRhom2 (Fig. 5A). In western blots of iRhom2^Uncv/Uncv mouse skin, mature TACE was significantly reduced at P3, P5 and P9 (Fig. 5B). The mRNA of TACE was not significantly different between the iRhom2^Uncv/Uncv and wild-type mice at P5 (Fig. 5C). Double immunofluorescence staining revealed that TACE and iRhom2 were colocalized in the hair follicles of wild-type and iRhom2^Uncv/Uncv mice (Figure D and E in S2 Fig.). These results indicate that iRhom2^Uncv cannot induce the maturation of TACE in vitro or in vivo.

Download:

Figure 5. The iRhom2^Uncv mutant protein cannot induce the maturation of TACE.

(A) 293T cells were transfected with the indicated constructs. Cell lysates were probed with anti-TACE antibody (immature, white arrowhead; mature, black arrowhead). The histogram shows the relative density of the maturation of TACE. n = 3, *P<0.05. (B) Western blot analysis of TACE expression in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice (immature, white arrowhead; mature, black arrowhead). The histogram shows the relative density of the maturation of TACE. n = 3, **P<0.01. (C) Real-time PCR analysis of TACE mRNA expression in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P5. n = 3. (D) 293T cells were transfected with the indicated constructs. Cell lysates were immunoprecipitated using an anti-Flag antibody, and the immunoprecipitates were probed with an anti-TACE antibody.

https://doi.org/10.1371/journal.pone.0115114.g005

Expression levels of regulators of inner root sheath and hair shaft differentiation in iRhom2^Uncv/Uncv follicles

Notch1 and BMP signaling play critical roles in the differentiation of the hair shaft and the IRS [12], [13], [15], [27]. Wnt/β-catenin signaling controls the differentiation of matrix cells along the hair shaft lineage [14]. TACE participates in the activation of the Notch pathway [28]–[31]. The expression of Notch intracellular domain (NICD) was dramatically reduced in iRhom2^Uncv/Uncv mouse hair follicles from P3-P9 (Fig. 6A, B and K); however, the expression of Notch1 mRNA was not significantly different from the wild-type (Fig. 6N), indicating that the post-translational maturation of the Notch1 protein was inhibited in iRhom2^Uncv/Uncv mouse skin. The Notch1 target genes Hes1, Hey1 and Hey2 [27] were also downregulated in iRhom2^Uncv/Uncv mouse skin (Fig. 6N). To determine whether iRhom2 affects Notch signaling transcriptional activity, HeLa cells were co-transfected with Notch-dependent CSL luciferase reporter (CSL-Luc) and increasing amounts of Flag-iRhom2 or Flag-iRhom2^Uncv mutation. As shown in Fig. 6L, Notch transcriptional activation activated by iRhom2 in a dose-dependent manner, but iRhom2^Uncv was not able to activate Notch transcriptional activation. It was reported that expression of Lef1, the Wnt/β-catenin pathway transcriptional effector, could be regulated by Notch1 [32], [33]. The expression of Lef1 was similar at E17.5 (Fig. 6C, D and M), dramatically reduced at P3 and P5 (Fig. 6E–H and M), and absent at P9 in iRhom2^Uncv/Uncv mouse follicles compared to wild-type follicles (Fig. 6I, J and M). The expression of Foxn1, Gata3 and Hoxc13, which are implicated in hair follicle differetionation [34], were dramatically reduced in iRhom2^Uncv/Uncv mouse follicles (Fig. 6N, Figure E and F in S4 Fig.). The nuclear localization of β-catenin, which complexes with Lef1 to activate the transcription of Wnt target genes, was normal in iRhom2^Uncv/Uncv mice (Figure A and B in S4 Fig.). Other genes involved in the Wnt pathway, including Ctnnb1 (β-catenin), Tcf3, Dact1, Wif1 and Daam2 mRNA, were normally expressed in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P5 (Fig. 6N). The levels of phospho-Smad1/5/8 were comparable between iRhom2^Uncv/Uncv mouse follicles and the wild-type (Figure C and D in S4 Fig.), as were the expression levels of Bmp2 and Bmp4 mRNA (Fig. 6N). These results indicated that iRhom2 is involved in hair follicle differentiation by controlling the Notch and Wnt/β-catenin signaling pathways.

Download:

Figure 6. Expression levels of regulators of inner root sheath and hair shaft differentiation in iRhom2^Uncv/Uncv follicles.

(A, B) Immunofluorescence staining of NICD in the dorsal skin of P9 wild-type and age-matched iRhom2^Uncv/Uncv mice. (C–J) Immunohistochemistry for Lef1 in the dorsal skin of E17.5, P0, P3 and P9 wild-type and iRhom2^Uncv/Uncv mice. (K) Western blot analysis of NICD protein expression in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P0, P3, P5 and P9. (L) Notch signaling transcriptional activity affected by Flag-iRhom2 or Flag-iRhom2^Uncv mutation in HeLa cells. NICD serves as a positive control. (M) Western blot analysis of Lef1 protein expression in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P0, P2, P3, P5 and P9. (N) Real-time PCR analysis of Notch1, Hes1, Hey1, Hey2, Bmp2, Bmp4, Lef1, Foxn1, Gata3, Ctnnb1, Tcf3, Dact1, Wif1 and Daam2 mRNA expression in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P5. n = 3, *P<0.05, **P<0.01. Scale bars: (A, B), 12.5 µm; (C, D), 50 µm; (E–J), 25 µm.

https://doi.org/10.1371/journal.pone.0115114.g006

Discussion

In this study, we discovered that iRhom2 regulate murine hair follicle differentiation by specifically modulating Notch1 and Wnt signaling pathway which maybe mediated by TACE.

