miR-101 Suppresses Vascular Endothelial Growth Factor C That Inhibits Migration and Invasion and Enhances Cisplatin Chemosensitivity of Bladder Cancer Cells

Ye Lei; Bin Li; Shiyu Tong; Lin Qi; Xiheng Hu; Yunbo Cui; Zengbo Li; Wei He; Xiongbing Zu; Zhi Wang; Minfeng Chen

doi:10.1371/journal.pone.0117809

Abstract

Background

The microRNA miR-101 is downregulated in several cancers, including bladder cancer. However, miR-101’s role in the invasion, metastasis, and chemosensitivity of bladder cancer cells remains unclear. This study was conducted to determine miR-101’s role on the lymphangiogenic molecule vascular endothelial growth factor C (VEGF-C) and their effects upon bladder cancer cell migration, invasion, and chemosensitivity to cisplatin.

Methods

Two bladder cancer cell lines (T24 and 5637) and the tool cell line 293T were employed here. Bladder cancer cells were transfected with either a miR-101 overexpression vector or a scrambled-sequence lentivirus, both of which exhibited a high transfection efficiency. Non-transfection was used as a mock negative control. Wound healing and Transwell assays were performed to measure cell migration and invasiveness. A luciferase reporter assay was performed to validate miR-101’s interaction with VEGF-C’s 3′ untranslated region followed by RT-PCR and Western blot confirmation. An MTS assay was used to evaluate the cisplatin sensitivity of the cell lines.

Results

miR-101 overexpression significantly inhibited the migration and invasiveness while significantly enhancing cisplatin sensitivity. miR-101 negatively regulated VEGF-C protein expression, and VEGF-C overexpression rescued the effects of miR-101 overexpression, indicating that miR-101 negatively regulates VEGF-C protein expression post-transcriptionally. miR-101 and VEGF-C interference independently enhanced cisplatin cytotoxicity in bladder cancer cells.

Conclusions

miR-101 suppresses VEGF-C expression, inhibits cell migration and invasion, and increases cisplatin sensitivity in bladder cancer cells. This study provides new insight into miR-101’s role in bladder cancer and shows miR-101’s promise as a potential molecular target for bladder cancer.

Citation: Lei Y, Li B, Tong S, Qi L, Hu X, Cui Y, et al. (2015) miR-101 Suppresses Vascular Endothelial Growth Factor C That Inhibits Migration and Invasion and Enhances Cisplatin Chemosensitivity of Bladder Cancer Cells. PLoS ONE 10(2): e0117809. https://doi.org/10.1371/journal.pone.0117809

Academic Editor: Ming Tan, University of South Alabama, UNITED STATES

Received: August 21, 2014; Accepted: December 30, 2014; Published: February 6, 2015

Copyright: © 2015 Lei et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: This work was supported by the National Nature Science Foundation for the Youth of China (No. 81202005), the Technology Plan Fund of Hunan Science (No. 2013FJ4109), and the Central South University Innovation Fund for Independent Graduate Exploration (No. 72150050587). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Bladder cancer is the most common urinary tract malignancy, producing approximately 150,000 annual deaths worldwide [1] and is clinically characterized by its progression, recurrence, metastasis, and drug resistance [2, 3]. Despite aggressive chemotherapy, 10–20% of non-muscle-invasive bladder cancers ultimately progress to muscle invasive bladder cancers [4]. Enrichment of blood and lymph vessels in the urothelial lamina propria, blood vessel invasion, invasion depth, and regional lymph node status have been identified as independent prognostic factors of tumor-free survival post-cystectomy, with the majority of cases of stage II and above distally recurring with each additional positive lymph node increasing the mortality risk by 20% [5,6]. Although cisplatin is the first-line chemotherapy for advanced bladder cancer, the cisplatin/gemcitabine (GC) regimen has a median time-to-progression of only six months and has no effect on overall survival after radical cystectomy in high-risk patients [7]. Despite radical cystectomy or preoperative chemotherapy, uncontrolled lymphovascular invasion of bladder cancer continues to yield a poor clinical prognosis [8–10]. Therefore, further research on bladder cancer’s progression, recurrence, metastasis, and chemotherapeutic efficacy is needed.

MicroRNAs (miRNA) are phylogenetically-conserved small non-coding RNAs that negatively regulate targeted mRNA 3′ untranslated regions (3′UTR) in several cancers and have been increasingly identified as tumor suppressors or carcinogenic agents [11–13]. Moreover, multiple miRNAs have been previously associated with chemotherapeutic sensitivity in several cancer cell lines, including bladder cancer [14]. In particular, miR-101 has been well-established as a tumor suppressor with inhibitory effects on cellular proliferation, migration, and invasion. Specifically, lower miR-101 levels have been previously associated with bladder cancer [15] as well as prostate [16], ovarian [17], colorectal [18], liver [19], gastric [20], lung [21], breast [22], thyroid [23], and melanoma [24] cancers. With respect to bladder cancer, miRNA profiling of bladder transitional cell carcinoma (TCC) samples has revealed that miR-101 is downregulated in TCC, and that miR-101 inhibits cell proliferation and colony formation in TCC cell lines through directly repressing the histone methyltransferase EZH2 [15]. However, miR-101’s role (if any) in the invasion, metastasis, and chemosensitivity of bladder cancer cells remains unclear.

VEGF-C, a member of vascular endothelial growth factor (VEGF) family, is regarded as an important lymphangiogenic molecule and is known to increase the permeability of lymphatic vessels [25–27]. In cancer, VEGF-C is positively correlated with lymphatic spread in bladder cancer, enhances lung adenocarcinoma cell migration to lymphatic vessels, and modulates cisplatin resistance in gastric cancer cells [28,29,38]. Although bladder cancer is known to primarily spread through the lymphatics (with metastasis found most commonly in the regional pelvic nodes) [30], no study has yet identified a relationship (if any) between miR-101 with VEGF-C in bladder cancer cells. In the current study, miR-101 was shown to have an effect on bladder cancer cell migration, invasion, and cisplatin sensitivity by directly regulating its functional target VEGF-C. This data suggests that miR-101 may be a potential molecular target for bladder cancer therapy.

Materials and Methods

Cell Culture

The bladder cancer cell lines T24 and 5637 as well as the human embryonic kidney tool cell line 293T used in this study were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and were maintained in RPMI-1640 (Gibco, Grand Island, NY, USA) and Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Grand Island, NY, USA), respectively, supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. All cell lines were incubated at 37- in humidified 5% CO₂.