Our study demonstrated that the iRhom2^Uncv/Uncv mouse has hair differentiation abnormalities and displays a hairless phenotype in a BALB/c genetic background. The iRhom2^Uncv/Uncv mouse showed decreased hair matrix proliferation and could not differentiated into IRS and hair shaft. In P9, the hair follicles of wild-type and mutant mice were in mid-anagen and had descended deep into the subcutis. However, the hair matrix of mutant follicles were less proliferative than that of wildtype. Comparable and few apoptotic cells were detected in both wildtype and iRhom2^Uncv/Uncv hair matrix of P9, implying that mutant mice did not entered into catagen stage prematurely. Further examination showed that hair follicle cycling of mutant mice was normal. So, the marked shrinkage of the hair follicle matrix in mutant mice is not due to premature catagen development. The iRhom2^Uncv/Uncv hair matrix failed to differentiate into IRS and hair shaft which resulted in the hairless phenotype of iRhom2^Uncv/Uncv mouse. However, the hair follicle phenotype was not reported in iRhom2 knockout C57BL/6 mouse [3], [5]. We noticed that cub/cub mice display a hairless or a wavy-coated phenotype depending on the modifier gene mcub [35]. When homozygous for the recessive mcub allele, cub/cub mice appear hairless. A single copy of the dominant Mcub allele confers a full, curly coat to cub/cub mice. The hairless phenotype in cub/cub, mcub/mcub mice resemble the Uncv/Uncv mice. The mapping regions of cub and Uncv cover a large overlapping region including the iRhom2 gene. We speculate that cub and Uncv are the same gene, iRhom2. The modifier gene, Mcub or mcub, maybe affect hair follicle phenotype of iRhom2 knockout mouse.

iRhom2 is necessary for the maturation of TACE. The Adam17 knockout mice displayed a disorganized distribution and structure of hair follicles [36]. Consistent with phenotype in hair follicle of Adam17 knockout mice, the iRhom2^Uncv/Uncv mice showed irregularly positioned and oriented hair follicles with abnormal structure. Adam17 conditional knockout mice induced by K14-Cre showed delayed hair outgrowth, shortened and disorganized hair follicles, abnormal epidermal proliferation and there was a dramatically increased infiltration of inflammatory macrophages [37]. iRhom2^Uncv/Uncv mice showed defects in hair development and macrophages infiltration (Figure A, B and C in S5 Fig.) resembling those in Adam17 conditional knockout mice. There are some disparity between iRhom2^Uncv/Uncv mice and Adam17 knockout mice. The majority of Adam17 knockout mice died between E17.5 and the first day after birth, those few mice that survived for several weeks had 20 to 40% body weights loss than those of littermates [36], while iRhom2^Uncv/Uncv mice could survive up to 12 months and had 20% body weights loss at 4 weeks after birth. It was reported that there is some redundancy between them iRhom1 and iRhom2 [38], this provides some explanation iRhom2^Uncv/Uncv mice do not show the several defects seen in Adam17 knockouts. We noticed that Adam17 knockouts have perturbed hair coats and curly vibrissae [36], however, iRhom2^Uncv/Uncv mice have hairless phenotype. This discrimination implies that iRhom2 has additional physiologically substrates other than Adam17.

iRhom2 is required for controlling the activation of TACE-dependent shedding events [6]. Consistently, iRhom2^Uncv cannot induce the maturation of TACE in vitro, and mature TACE was also significantly reduced in iRhom2^Uncv/Uncv mouse skin. Furthermore, iRhom2^Uncv does not affect the maturation of TACE induced by wild-type iRhom2. These findings indicated that iRhom2^Uncv is a loss of function with respect to the maturation of TACE. However, the deleted region in the iRhom2^Uncv mutant is not necessary for the degradation of EGF. So, the iRhom2^Uncv mutant is not a simple loss of function mutation, which selectivity affects the client protein.

Our results indicated that the deleted region in the iRhom2^Uncv is necessary for the maturation of TACE, which is required for the normal processing of Notch [28], [29], [39]. The Notch precursor protein is cleaved by furin to produce a bipartite heterodimeric molecule. Notch ligand-receptor interactions induce S2 and S3 proteolytic cleavage. S2 cleavage within the extracellular domain is mediated by TACE. Subsequently, S3 cleavage by the γ-secretase releases NICD, which translocates to the nucleus [39], [40]. We demonstrated that the iRhom2^Uncv mutation affects TACE activity and inhibits the activation of Notch1. It was reported that Notch and WNT signaling exists cross-talk [32], [33], [41]. Moreover, the Notch intracellular domain can function as a coactivator for Lef1 and regulator for expression of Lef1 [32], [41]. We observed that the expression of NICD and Lef1 were dramatically reduced from P3, which is the initial stage of hair follicle differentiation and the numbers of hair matrix cells were comparable between the wild-type and the iRhom2^Uncv/Uncv mice, indicating that the loss of NICD and Lef1 is not due to loss of the matrix cells. Therefore, the reduction in NICD and Lef1 expression in the iRhom2^Uncv/Uncv mouse hair matrix appeared before the change in hair bulb morphology, which resulted in disorders of follicle differentiation. This study identifies that iRhom2 regulates hair shaft and IRS differentiation by specifically modulating Notch1 and Wnt signaling pathway which maybe mediated by TACE.

Materials and Methods

Mouse strains and genotyping

Uncv mice were maintained in a BALB/c background in a specific pathogen-free environment. Uncv mice were bred in a heterozygous mating heterozygous format. The genotyping primers were iRhom2 fwd, 5′- CACAGCCCAGTGGTTTGGGGTCA -3′, and iRhom2 rev, 5′- GAGGGCGGCGGCTGCCTGAAAGCT -3′. In wild-type mice, iRhom2 was amplified by standard PCR to yield a 469 bp fragment. In Uncv/Uncv mutant mice, iRhom2 was amplified to yield a 160 bp fragment. Wild-type mice littermates were used as controls. All animal studies were approved by the Review Board of the Institute of Radiation Medicine, Beijing, China.

Plasmid construction

Full-length and mutant iRhom2^Uncv were individually cloned into the pcDNA3.0-Flag vector using the primers iRhom2 fwd, 5′-cccaagcttatggcctcagctgacaagaatggcagcaacctccca-3′, and iRhom2 rev, 5′-ccggaattcttagtgtagcacctggtctagctcg-3′. Myc-tagged mouse EGF in pcDNA3.1 plasmid was a kind gift from Dr. Matthew Freeman [2].

Cell culture, transfection and immunoprecipitation

293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 2 mM L-glutamine at 37°C in a humidified incubator with 5% CO₂. iRhom2 plasmids and the pcDNA3.0-Flag vector were transfected into 293T cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The immunoprecipitation was performed as described previously [42].

Histological analysis, immunohistochemistry and immunofluorescence

Dorsal skin tissue samples were fixed in 4% paraformaldehyde at 4°C overnight, embedded in paraffin, sectioned at 4 µm and stained with hematoxylin and eosin for histological analysis. Immunohistochemistry and immunofluorescence was performed as described previously [43], [44]. For the iRhom2 antibody-blocking experiment, iRhom2 antibody was pre-mixed with iRhom2 antibody (N-terminus) blocking peptides (Abgent) before incubation with the sections.

Terminal deoxyribonucleotidyl transferase-mediated dUTP nick-end labeling assay

The terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay was performed on 4-µm-thick sections of dorsal skin using the ApopTag Peroxidase In Situ Apoptosis Detection Kit (Roche) following the manufacturer's directions.

RNA isolation and real-time PCR

Total RNA was isolated from the dorsal skin using TRIzol reagent (Life Technologies) following the manufacturer's protocol, and cDNA was then prepared using the Prime Script RT reagent kit (TaKaRa) according to the manufacturer's instructions with oligo-dT primers. SYBR Premix Ex Taq (TaKaRa) was used for real-time quantification, and gene expression was normalized to GAPDH using the ΔΔcycle threshold method. Primer sequences are available upon request. To assess the iRhom2 expression separately in the epidermis and dermis, dorsal skin was incubated in 0.25% trypsin at 4°C for 24 to 48 hours; the epidermis was removed as soon as it could be separated from the dermis as an intact sheet.

Luciferase assays

HeLa cells were transfected with Notch-dependent CSL luciferase reporter containing CSL binding sites, Renilla luciferase reporter, iRhom2 and iRhom2^Uncv plasmids. Renilla luciferase was used as a transfection control and signals are given as fold Firefly/Renilla corrected for background. 48 h after transfection, luciferase-reporters activity was measured. Datas are representative of at least three independent experiments.

Statistical analysis

All results are presented as the means ± SE. All statistical analyses were performed using the SPSS software. The significance of the differences between groups was determined using Student's t-test; P<0.05 was considered significant.

Supporting Information

S1 Fig.

Genotyping of wild-type, iRhom2^Uncv/+ and iRhom2^Uncv/Uncv mice. (A) All homozygous Uncv/Uncv mice are hairless, and all heterozygotes (HE) are sparsely coated. (B) The PCR genotyping of iRhom2 revealed a 469 bp wild-type PCR product and a 160 bp mutant product. Heterozygous mice produced both the 469 bp and 160 bp products.

https://doi.org/10.1371/journal.pone.0115114.s001

(TIF)

S2 Fig.