Plasmid Construction and Lentivirus Preparation

A fragment of miR-101 was generated by using the following primers: sense, 5′-CGGGTACCGGTAGTCCTTCACTTCATGGGGAG-3′ and antisense, 5′-CGGAATTCAAA- AAACCCAGCCACCTGTTTCAC-3′ and inserted into the GV209 vector with a green fluorescent protein (GFP) reporter gene within the AgeⅠand EcoRⅠrestriction sites. The aforementioned miR-101 plasmid, pHelper1.0, and pHelper2.0 were co-transfected into 293T cells, and the lentiviral particle-enriched supernatant was obtained 48 h later. A scrambled sequence (5′-TTCTCCGAACGTGTCACGT-3′), which had no homology with the human gene, was used as a scrambled negative control. The VEGF-C cDNA was amplified using the following primers: sense, 5′-TCCGCTCGAGATGCACTTGCTGG- GCTTCTTC-3′ and antisense, 5′-ATGGGGTACCGTGCTCATTTGTGGTCTTTTCC-3′ and cloned into the GV147 vector with a red fluorescent protein (RFP) reporter gene containing the restriction enzyme sites XhoⅠand Kpn I. Non-transfection was used as a mock negative control (S1 Data). All sequences in the experiments were confirmed by sequencing as follows: VEGF-C siRNA, sense, 5′-AGAUCUGGAGGAGCAGUUAUU-3′ and antisense, 5′-UAACUGCUCCUCCAGAUCUUU-3′; negative control siRNA, sense, 5′-UACUCACUACUCGAGAUGCUU-3′ and antisense, 5′-GCAUCUCGAGUAGUGAGUAUU-3′. Then, the synthesized pair of complementary VEGF-C shRNA were placed into a pGenesil-1 vector (Genesil, Wuhan). Fluorescence-activated cell sorting (FACS) (Epics Altra Flow Cytosorter, Beckman, USA) was used for select GFP+ or RFP+ cells according to the manufacturer’s recommended procedure. The transfection efficiency of miR-101 (GFP) and VEGF-C (RFP) was calculated as follows: miR-101 transfection efficiency = GFP+ cell count/total cell count x 100%, and VEGF-C transfection efficiency = RFP+/total cell count x 100%. On this basis, the transfection efficiencies for miR-101 (GFP) and VEGF-C (RFP) were found to be 99% and 40%, respectively.

RNA Isolation and Quantitative PCR

Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Isolated RNA was measured using a Nanodrop 1000 spectrophotometer (Thermo Scientific, DE, USA) with an OD₂₆₀/OD₂₈₀ ratio greater than 1.8 used for cDNA synthesis. The reverse transcription of miR-101 and its specific amplification were performed using a miRNA qRT-PCR Detection Kit (GeneCopoeia, MD, USA). U6 was used as an endogenous control. cDNA synthesis of VEGF-C was performed using a First-Strand cDNA Synthesis Kit (GeneCopoeia, MD, USA), and the real-time quantitative PCR (RT-qPCR) reaction of VEGF-C was performed using qPCR Mix (GeneCopoeia, MD, USA). GAPDH was used for VEGF-C template normalization. All primers were purchased from GeneCopeia. miR-101 and VEGF-C amplification were determined on a ROTOR-GENE 3000 platform. The target PCR threshold cycle (Ct) values were normalized by subtracting the U6 or GADPH Ct value, which provided the ΔCt value. Relative expression was calculated using the following equation: relative gene expression level = 2 ^{-(ΔCt experimental group-ΔCt control group}).

Western Blot Analysis

RIPA lysis buffer containing 1 mM PMSF was added to the cells in six-well plates and then centrifuged for 10 min at 4-. The total protein content of the supernatant was determined by the Lowry method. The protein sample was diluted, heated for denaturation, and then subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After the proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, MA, USA), 5% skimmed milk powder was applied for 2 h at 37-. Then, 1:1000 dilutions of rabbit polyclonal primary antibody anti-VEGF-C (Cell Signaling Technology, MA, USA) or anti-β-actin (which served as a loading control; Bioworld Technology, Inc, USA) was incubated with the membrane overnight. The next day, the membrane was rinsed in TBST three times and then incubated with a fluorescent secondary anti-rabbit antibody for 2 h. The membrane was scanned by an infrared imaging system (Odyssey), and the band intensity was detected by Odyssey 3.0 analysis software.

VEGF-C 3’UTR Wild Type and Mutant Type Construction and Luciferase Reporter Assay

TargetScan analysis was used to discover a seven-nucleotide complementary sequence between miR-101 and the VEGF-C 3′UTR. A wild type (wt) VEGF-C 3′UTR sequence including Xba1 restriction sites (5′-TCTAGAACGAACCGCCAGAAGGCTTGTGAGCCAGGATTTTCATATAGTGAAG- AAGTGTGTCGTTGTGTCCCTTCATATTGGAAAAGACCACAAATGAGCTAAGATTGTACTGTTTTCCAGTTCATCGATTTTCTATTATGGAAAACTGTGTTGCCACAGTAGAACTGTCTGTGAACAGAGAGACCCTTGTGGGTCCATGCTAACAAAGACAAATCTAGA-3′) in addition to a mutant type (mut) VEGF-C 3′UTR sequence with a completely different miR-101-binding sequence, were synthesized and each independently cloned into separate GV272 luciferase reporter vectors (Genechem, Shanghai, China). The previously described miR-101-overexpressing or scrambled-sequence plasmid along with either a wt or mut VEGF-C 3′UTR plasmid were co-transfected into 293T cells using Lipofectamine 2000 reagent (Invitrogen, CA, USA), creating four experimental groups. Then, 293T cell luciferase assays were performed to determine the interaction between miR-101 and the wt and mut VEGF-C 3′-UTR. Renilla and firefly luciferase activities were measured at 48 h post-transfection using the Dual-Glo Luciferase Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer’s protocols. The ratio of renilla-to-firefly luciferase value was recorded (S1 Table). Experiments were performed in triplicate wells, and the data represents the mean of five independent experiments.

Wound Healing Assay

The target cells, including T24 and 5637 cells, were transfected with recombinant lentivirus (1×10⁸ transducing units/ml) and polybrene (5 ug/ml). After 48 h, a trypsinized single cell suspension was prepared and seeded in six-well dishes (5×10⁵/well) until the cells reached 80% confluence. Then, 1-ml sterile pipette tip was used to scrape a cross in the center (similar to a wound), rinsed with PBS three times, and the serum-free medium was replaced immediately. Cells were allowed to migrate for 24 h, and the scratches were carefully observed and photographed. Light microscopic and fluorescent images were captured with an Olympus IX71 microscope. The gap lengths were also calculated from the photomicrographs. Each cell line was measured in triplicate.