Expression of iRhom2 in mouse skin. (A) Real-time PCR analysis of iRhom2, iRhom2# (The PCR primers were located in the deletion region of iRhom2^Uncv), mRNA expression in the dorsal skin of wild-type and iRhom2^Uncv/Uncv mice at P5. n = 3, **P<0.01. (B, C) Immunofluorescence staining of iRhom2 at P9 mouse dorsal skin from wild-type mice. (D, E) Immunofluorescence staining of iRhom2 and TACE in the dorsal skin of P9 wild-type and iRhom2^Uncv/Uncv mice. Scale bars: (B–E), 12.5 µm.

https://doi.org/10.1371/journal.pone.0115114.s002

(TIF)

S3 Fig.

Histology of the dorsal skin from wild-type and iRhom2^Uncv/Uncv mice. (A–F) Histology of the dorsal skin from wild-type and iRhom2^Uncv/Uncv mice at P18, P22 and P32, respectively. Scale bars: (A–F), 100 µm.

https://doi.org/10.1371/journal.pone.0115114.s003

(TIF)

S4 Fig.

Expression levels of β-catenin, phospho-Smad1/5/8 and Hoxc13 in iRhom2^Uncv/Uncv follicles. (A–F) Immunofluorescence staining of β-catenin, phospho-Smad1/5/8 and Hoxc13 in the dorsal skin of P9 wild-type and iRhom2^Uncv/Uncv mice. Scale bars: (A–F), 12.5 µm.

https://doi.org/10.1371/journal.pone.0115114.s004

(TIF)

S5 Fig.

Excessive macrophages infiltration in iRhom2^Uncv/Uncv mice skin. (A, B) Immunohistochemistry staining of skin with anti-F4/80 antibodies to detect macrophages in wild-type and iRhom2^Uncv/Uncv mice at P5. (C) Number of F4/80-positive cells per 20× field in the dermis of P9; n = 5, **P<0.01. Scale bars: (A, B), 25 µm.

https://doi.org/10.1371/journal.pone.0115114.s005

(TIF)

Acknowledgments

We thank Dr. Matthew Freeman for the Myc-EGF plasmid. We would like to thank the staff of the Institute of JingFeng Medical Laboratory Animal for animal husbandry.

Author Contributions

Conceived and designed the experiments: LW YL. Performed the experiments: LW YL LB XY WS. Analyzed the data: LW YL LY PR ZL. Contributed reagents/materials/analysis tools: WD SS YH ZG. Wrote the paper: LW YL.