Transwell Assay

A Transwell chamber (Corning Corporation, MA, USA) with 8-μm polyester membrane filter pores, was used for both the invasion assay and migration assay. The difference between the invasion assay and the migration assay was that the invasion assay used coated Matrigel (BD Bioscience, MD, USA) in the upper chamber, which simulated the characteristics of the extracellular matrix, while the migration assay did not. A total of 2×10⁵ lentivirus-infected cells were seeded into the upper chamber with 200 μl serum-free medium. A total of 500 μl medium containing 20% FBS was added to the lower chamber. After incubation for 24 h, the cells adhering to the lower surface of the membrane on the upper chamber were fixed in 90% ethanol for 10 min, stained with 0.1% crystal violet, counted in three random shots by microscopy, and photographed. The average number of cells in the three random shots were reported. All experiments were performed in triplicate.

MTS Assay

The cell suspension was seeded in 96-well culture plates at a density of 4×10³ cells/well (0.2 ml/well) for 24 h before use. The culture medium was replaced with fresh medium containing cisplatin with different concentrations for 72 h. Next, MTS (20 μl/well) was added to each well, and the absorbance at 490 nm of each well was recorded with a universal microplate reader (Bio-Rad Hercules, CA, USA) after 3 h. Dose-inhibition rate curves were plotted according to absorbance values. The IC50 value (the 50% maximal inhibitory concentration of cisplatin) was also calculated. The assay was repeated in triplicate.

Statistical Analysis

Results were expressed as means ± SDs. All data were analyzed using SPSS software version 21.0. Experiments were statistically analyzed by Student’s t-test or one-way ANOVA. P<0.05 was deemed to be statistically significant.

Results

miR-101 Inhibits Bladder Cancer Cell Migration and Invasion

Due to previous findings of lower miR-101 expression in bladder cancer [15,31], we constructed a miR-101 overexpression plasmid and packaged it into lentiviral vector. Bladder cancer cells were transfected with either a miR-101 overexpression vector or a scrambled-sequence lentivirus (scrambled negative control), both of which exhibited a high transfection efficiency (Fig. 1A). Non-transfection was used as a mock negative control. We then examined the cell migration and invasion ability of these bladder cancer cells. The wound healing assay and Transwell migration assay showed that cell migration was significantly inhibited by the miR-101-overexpressing lentivirus (Fig. 1B, 1C). The inhibitory effect of miR-101 on cell invasion was confirmed by the Transwell invasion assay. As a result, both T24 and 5637 miR-101-overexpressing cells in the bottom surface of the upper chamber exhibited dramatically inhibited invasiveness compared to their scrambled-sequence-transfected counterparts (Fig. 1D).

Download:

Fig 1. miR-101 Overexpression Suppresses Migration and Invasion of T24 and 5637 Bladder Cancer Cells.

(A) Normalized miR-101 mRNA levels detected by RT-qPCR. (B) The open wound % (wound field_final/wound field_initial x 100%) from the wound healing assay after transfection. (C) Representative images of migrated cells with the number of migrated cells per field. Note: T24 cells have a stronger affinity for crystal violent dye. Thus, although the image appears to show more abundant staining for T24 cells, the T24 cell counts were actually lower compared to those of 5637 cell. (D) Representative images of invasive cells penetrating the coated Matrigel and the number of invading cells per field. Data presented as means ± SDs. *p<0.05, **p<0.01.

https://doi.org/10.1371/journal.pone.0117809.g001

miR-101 Directly Targets VEGF-C in 293T Cells

To evaluate the molecular mechanism(s) of miR-101, TargetScan analysis found that VEGF-C is a potential target gene for miR-101, as there is a seven-nucleotide complementary sequence between miR-101 and the VEGF-C 3′UTR (Fig. 2A). Thus, a luciferase reporter assay showed that miR-101 upregulation significantly decreased the luciferase activity of wild-type VEGF-C but not the mutant VEGF-C (Fig. 2B). Then, RT-qPCR and Western blotting was used to assess the VEGF-C mRNA and protein levels, respectively (Fig. 2C, 2D). miR-101 overexpression significantly inhibited VEGF-C protein expression but did not significantly inhibit VEGF-C mRNA expression in both T24 and 5637 cells, suggesting post-transcriptional regulation of VEGF-C by miR-101.

Download:

Fig 2. miR-101 Overexpression Directly Targets VEGF-C in T24 and 5637 Bladder Cancer Cells.

(A) The potential binding sites for miR-101 on the seven bp-seed sequences of the 3′UTR region of VEGF-C. The mutant type was constructed at this seed region as underlined (wt: wild type, mut: mutant type). (B) Firely/Renilla luciferase activity after transfection with wt and mut VEGF-C 3′UTR and either miR-101-overexpressing vector or a scrambled-sequence vector. (C) VEGF-C mRNA expression measured by RT-qPCR in transfected cell lines showing no significant differences in VEGF-C mRNA expression across the three transfection states. (D) Western blot analysis of VEGF-C expression in transfected cell lines showing miR-101 overexpression significantly suppressing VEGF-C protein expression. Data presented as means ± SDs. **p<0.01.

https://doi.org/10.1371/journal.pone.0117809.g002

VEGF-C Overexpression Rescues miR-101’s Invasion Effects

To verify the role of VEGF-C in the bladder cancer cell lines, we performed rescue experimentation (S1 Fig.). After T24 cells were transfected with the miR-101 lentivirus for 48 h, they were transiently transfected with a VEGF-C overexpression plasmid (Fig. 3A) to investigate the recovery of cell mobility. The Transwell invasion assay showed that the subsequent transfection of VEGF-C partially recovered the cells’ invasion ability compared to the VEGF-C negative control and non-transfected groups (Fig. 3B). As expected, the VEGF-C protein level was rescued (Fig. 3C). Thus, inhibition of bladder cancer cell invasion by miR-101 is likely a consequence of decreased VEGF-C expression.

Download:

Fig 3. VEGF-C Overexpression Rescues miR-101 Overexpression Thereby Suppressing Invasion of T24 and 5637 Bladder Cancer Cells.