References

1. Lemberg MK, Freeman M (2007) Functional and evolutionary implications of enhanced genomic analysis of rhomboid intramembrane proteases. Genome Res 17:1634–1646.
- View Article
- Google Scholar
2. Zettl M, Adrain C, Strisovsky K, Lastun V, Freeman M (2011) Rhomboid family pseudoproteases use the ER quality control machinery to regulate intercellular signaling. Cell 145:79–91.
- View Article
- Google Scholar
3. Adrain C, Zettl M, Christova Y, Taylor N, Freeman M (2012) Tumor necrosis factor signaling requires iRhom2 to promote trafficking and activation of TACE. Science 335:225–228.
- View Article
- Google Scholar
4. Siggs OM, Xiao N, Wang Y, Shi H, Tomisato W, et al. (2012) iRhom2 is required for the secretion of mouse TNFalpha. Blood 119:5769–5771.
- View Article
- Google Scholar
5. McIlwain DR, Lang PA, Maretzky T, Hamada K, Ohishi K, et al. (2012) iRhom2 regulation of TACE controls TNF-mediated protection against Listeria and responses to LPS. Science 335:229–232.
- View Article
- Google Scholar
6. Maretzky T, McIlwain DR, Issuree PD, Li X, Malapeira J, et al. (2013) iRhom2 controls the substrate selectivity of stimulated ADAM17-dependent ectodomain shedding. Proc Natl Acad Sci U S A 110:11433–11438.
- View Article
- Google Scholar
7. Blaydon DC, Etheridge SL, Risk JM, Hennies HC, Gay LJ, et al. (2012) RHBDF2 mutations are associated with tylosis, a familial esophageal cancer syndrome. Am J Hum Genet 90:340–346.
- View Article
- Google Scholar
8. Brooke MA, Etheridge SL, Kaplan N, Simpson C, O'Toole EA, et al.. (2014) iRHOM2-dependent regulation of ADAM17 in cutaneous disease and epidermal barrier function. Hum Mol Genet.
9. Issuree PD, Maretzky T, McIlwain DR, Monette S, Qing X, et al. (2013) iRHOM2 is a critical pathogenic mediator of inflammatory arthritis. J Clin Invest 123:928–932.
- View Article
- Google Scholar
10. Blanpain C, Fuchs E (2006) Epidermal stem cells of the skin. Annu Rev Cell Dev Biol 22:339–373.
- View Article
- Google Scholar
11. Schmidt-Ullrich R, Paus R (2005) Molecular principles of hair follicle induction and morphogenesis. Bioessays 27:247–261.
- View Article
- Google Scholar
12. Yuhki M, Yamada M, Kawano M, Iwasato T, Itohara S, et al. (2004) BMPR1A signaling is necessary for hair follicle cycling and hair shaft differentiation in mice. Development 131:1825–1833.
- View Article
- Google Scholar
13. Andl T, Ahn K, Kairo A, Chu EY, Wine-Lee L, et al. (2004) Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 131:2257–2268.
- View Article
- Google Scholar
14. Merrill BJ, Gat U, DasGupta R, Fuchs E (2001) Tcf3 and Lef1 regulate lineage differentiation of multipotent stem cells in skin. Genes Dev 15:1688–1705.
- View Article
- Google Scholar
15. Pan Y, Lin MH, Tian X, Cheng HT, Gridley T, et al. (2004) gamma-secretase functions through Notch signaling to maintain skin appendages but is not required for their patterning or initial morphogenesis. Dev Cell 7:731–743.
- View Article
- Google Scholar
16. Ellis T, Gambardella L, Horcher M, Tschanz S, Capol J, et al. (2001) The transcriptional repressor CDP (Cutl1) is essential for epithelial cell differentiation of the lung and the hair follicle. Genes Dev 15:2307–2319.
- View Article
- Google Scholar
17. Kaufman CK, Zhou P, Pasolli HA, Rendl M, Bolotin D, et al. (2003) GATA-3: an unexpected regulator of cell lineage determination in skin. Genes Dev 17:2108–2122.
- View Article
- Google Scholar
18. Godwin AR, Capecchi MR (1998) Hoxc13 mutant mice lack external hair. Genes Dev 12:11–20.
- View Article
- Google Scholar
19. Dai X, Segre JA (2004) Transcriptional control of epidermal specification and differentiation. Curr Opin Genet Dev 14:485–491.
- View Article
- Google Scholar
20. Li SR, Wang DP, Yu XL, Ge BS, Wang CE, et al. (1999) Uncv (uncovered): a new mutation causing hairloss on mouse chromosome 11. Genet Res 73:233–238.
- View Article
- Google Scholar
21. Liu B, Xu Y, Li WL, Zeng L (2014) Proteomic analysis of differentially expressed skin proteins in iRhom2Uncv mice. BMB Rep.
22. Shi YZ, Wang DP, Hu LD, Zhao GP, Wang YZ, et al. (2003) A high-resolution genetic and physical map of a mouse coat abnormality locus (Uncv). Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 35:397–402.
- View Article
- Google Scholar
23. Muller-Rover S, Handjiski B, van der Veen C, Eichmuller S, Foitzik K, et al. (2001) A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J Invest Dermatol 117:3–15.
- View Article
- Google Scholar
24. Ramirez A, Vidal M, Bravo A, Jorcano JL (1998) Analysis of sequences controlling tissue-specific and hyperproliferation-related keratin 6 gene expression in transgenic mice. DNA Cell Biol 17:177–185.
- View Article
- Google Scholar
25. O'Guin WM, Sun TT, Manabe M (1992) Interaction of trichohyalin with intermediate filaments: three immunologically defined stages of trichohyalin maturation. J Invest Dermatol 98:24–32.
- View Article
- Google Scholar
26. Lynch MH, O'Guin WM, Hardy C, Mak L, Sun TT (1986) Acidic and basic hair/nail (“hard”) keratins: their colocalization in upper cortical and cuticle cells of the human hair follicle and their relationship to “soft” keratins. J Cell Biol 103:2593–2606.
- View Article
- Google Scholar
27. Watt FM, Estrach S, Ambler CA (2008) Epidermal Notch signalling: differentiation, cancer and adhesion. Curr Opin Cell Biol 20:171–179.
- View Article
- Google Scholar
28. Bozkulak EC, Weinmaster G (2009) Selective use of ADAM10 and ADAM17 in activation of Notch1 signaling. Mol Cell Biol 29:5679–5695.
- View Article
- Google Scholar
29. Brou C, Logeat F, Gupta N, Bessia C, LeBail O, et al. (2000) A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol Cell 5:207–216.
- View Article
- Google Scholar
30. Murthy A, Shao YW, Narala SR, Molyneux SD, Zuniga-Pflucker JC, et al. (2012) Notch activation by the metalloproteinase ADAM17 regulates myeloproliferation and atopic barrier immunity by suppressing epithelial cytokine synthesis. Immunity 36:105–119.
- View Article
- Google Scholar
31. Stephenson NL, Avis JM (2012) Direct observation of proteolytic cleavage at the S2 site upon forced unfolding of the Notch negative regulatory region. Proc Natl Acad Sci U S A 109:E2757–2765.
- View Article
- Google Scholar
32. Spaulding C, Reschly EJ, Zagort DE, Yashiro-Ohtani Y, Beverly LJ, et al. (2007) Notch1 co-opts lymphoid enhancer factor 1 for survival of murine T-cell lymphomas. Blood 110:2650–2658.
- View Article
- Google Scholar
33. Lin MH, Kopan R (2003) Long-range, nonautonomous effects of activated Notch1 on tissue homeostasis in the nail. Dev Biol 263:343–359.
- View Article
- Google Scholar
34. Fuchs E (2007) Scratching the surface of skin development. Nature 445:834–842.
- View Article
- Google Scholar
35. Johnson KR, Lane PW, Cook SA, Harris BS, Ward-Bailey PF, et al. (2003) Curly bare (cub), a new mouse mutation on chromosome 11 causing skin and hair abnormalities, and a modifier gene (mcub) on chromosome 5. Genomics 81:6–14.
- View Article
- Google Scholar
36. Peschon JJ, Slack JL, Reddy P, Stocking KL, Sunnarborg SW, et al. (1998) An essential role for ectodomain shedding in mammalian development. Science 282:1281–1284.
- View Article
- Google Scholar
37. Franzke CW, Cobzaru C, Triantafyllopoulou A, Loffek S, Horiuchi K, et al. (2012) Epidermal ADAM17 maintains the skin barrier by regulating EGFR ligand-dependent terminal keratinocyte differentiation. J Exp Med 209:1105–1119.
- View Article
- Google Scholar
38. Christova Y, Adrain C, Bambrough P, Ibrahim A, Freeman M (2013) Mammalian iRhoms have distinct physiological functions including an essential role in TACE regulation. EMBO Rep.
39. Radtke F, Raj K (2003) The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nat Rev Cancer 3:756–767.
- View Article
- Google Scholar
40. Weinmaster G (2000) Notch signal transduction: a real rip and more. Curr Opin Genet Dev 10:363–369.
- View Article
- Google Scholar
41. Ross DA, Kadesch T (2001) The notch intracellular domain can function as a coactivator for LEF-1. Mol Cell Biol 21:7537–7544.
- View Article
- Google Scholar
42. Li HY, Liu H, Wang CH, Zhang JY, Man JH, et al. (2008) Deactivation of the kinase IKK by CUEDC2 through recruitment of the phosphatase PP1. Nat Immunol 9:533–541.
- View Article
- Google Scholar
43. Yang L, Mao C, Teng Y, Li W, Zhang J, et al. (2005) Targeted disruption of Smad4 in mouse epidermis results in failure of hair follicle cycling and formation of skin tumors. Cancer Res 65:8671–8678.
- View Article
- Google Scholar
44. Yang L, Wang L, Yang X (2009) Disruption of Smad4 in mouse epidermis leads to depletion of follicle stem cells. Mol Biol Cell 20:882–890.
- View Article
- Google Scholar

[ref1] 1. Lemberg MK, Freeman M (2007) Functional and evolutionary implications of enhanced genomic analysis of rhomboid intramembrane proteases. Genome Res 17:1634–1646.
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Zettl M, Adrain C, Strisovsky K, Lastun V, Freeman M (2011) Rhomboid family pseudoproteases use the ER quality control machinery to regulate intercellular signaling. Cell 145:79–91.
View Article
Google Scholar

[5] View Article

[6] Google Scholar

[ref3] 3. Adrain C, Zettl M, Christova Y, Taylor N, Freeman M (2012) Tumor necrosis factor signaling requires iRhom2 to promote trafficking and activation of TACE. Science 335:225–228.
View Article
Google Scholar

[8] View Article

[9] Google Scholar

[ref4] 4. Siggs OM, Xiao N, Wang Y, Shi H, Tomisato W, et al. (2012) iRhom2 is required for the secretion of mouse TNFalpha. Blood 119:5769–5771.
View Article
Google Scholar

[11] View Article

[12] Google Scholar

[ref5] 5. McIlwain DR, Lang PA, Maretzky T, Hamada K, Ohishi K, et al. (2012) iRhom2 regulation of TACE controls TNF-mediated protection against Listeria and responses to LPS. Science 335:229–232.
View Article
Google Scholar

[14] View Article

[15] Google Scholar

[ref6] 6. Maretzky T, McIlwain DR, Issuree PD, Li X, Malapeira J, et al. (2013) iRhom2 controls the substrate selectivity of stimulated ADAM17-dependent ectodomain shedding. Proc Natl Acad Sci U S A 110:11433–11438.
View Article
Google Scholar

[17] View Article

[18] Google Scholar

[ref7] 7. Blaydon DC, Etheridge SL, Risk JM, Hennies HC, Gay LJ, et al. (2012) RHBDF2 mutations are associated with tylosis, a familial esophageal cancer syndrome. Am J Hum Genet 90:340–346.
View Article
Google Scholar

[20] View Article

[21] Google Scholar

[ref8] 8. Brooke MA, Etheridge SL, Kaplan N, Simpson C, O'Toole EA, et al.. (2014) iRHOM2-dependent regulation of ADAM17 in cutaneous disease and epidermal barrier function. Hum Mol Genet.

[ref9] 9. Issuree PD, Maretzky T, McIlwain DR, Monette S, Qing X, et al. (2013) iRHOM2 is a critical pathogenic mediator of inflammatory arthritis. J Clin Invest 123:928–932.
View Article
Google Scholar

[24] View Article

[25] Google Scholar

[ref10] 10. Blanpain C, Fuchs E (2006) Epidermal stem cells of the skin. Annu Rev Cell Dev Biol 22:339–373.
View Article
Google Scholar

[27] View Article

[28] Google Scholar

[ref11] 11. Schmidt-Ullrich R, Paus R (2005) Molecular principles of hair follicle induction and morphogenesis. Bioessays 27:247–261.
View Article
Google Scholar