(A) Representative images of bladder cancer cells simultaneously transfected with miR-101/green fluorescent protein (miR-101/GFP) and VEGF-C/red fluorescent protein (VEGF-C/RFP). (B) Representative images of invasive cells penetrating the coated Matrigel transfected with either miR-101, miR-101 and VEGF-C (miR-101/VEGF-C(+)), miR-101 and a negative control of VEGF-C (miR-101/VEGF-C(-)), or non-transfection (mock). (C) Western blot analysis validating VEGF-C protein expression in the transfected cell lines.

https://doi.org/10.1371/journal.pone.0117809.g003

miR-101 Overexpression and VEGF-C Knockdown Independently Enhance Bladder Cell Sensitivity to Cisplatin

miR-101 overexpression increased the sensitivity of both T24 and 5637 cells to cisplatin, with the IC50 value increasing from 4.06 ± 0.69 mg/l to 9.17 ± 1.24 mg/l and from 2.96 ± 0.46 mg/l to 5.56 ± 0.36 mg/l, respectively (Fig. 4A, 4B). In order to determine VEGF-C’s role in cisplatin sensitivity, a VEGF-C interference plasmid was constructed and transfected into the bladder cancer cell lines (Fig. 5A). The sensitivity of T24 and 5637 cells to cisplatin increased after VEGF-C interference, with the IC50 value increasing from 2.56 ± 0.31 mg/l to 8.23 ± 0.83 mg/l and from 3.01 ± 0.5 5mg/l to 5.42 x 0.52 mg/l, respectively (Fig. 5B, 5C). These results suggest that VEGF-C downregulation, as the downstream target of miR-101, enhances bladder cancer cell sensitivity to cisplatin.

Download:

Fig 4. miR-101 Overexpression Enhances Cisplatin Sensitivity of T24 and 5637 Bladder Cancer Cells.

(A) Plots of dose inhibition rate curves for cisplatin measuring cell counts after transfection with either miR-101-overexpressing or scrambled-sequence lentivirus. (B) IC50 values significantly reduced upon miR-101 overexpression. Data presented as means ± SDs. **p<0.01.

https://doi.org/10.1371/journal.pone.0117809.g004

Download:

Fig 5. VEGF-C Knockdown Enhances Cisplatin Sensitivity of T24 and 5637 Bladder Cancer Cells.

(A) Western blot analysis of VEGF-C expression in cell lines transfected with VEGF-C shRNA or control shRNA. (B) Plots of dose inhibition rate curves for cisplatin measuring cell counts after transfection with VEGF-C shRNA or control shRNA. (C) IC50 value significantly reduced after VEGF-C knockdown. Data presented as means ± SDs. **p<0.01.

https://doi.org/10.1371/journal.pone.0117809.g005

VEGF-C Overexpression Rescues miR-101-Induced Cisplatin Sensitivity

After T24 cells were transfected with the miR-101 lentivirus for 48 h, they were then transiently transfected with either a VEGF-C overexpression plasmid, a VEGF-C control plasmid, or a VEGF-C shRNA plasmid. We found that VEGF-C overexpression partially recovered bladder cancer cell sensitivity to cisplatin compared the VEGF-C control with IC50 values of10.05 ± 1.05 mg/l and 3.14 ± 1.02 mg/l to 0.63 ± 0.16 mg/l, respectively (Fig. 6A, 6B). Moreover, shVEGF-C more significantly enhanced bladder cancer cell sensitivity to cisplatin compared to the VEGF-C control (Fig. 6A, 6B).

Download:

Fig 6. VEGF-C Rescues miR-101-Induced Sensitivity to Cisplatin.

(A) Plots of dose inhibition rate curves for cisplatin measuring cell counts after transfection with either miR-101 and VEGF-C (miR-101/VEGF-C(+)), miR-101 and a negative control of VEGF-C (miR-101/VEGF-C(-)), or miR-101 and VEGF-C shRNA (miR-101/shVEGF-C). (B) The IC50 value was significantly increased after transfection with miR-101/VEGF-C(+).

https://doi.org/10.1371/journal.pone.0117809.g006

Discussion

Emerging evidence shows that miR-101 expression is lost in bladder cancer tissues and bladder cancer cell lines [15,31]. The NDY1/KDM2B-miR-101-EZH2 axis has been identified as active in bladder cancer cells [32], wherein miR-101 suppresses the motility of T24 bladder cancer cells by targeting c-Met’s 3′-UTR [33]. However, the detailed molecular mechanism(s) of miR-101’s role in bladder cancer cells remains to be elucidated. Therefore, by utilizing a TargetScan-based bioinformatic approach to search for potential miR-101 targets, we identified VEGF-C as a potential miR-101 target. We then constructed a miR-101-overexpressing lentivirus for transfection into the T24 and 5637 bladder cancer cell lines and demonstrated that miR-101 overexpression inhibits bladder cancer cell migration and invasion. Moreover, we demonstrated that miR-101 negatively regulates VEGF-C protein expression, and VEGF-C overexpression rescues the effects of miR-101 overexpression, suggesting that miR-101 negatively regulates VEGF-C expression post-transcriptionally. Finally, we showed that both miR-101 and VEGF-C interference independently enhanced cisplatin cytotoxicity in bladder cancer cells, and VEGF-C also rescued miR-101’s effect on bladder cancer cell sensitivity to cisplatin.

The production and secretion of VEGFs—potent stimulators of angiogenesis that affect endothelial cell proliferation and motility as well as vascular permeability—has been commonly observed in several aggressive tumor types and significantly influences the prognosis of cancer patients [28], Although VEGF-C has been shown to have angiogenic effects on endothelial cells [34], VEGF-C primarily acts lymphatically through the Flt4/VEGFR-3 and KDR/VEGFR-2 receptor tyrosine kinases [35], which are exclusively expressed in the lymphatic endothelium and high venular endothelium of lymph nodes in normal adult tissues. For example, VEGF-C overexpression has been shown to produce lymphatic endothelial proliferation and selective hyperplasia of the lymphatic vasculature [36].

With respect to VEGF-C’s role in malignancy, VEGF-C mRNA expression was initially detected in a mixed set of solid human tumors with VEGF-C’s role in lymphangiogenesis providing a possible mechanism for metastasis via newly-formed lymphatic vessels [37]. Later studies discovered that VEGF-C’s primary receptor Flt4/VEGFR-3 is expressed in a variety of human malignancies, including lung, colorectal, prostate, and squamous cell carcinomas of the head and neck as well as Kaposi’s sarcoma [28]. Moreover, positive correlations have been found between VEGF-C expression and lymphatic spread in bladder TCC [38] as well as in prostate [39], colorectal [40], gastric [41], thyroid [42], and neuroblastoma cancers [43]. VEGF-C downregulation reduces murine lung and colon cancer metastases, and Flt4/VEGFR-3 inhibition has been associated with reduced angiogenesis/lymphangiogenic activities as well as reduced growth and metastasis in breast, pancreatic, and ovarian cancers, paving the way for the development and testing of VEGFR3 inhibitors as targeted chemotherapeutics [44]. Here, miR-101 overexpression repressed VEGF-C protein expression, impairing bladder cancer cell migration and invasion in vitro in the absence of lymphangiogenesis. These findings suggest that VEGF-C acts through non-lymphangiogenic mechanism(s) in promoting bladder tumor progression. Further research is required to determine the downstream affector(s) of the VEGF-C-Flt4/VEGFR-3 axis in bladder cancer cells that promote bladder cancer cell mobility.

Cisplatin chemotherapy remains the first-line treatment for locally advanced bladder cancer, so cisplatin resistance is a major clinical issue for bladder cancer patients [45]. Although we found no previous work investigating miR-101’s role on cisplatin resistance in bladder cancer cells, miR-101 expression has been shown to be downregulated in docetaxel-induced cisplatin cross-resistant head and neck squamous cell carcinoma cell lines [46], while miR-101 has been shown to synergize with cisplatin, doxorubicin, and fluorouracil in inducing apoptosis in hepatocellular carcinoma cells [47,48]. As miR-101’s antagonist, VEGF-C promotes cisplatin resistance in gastric cancer cells [29], and VEGF-C upregulation results in tumor resistance to anti-VEGF therapy in a murine lung cancer model [49]. In agreement with these previous findings, here both miR-101 and VEGF-C interference were shown to independently enhance cisplatin cytotoxicity in bladder cancer cells, and VEGF-C also rescued miR-101’s effect on bladder cancer cell sensitivity to cisplatin. However, the mechanism(s) underlying VEGF-C’s role in the cisplatin resistance of bladder cancer cells remains unknown and requires further study.

There are two limitations to this study. First, this study shows that VEGF-C plays a key role in bladder cancer cell migration, invasion, and cisplatin chemosensitivity and is a direct target of miR-101. However, this fact does not preclude the possibility that miR-101 has other targets that have similar cellular functions to VEGF-C. Using the TargetScan database, we found 803 transcripts that are predicted to be targets of hsa-miR-101, including EZH2, BTBD3, NLK, and MITF. Further study is needed to determine whether these 803 putative targets are actual targets of miR-101 and whether any such protein targets are associated with bladder cancer cell migration, invasion, and cisplatin chemosensitivity. Second, previous work has shown that miR-101 is downregulated in TCC and that miR-101 inhibits TCC cell proliferation and colony formation through directly repressing the histone methyltransferase EZH2 [15]. Therefore, in this study, we did not assess miR-101’s effects upon bladder cancer cell proliferation but rather specifically focused on miR-101’s influence on bladder cancer cell migration and invasion through VEGF-C. Thus, whether or not the miR-101-VEGF-C axis affects bladder cancer cell proliferation remains an open question. Third, the transfection efficiency of miR-101 lentivirus was 99%, but the transfection efficiency of the VEGF-C plasmid was only 40%; due to technical photographic issues, we assumed that all cells were miR-101+ (GFP+) and thereby selected cells by FACS solely on the basis of VEGF-C+ (RFP+). In short, VEGF-C+ (RFP+) cells were deemed double-positive cells. Due to this technical limitation, it was difficult to appropriately assess co-localization of miR-101 and VEGF-C mRNA.

In summary, we demonstrate miR-101 post-transcriptionally suppresses VEGF-C expression, inhibits bladder cancer cell migration and invasion, and increases cisplatin sensitivity. Although further research is needed to identify other relevant targets of miR-101, this study provides new insight into miR-101’s role in bladder cancer and shows miR-101’s promise as a potential molecular target for bladder cancer.

Supporting Information

S1 Data. The Construction of miR-101-overexpression Plasmid and VEGF-C-overexpression Plasmid

https://doi.org/10.1371/journal.pone.0117809.s001

(DOC)

S1 Fig. Representative Image of Bladder Cancer T24 Cells Simultaneously Transfected with miR-101/green fluorescent Protein (miR-101/GFP) and VEGF-C/red fluorescent protein (VEGF-C/RFP)

https://doi.org/10.1371/journal.pone.0117809.s002

(TIF)

S1 Table. Firely/Renilla Luciferase Analyses of the Transfection with wt and mut VEGF-C 3′UTR and Either miR-101-overexpressing Vector or a Scrambled-sequence Vector.

https://doi.org/10.1371/journal.pone.0117809.s003

(XLSX)

Author Contributions

Conceived and designed the experiments: YL BL MC. Performed the experiments: XH YC ZL. Analyzed the data: LQ XZ. Contributed reagents/materials/analysis tools: WH ZW. Wrote the paper: YL ST.