[30] View Article

[31] Google Scholar

[ref12] 12. Yuhki M, Yamada M, Kawano M, Iwasato T, Itohara S, et al. (2004) BMPR1A signaling is necessary for hair follicle cycling and hair shaft differentiation in mice. Development 131:1825–1833.
View Article
Google Scholar

[33] View Article

[34] Google Scholar

[ref13] 13. Andl T, Ahn K, Kairo A, Chu EY, Wine-Lee L, et al. (2004) Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 131:2257–2268.
View Article
Google Scholar

[36] View Article

[37] Google Scholar

[ref14] 14. Merrill BJ, Gat U, DasGupta R, Fuchs E (2001) Tcf3 and Lef1 regulate lineage differentiation of multipotent stem cells in skin. Genes Dev 15:1688–1705.
View Article
Google Scholar

[39] View Article

[40] Google Scholar

[ref15] 15. Pan Y, Lin MH, Tian X, Cheng HT, Gridley T, et al. (2004) gamma-secretase functions through Notch signaling to maintain skin appendages but is not required for their patterning or initial morphogenesis. Dev Cell 7:731–743.
View Article
Google Scholar

[42] View Article

[43] Google Scholar

[ref16] 16. Ellis T, Gambardella L, Horcher M, Tschanz S, Capol J, et al. (2001) The transcriptional repressor CDP (Cutl1) is essential for epithelial cell differentiation of the lung and the hair follicle. Genes Dev 15:2307–2319.
View Article
Google Scholar

[45] View Article

[46] Google Scholar

[ref17] 17. Kaufman CK, Zhou P, Pasolli HA, Rendl M, Bolotin D, et al. (2003) GATA-3: an unexpected regulator of cell lineage determination in skin. Genes Dev 17:2108–2122.
View Article
Google Scholar

[48] View Article

[49] Google Scholar

[ref18] 18. Godwin AR, Capecchi MR (1998) Hoxc13 mutant mice lack external hair. Genes Dev 12:11–20.
View Article
Google Scholar

[51] View Article

[52] Google Scholar

[ref19] 19. Dai X, Segre JA (2004) Transcriptional control of epidermal specification and differentiation. Curr Opin Genet Dev 14:485–491.
View Article
Google Scholar

[54] View Article

[55] Google Scholar

[ref20] 20. Li SR, Wang DP, Yu XL, Ge BS, Wang CE, et al. (1999) Uncv (uncovered): a new mutation causing hairloss on mouse chromosome 11. Genet Res 73:233–238.
View Article
Google Scholar

[57] View Article

[58] Google Scholar

[ref21] 21. Liu B, Xu Y, Li WL, Zeng L (2014) Proteomic analysis of differentially expressed skin proteins in iRhom2Uncv mice. BMB Rep.

[ref22] 22. Shi YZ, Wang DP, Hu LD, Zhao GP, Wang YZ, et al. (2003) A high-resolution genetic and physical map of a mouse coat abnormality locus (Uncv). Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 35:397–402.
View Article
Google Scholar

[61] View Article

[62] Google Scholar

[ref23] 23. Muller-Rover S, Handjiski B, van der Veen C, Eichmuller S, Foitzik K, et al. (2001) A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J Invest Dermatol 117:3–15.
View Article
Google Scholar

[64] View Article

[65] Google Scholar

[ref24] 24. Ramirez A, Vidal M, Bravo A, Jorcano JL (1998) Analysis of sequences controlling tissue-specific and hyperproliferation-related keratin 6 gene expression in transgenic mice. DNA Cell Biol 17:177–185.
View Article
Google Scholar

[67] View Article

[68] Google Scholar

[ref25] 25. O'Guin WM, Sun TT, Manabe M (1992) Interaction of trichohyalin with intermediate filaments: three immunologically defined stages of trichohyalin maturation. J Invest Dermatol 98:24–32.
View Article
Google Scholar

[70] View Article

[71] Google Scholar

[ref26] 26. Lynch MH, O'Guin WM, Hardy C, Mak L, Sun TT (1986) Acidic and basic hair/nail (“hard”) keratins: their colocalization in upper cortical and cuticle cells of the human hair follicle and their relationship to “soft” keratins. J Cell Biol 103:2593–2606.
View Article
Google Scholar

[73] View Article

[74] Google Scholar

[ref27] 27. Watt FM, Estrach S, Ambler CA (2008) Epidermal Notch signalling: differentiation, cancer and adhesion. Curr Opin Cell Biol 20:171–179.
View Article
Google Scholar

[76] View Article

[77] Google Scholar

[ref28] 28. Bozkulak EC, Weinmaster G (2009) Selective use of ADAM10 and ADAM17 in activation of Notch1 signaling. Mol Cell Biol 29:5679–5695.
View Article
Google Scholar

[79] View Article

[80] Google Scholar

[ref29] 29. Brou C, Logeat F, Gupta N, Bessia C, LeBail O, et al. (2000) A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol Cell 5:207–216.
View Article
Google Scholar

[82] View Article

[83] Google Scholar

[ref30] 30. Murthy A, Shao YW, Narala SR, Molyneux SD, Zuniga-Pflucker JC, et al. (2012) Notch activation by the metalloproteinase ADAM17 regulates myeloproliferation and atopic barrier immunity by suppressing epithelial cytokine synthesis. Immunity 36:105–119.
View Article
Google Scholar