References

1. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, et al. (2010) Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer 127: 2893–2917. pmid:21351269
- View Article
- PubMed/NCBI
- Google Scholar
2. Herr HW (2001) Transurethral resection of muscle-invasive bladder cancer: 10-year outcome. J Clin Oncol 19: 89–93. pmid:11134199
- View Article
- PubMed/NCBI
- Google Scholar
3. Sonpavde G, Sternberg CN, Rosenberg JE, Hahn NM, Galsky MD, et al. (2010) Second-line systemic therapy and emerging drugs for metastatic transitional-cell carcinoma of the urothelium. Lancet Oncol 11: 861–870. pmid:20537950
- View Article
- PubMed/NCBI
- Google Scholar
4. Rosenberg JE, Carroll PR, Small EJ (2005) Update on chemotherapy for advanced bladder cancer. J Urol 174: 14–20. pmid:15947569
- View Article
- PubMed/NCBI
- Google Scholar
5. Leissner J, Koeppen C, Wolf HK (2003) Prognostic significance of vascular and perineural invasion in urothelial bladder cancer treated with radical cystectomy. J Urol 169: 955–960. pmid:12576821
- View Article
- PubMed/NCBI
- Google Scholar
6. Frank I, Cheville JC, Blute ML, Lohse CM, Nehra A, et al. (2003) Transitional cell carcinoma of the urinary bladder with regional lymph node involvement treated by cystectomy: clinicopathologic features associated with outcome. Cancer 97: 2425–2431. pmid:12733141
- View Article
- PubMed/NCBI
- Google Scholar
7. Tanji N, Ozawa A, Miura N, Yanagihara Y, Sasaki T, et al. (2010) Long-term results of combined chemotherapy with gemcitabine and cisplatin for metastatic urothelial carcinomas. Int J Clin Onco 15: 369–375. pmid:20340038
- View Article
- PubMed/NCBI
- Google Scholar
8. Walz J, Shariat SF, Suardi N, Perrotte P, Lotan Y, et al. (2008) Adjuvant chemotherapy for bladder cancer does not alter cancer-specific survival after cystectomy in a matched case-control study. BJU Int 101: 1356–1361. pmid:18454792
- View Article
- PubMed/NCBI
- Google Scholar
9. Canter D, Guzzo T, Resnick M, Magerfleisch L, Sonnad S, et al. (2008) The presence of lymphovascular invasion in radical cystectomy specimens from patients with urothelial carcinoma portends a poor clinical prognosis. BJU Int 102: 952–957. pmid:18485042
- View Article
- PubMed/NCBI
- Google Scholar
10. Kassouf W, Agarwal PK, Grossman HB, Leibovici D, Munsell MF, et al. (2009) Outcome of patients with bladder cancer with pN+ disease after preoperative chemotherapy and radical cystectomy. Urology 73: 147–152. pmid:18848348
- View Article
- PubMed/NCBI
- Google Scholar
11. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136: 215–233. pmid:19167326
- View Article
- PubMed/NCBI
- Google Scholar
12. Croce CM, Calin GA (2005) miRNAs, cancer, and stem cell division. Cell 122: 6–7. pmid:16009126
- View Article
- PubMed/NCBI
- Google Scholar
13. Lujambio A, Lowe SW (2012) The microcosmos of cancer. Nature 482: 347–355. pmid:22337054
- View Article
- PubMed/NCBI
- Google Scholar
14. Nordentoft I, Birkenkamp-Demtroder K, Agerbaek M, Theodorescu D, Ostenfeld MS, et al. (2012) miRNAs associated with chemo-sensitivity in cell lines and in advanced bladder cancer. BMC Med Genomics 5: 40. pmid:22954303
- View Article
- PubMed/NCBI
- Google Scholar
15. Friedman JM, Liang G, Liu CC, Wolff EM, Tsai YC, et al. (2009) The putative tumor suppressor microRNA-101 modulates the cancer epigenome by repressing the polycomb group protein EZH2. Cancer Res 69: 2623–2629. pmid:19258506
- View Article
- PubMed/NCBI
- Google Scholar
16. Hao Y, Gu X, Zhao Y, Greene S, Sha W, et al. (2011) Enforced expression of miR-101 inhibits prostate cancer cell growth by modulating the COX-2 pathway in vivo. Cancer Prev Res 4: 1073–1083. pmid:21430074
- View Article
- PubMed/NCBI
- Google Scholar
17. Guo F, Cogdell D, Hu L, Yang D, Sood AK, et al. (2014) MiR-101 suppresses the epithelial-to-mesenchymal transition by targeting ZEB1 and ZEB2 in ovarian carcinoma. Oncol Rep 31: 2021–2028. pmid:24677166
- View Article
- PubMed/NCBI
- Google Scholar
18. Schee K, Boye K, Abrahamsen TW, Fodstad O, Flatmark K (2012) Clinical relevance of microRNA miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 in colorectal cancer. BMC Cancer 12: 505. pmid:23121918
- View Article
- PubMed/NCBI
- Google Scholar
19. Su H, Yang JR, Xu T, Huang J, Xu L, et al. (2009) MicroRNA-101, down-regulated in hepatocellular carcinoma, promotes apoptosis and suppresses tumorigenicity. Cancer Res 69: 1135–1142. pmid:19155302
- View Article
- PubMed/NCBI
- Google Scholar
20. Wang HJ, Ruan HJ, He XJ, Ma YY, Jiang XT, et al. (2010) MicroRNA-101 is down-regulated in gastric cancer and involved in cell migration and invasion. Eur J Cancer 46: 2295–2303. pmid:20712078
- View Article
- PubMed/NCBI
- Google Scholar
21. Luo L, Zhang T, Liu H, Lv T, Yuan D, et al. (2012) MiR-101 and Mcl-1 in non-small-cell lung cancer: expression profile and clinical significance. Med Oncol 29: 1681–1686. pmid:21993632
- View Article
- PubMed/NCBI
- Google Scholar
22. Wang R, Wang HB, Hao CJ, Cui Y, Han XC, et al. (2012) MiR-101 is involved in human breast carcinogenesis by targeting Stathmin1. PloS One 7: e46173. pmid:23071542
- View Article
- PubMed/NCBI
- Google Scholar
23. Lin X, Guan H, Li H, Liu L, Liu J, et al. (2014) miR-101 inhibits cell proliferation by targeting Rac1 in papillary thyroid carcinoma. Biomed Rep 2: 122–126. pmid:24649082
- View Article
- PubMed/NCBI
- Google Scholar
24. Luo C, Merz PR, Chen Y, Dickes E, Pscherer A, et al. (2013) MiR-101 inhibits melanoma cell invasion and proliferation by targeting MITF and EZH2. Cancer Lett 341: 240–247. pmid:23962556
- View Article
- PubMed/NCBI
- Google Scholar
25. Tammela T, Alitalo K (2010) Lymphangiogenesis: Molecular mechanisms and future promise. Cell 140: 460–476. pmid:20178740
- View Article
- PubMed/NCBI
- Google Scholar
26. Leppanen VM, Tvorogov D, Kisko K, Prota AE, Jeltsch M, et al. (2013) Structural and mechanistic insights into VEGF receptor 3 ligand binding and activation. Proc Natl Acad Sci U S A 110: 12960–12965. pmid:23878260
- View Article
- PubMed/NCBI
- Google Scholar
27. Trojan L, Rensch F, Voss M, Grobholz R, Weiss C, et al. (2006) The role of the lymphatic system and its specific growth factor, vascular endothelial growth factor C, for lymphogenic metastasis in prostate cancer. BJU Int 98: 903–906. pmid:16978291
- View Article
- PubMed/NCBI
- Google Scholar
28. Su JL, Yang PC, Shih JY, Yang CY, Wei LH, et al. (2006) The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells. Cancer Cell 9: 209–223. pmid:16530705
- View Article
- PubMed/NCBI
- Google Scholar
29. Jun Cho H, Kim IK, Park SM, Eun Baek K, Nam IK, et al. (2014) VEGF-C mediates RhoGDI2-induced gastric cancer cell metastasis and cisplatin resistance. Int J Cancer 135: 1553–1563. pmid:24585459
- View Article
- PubMed/NCBI
- Google Scholar
30. Yafi FA, Kassouf W (2009) Role of lymphadenectomy for invasive bladder cancer. Can Urol Assoc J 3: S206–210. pmid:20019986
- View Article
- PubMed/NCBI
- Google Scholar
31. Ratert N, Meyer HA, Jung M, Mollenkopf HJ, Wagner I, et al. (2012) Reference miRNAs for miRNAome analysis of urothelial carcinomas. PloS One 7: e39309. pmid:22745731
- View Article
- PubMed/NCBI
- Google Scholar
32. Kottakis F, Polytarchou C, Foltopoulou P, Sanidas I, Kampranis SC, et al. (2011) FGF-2 regulates cell proliferation, migration, and angiogenesis through an NDY1/KDM2B-miR-101-EZH2 pathway. Mol cell 43: 285–298. pmid:21777817
- View Article
- PubMed/NCBI
- Google Scholar
33. Hu Z, Lin Y, Chen H, Mao Y, Wu J, et al. (2013) MicroRNA-101 suppresses motility of bladder cancer cells by targeting c-Met. Biochem Biophys Res Commun 435: 82–87. pmid:23618864
- View Article
- PubMed/NCBI
- Google Scholar
34. Cao Y, Linden P, Farnebo J, Cao R, Eriksson A, et al. (1998) Vascular endothelial growth factor C induces angiogenesis in vivo. Proc Natl Acad Sci U S A 95: 14389–14394. pmid:9826710
- View Article
- PubMed/NCBI
- Google Scholar
35. Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, et al. (1996) A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases. EMBO J 15: 290–298. pmid:8617204
- View Article
- PubMed/NCBI
- Google Scholar
36. Jeltsch M, Kaipainen A, Joukov V, Meng X, Lakso M, et al. (1997) Hyperplasia of lymphatic vessels in VEGF-C transgenic mice. Science 276: 1423–1425. pmid:9162011
- View Article
- PubMed/NCBI
- Google Scholar
37. Salven P, Lymboussaki A, Heikkila P, Jaaskela-Saari H, Enholm B, et al. (1998) Vascular endothelial growth factors VEGF-B and VEGF-C are expressed in human tumors. Am J Pathol 153: 103–108. pmid:9665470
- View Article
- PubMed/NCBI
- Google Scholar
38. Suzuki K, Morita T, Tokue A (2005) Vascular endothelial growth factor-C (VEGF-C) expression predicts lymph node metastasis of transitional cell carcinoma of the bladder. Int J Urol 12: 152–158. pmid:15733109
- View Article
- PubMed/NCBI
- Google Scholar
39. Tsurusaki T, Kanda S, Sakai H, Kanetake H, Saito Y, et al. (1999) Vascular endothelial growth factor-C expression in human prostatic carcinoma and its relationship to lymph node metastasis. Br J Cancer 80: 309–313. pmid:10390013
- View Article
- PubMed/NCBI
- Google Scholar
40. Akagi K, Ikeda Y, Miyazaki M, Abe T, Kinoshita J, et al. (2000) Vascular endothelial growth factor-C (VEGF-C) expression in human colorectal cancer tissues. Br J Cancer 83: 887–891. pmid:10970690
- View Article
- PubMed/NCBI
- Google Scholar
41. Yonemura Y, Endo Y, Fujita H, Fushida S, Ninomiya I, et al. (1999) Role of vascular endothelial growth factor C expression in the development of lymph node metastasis in gastric cancer. Clin Cancer Res 5: 1823–1829. pmid:10430087
- View Article
- PubMed/NCBI
- Google Scholar
42. Fellmer PT, Sato K, Tanaka R, Okamoto T, Kato Y, et al. (1999) Vascular endothelial growth factor-C gene expression in papillary and follicular thyroid carcinomas. Surgery 126: 1056–1061; discussion 1061–1052. pmid:10598188
- View Article
- PubMed/NCBI
- Google Scholar
43. Eggert A, Ikegaki N, Kwiatkowski J, Zhao H, Brodeur GM, et al. (2000) High-level expression of angiogenic factors is associated with advanced tumor stage in human neuroblastomas. Clin Cancer Res 6: 1900–1908. pmid:10815914
- View Article
- PubMed/NCBI
- Google Scholar
44. Lim JJ, Yang K, Taylor-Harding B, Wiedemeyer WR, Buckanovich RJ (2014) VEGFR3 inhibition chemosensitizes ovarian cancer stemlike cells through down-regulation of BRCA1 and BRCA2. Neoplasia 16: 343–353 e341–342. pmid:24862760
- View Article
- PubMed/NCBI
- Google Scholar
45. Drayton RM, Catto JW (2012) Molecular mechanisms of cisplatin resistance in bladder cancer. Expert Rev Anticancer Ther 12: 271–281. pmid:22316374
- View Article
- PubMed/NCBI
- Google Scholar
46. Dai Y, Xie CH, Neis JP, Fan CY, Vural E, et al. (2011) MicroRNA expression profiles of head and neck squamous cell carcinoma with docetaxel-induced multidrug resistance. Head Neck 33: 786–791. pmid:21560177
- View Article
- PubMed/NCBI
- Google Scholar
47. Xu L, Beckebaum S, Iacob S, Wu G, Kaiser GM, et al. (2014) MicroRNA-101 inhibits human hepatocellular carcinoma progression through EZH2 downregulation and increased cytostatic drug sensitivity. J Hepatol 60: 590–598. pmid:24211739
- View Article
- PubMed/NCBI
- Google Scholar
48. Xu Y, An Y, Wang Y, Zhang C, Zhang H, et al. (2013) miR-101 inhibits autophagy and enhances cisplatin-induced apoptosis in hepatocellular carcinoma cells. Oncol Rep 29: 2019–2024. pmid:23483142
- View Article
- PubMed/NCBI
- Google Scholar
49. Li D, Xie K, Ding G, Li J, Chen K, et al. (2014) Tumor resistance to anti-VEGF therapy through up-regulation of VEGF-C expression. Cancer Lett 346: 45–52. pmid:24333721
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, et al. (2010) Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer 127: 2893–2917. pmid:21351269
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Herr HW (2001) Transurethral resection of muscle-invasive bladder cancer: 10-year outcome. J Clin Oncol 19: 89–93. pmid:11134199
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Sonpavde G, Sternberg CN, Rosenberg JE, Hahn NM, Galsky MD, et al. (2010) Second-line systemic therapy and emerging drugs for metastatic transitional-cell carcinoma of the urothelium. Lancet Oncol 11: 861–870. pmid:20537950
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Rosenberg JE, Carroll PR, Small EJ (2005) Update on chemotherapy for advanced bladder cancer. J Urol 174: 14–20. pmid:15947569
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Leissner J, Koeppen C, Wolf HK (2003) Prognostic significance of vascular and perineural invasion in urothelial bladder cancer treated with radical cystectomy. J Urol 169: 955–960. pmid:12576821