[85] View Article

[86] Google Scholar

[ref31] 31. Stephenson NL, Avis JM (2012) Direct observation of proteolytic cleavage at the S2 site upon forced unfolding of the Notch negative regulatory region. Proc Natl Acad Sci U S A 109:E2757–2765.
View Article
Google Scholar

[88] View Article

[89] Google Scholar

[ref32] 32. Spaulding C, Reschly EJ, Zagort DE, Yashiro-Ohtani Y, Beverly LJ, et al. (2007) Notch1 co-opts lymphoid enhancer factor 1 for survival of murine T-cell lymphomas. Blood 110:2650–2658.
View Article
Google Scholar

[91] View Article

[92] Google Scholar

[ref33] 33. Lin MH, Kopan R (2003) Long-range, nonautonomous effects of activated Notch1 on tissue homeostasis in the nail. Dev Biol 263:343–359.
View Article
Google Scholar

[94] View Article

[95] Google Scholar

[ref34] 34. Fuchs E (2007) Scratching the surface of skin development. Nature 445:834–842.
View Article
Google Scholar

[97] View Article

[98] Google Scholar

[ref35] 35. Johnson KR, Lane PW, Cook SA, Harris BS, Ward-Bailey PF, et al. (2003) Curly bare (cub), a new mouse mutation on chromosome 11 causing skin and hair abnormalities, and a modifier gene (mcub) on chromosome 5. Genomics 81:6–14.
View Article
Google Scholar

[100] View Article

[101] Google Scholar

[ref36] 36. Peschon JJ, Slack JL, Reddy P, Stocking KL, Sunnarborg SW, et al. (1998) An essential role for ectodomain shedding in mammalian development. Science 282:1281–1284.
View Article
Google Scholar

[103] View Article

[104] Google Scholar

[ref37] 37. Franzke CW, Cobzaru C, Triantafyllopoulou A, Loffek S, Horiuchi K, et al. (2012) Epidermal ADAM17 maintains the skin barrier by regulating EGFR ligand-dependent terminal keratinocyte differentiation. J Exp Med 209:1105–1119.
View Article
Google Scholar

[106] View Article

[107] Google Scholar

[ref38] 38. Christova Y, Adrain C, Bambrough P, Ibrahim A, Freeman M (2013) Mammalian iRhoms have distinct physiological functions including an essential role in TACE regulation. EMBO Rep.

[ref39] 39. Radtke F, Raj K (2003) The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nat Rev Cancer 3:756–767.
View Article
Google Scholar

[110] View Article

[111] Google Scholar

[ref40] 40. Weinmaster G (2000) Notch signal transduction: a real rip and more. Curr Opin Genet Dev 10:363–369.
View Article
Google Scholar

[113] View Article

[114] Google Scholar

[ref41] 41. Ross DA, Kadesch T (2001) The notch intracellular domain can function as a coactivator for LEF-1. Mol Cell Biol 21:7537–7544.
View Article
Google Scholar

[116] View Article

[117] Google Scholar

[ref42] 42. Li HY, Liu H, Wang CH, Zhang JY, Man JH, et al. (2008) Deactivation of the kinase IKK by CUEDC2 through recruitment of the phosphatase PP1. Nat Immunol 9:533–541.
View Article
Google Scholar

[119] View Article

[120] Google Scholar

[ref43] 43. Yang L, Mao C, Teng Y, Li W, Zhang J, et al. (2005) Targeted disruption of Smad4 in mouse epidermis results in failure of hair follicle cycling and formation of skin tumors. Cancer Res 65:8671–8678.
View Article
Google Scholar

[122] View Article

[123] Google Scholar

[ref44] 44. Yang L, Wang L, Yang X (2009) Disruption of Smad4 in mouse epidermis leads to depletion of follicle stem cells. Mol Biol Cell 20:882–890.
View Article
Google Scholar

[125] View Article

[126] Google Scholar

Figures

Abstract

Introduction

Results

Pattern of iRhom2 expression in the mouse

Aberrant hair shaft and inner root sheath differentiation in iRhom2Uncv/Uncv mice

The iRhom2Uncv mutant protein cannot induce the maturation of TACE

Expression levels of regulators of inner root sheath and hair shaft differentiation in iRhom2Uncv/Uncv follicles

Discussion

Materials and Methods

Mouse strains and genotyping

Plasmid construction

Cell culture, transfection and immunoprecipitation

Histological analysis, immunohistochemistry and immunofluorescence

Terminal deoxyribonucleotidyl transferase-mediated dUTP nick-end labeling assay

RNA isolation and real-time PCR

Luciferase assays

Statistical analysis

Supporting Information

S1 Fig.

S2 Fig.

S3 Fig.

S4 Fig.

S5 Fig.

Acknowledgments

Author Contributions

References

Aberrant hair shaft and inner root sheath differentiation in iRhom2^Uncv/Uncv mice

The iRhom2^Uncv mutant protein cannot induce the maturation of TACE

Expression levels of regulators of inner root sheath and hair shaft differentiation in iRhom2^Uncv/Uncv follicles