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Frank I, Cheville JC, Blute ML, Lohse CM, Nehra A, et al. (2003) Transitional cell carcinoma of the urinary bladder with regional lymph node involvement treated by cystectomy: clinicopathologic features associated with outcome. Cancer 97: 2425–2431. pmid:12733141
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Tanji N, Ozawa A, Miura N, Yanagihara Y, Sasaki T, et al. (2010) Long-term results of combined chemotherapy with gemcitabine and cisplatin for metastatic urothelial carcinomas. Int J Clin Onco 15: 369–375. pmid:20340038
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Walz J, Shariat SF, Suardi N, Perrotte P, Lotan Y, et al. (2008) Adjuvant chemotherapy for bladder cancer does not alter cancer-specific survival after cystectomy in a matched case-control study. BJU Int 101: 1356–1361. pmid:18454792
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Canter D, Guzzo T, Resnick M, Magerfleisch L, Sonnad S, et al. (2008) The presence of lymphovascular invasion in radical cystectomy specimens from patients with urothelial carcinoma portends a poor clinical prognosis. BJU Int 102: 952–957. pmid:18485042
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Kassouf W, Agarwal PK, Grossman HB, Leibovici D, Munsell MF, et al. (2009) Outcome of patients with bladder cancer with pN+ disease after preoperative chemotherapy and radical cystectomy. Urology 73: 147–152. pmid:18848348
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136: 215–233. pmid:19167326
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Croce CM, Calin GA (2005) miRNAs, cancer, and stem cell division. Cell 122: 6–7. pmid:16009126
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Lujambio A, Lowe SW (2012) The microcosmos of cancer. Nature 482: 347–355. pmid:22337054
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Nordentoft I, Birkenkamp-Demtroder K, Agerbaek M, Theodorescu D, Ostenfeld MS, et al. (2012) miRNAs associated with chemo-sensitivity in cell lines and in advanced bladder cancer. BMC Med Genomics 5: 40. pmid:22954303
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Friedman JM, Liang G, Liu CC, Wolff EM, Tsai YC, et al. (2009) The putative tumor suppressor microRNA-101 modulates the cancer epigenome by repressing the polycomb group protein EZH2. Cancer Res 69: 2623–2629. pmid:19258506
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. Hao Y, Gu X, Zhao Y, Greene S, Sha W, et al. (2011) Enforced expression of miR-101 inhibits prostate cancer cell growth by modulating the COX-2 pathway in vivo. Cancer Prev Res 4: 1073–1083. pmid:21430074
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Guo F, Cogdell D, Hu L, Yang D, Sood AK, et al. (2014) MiR-101 suppresses the epithelial-to-mesenchymal transition by targeting ZEB1 and ZEB2 in ovarian carcinoma. Oncol Rep 31: 2021–2028. pmid:24677166
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Schee K, Boye K, Abrahamsen TW, Fodstad O, Flatmark K (2012) Clinical relevance of microRNA miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 in colorectal cancer. BMC Cancer 12: 505. pmid:23121918
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Su H, Yang JR, Xu T, Huang J, Xu L, et al. (2009) MicroRNA-101, down-regulated in hepatocellular carcinoma, promotes apoptosis and suppresses tumorigenicity. Cancer Res 69: 1135–1142. pmid:19155302
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. Wang HJ, Ruan HJ, He XJ, Ma YY, Jiang XT, et al. (2010) MicroRNA-101 is down-regulated in gastric cancer and involved in cell migration and invasion. Eur J Cancer 46: 2295–2303. pmid:20712078
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Luo L, Zhang T, Liu H, Lv T, Yuan D, et al. (2012) MiR-101 and Mcl-1 in non-small-cell lung cancer: expression profile and clinical significance. Med Oncol 29: 1681–1686. pmid:21993632
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref22] 22. Wang R, Wang HB, Hao CJ, Cui Y, Han XC, et al. (2012) MiR-101 is involved in human breast carcinogenesis by targeting Stathmin1. PloS One 7: e46173. pmid:23071542
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref23] 23. Lin X, Guan H, Li H, Liu L, Liu J, et al. (2014) miR-101 inhibits cell proliferation by targeting Rac1 in papillary thyroid carcinoma. Biomed Rep 2: 122–126. pmid:24649082
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref24] 24. Luo C, Merz PR, Chen Y, Dickes E, Pscherer A, et al. (2013) MiR-101 inhibits melanoma cell invasion and proliferation by targeting MITF and EZH2. Cancer Lett 341: 240–247. pmid:23962556
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref25] 25. Tammela T, Alitalo K (2010) Lymphangiogenesis: Molecular mechanisms and future promise. Cell 140: 460–476. pmid:20178740
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref26] 26. Leppanen VM, Tvorogov D, Kisko K, Prota AE, Jeltsch M, et al. (2013) Structural and mechanistic insights into VEGF receptor 3 ligand binding and activation. Proc Natl Acad Sci U S A 110: 12960–12965. pmid:23878260
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref27] 27. Trojan L, Rensch F, Voss M, Grobholz R, Weiss C, et al. (2006) The role of the lymphatic system and its specific growth factor, vascular endothelial growth factor C, for lymphogenic metastasis in prostate cancer. BJU Int 98: 903–906. pmid:16978291
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref28] 28. Su JL, Yang PC, Shih JY, Yang CY, Wei LH, et al. (2006) The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells. Cancer Cell 9: 209–223. pmid:16530705
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref29] 29. Jun Cho H, Kim IK, Park SM, Eun Baek K, Nam IK, et al. (2014) VEGF-C mediates RhoGDI2-induced gastric cancer cell metastasis and cisplatin resistance. Int J Cancer 135: 1553–1563. pmid:24585459
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref30] 30. Yafi FA, Kassouf W (2009) Role of lymphadenectomy for invasive bladder cancer. Can Urol Assoc J 3: S206–210. pmid:20019986
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref31] 31. Ratert N, Meyer HA, Jung M, Mollenkopf HJ, Wagner I, et al. (2012) Reference miRNAs for miRNAome analysis of urothelial carcinomas. PloS One 7: e39309. pmid:22745731
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref32] 32. Kottakis F, Polytarchou C, Foltopoulou P, Sanidas I, Kampranis SC, et al. (2011) FGF-2 regulates cell proliferation, migration, and angiogenesis through an NDY1/KDM2B-miR-101-EZH2 pathway. Mol cell 43: 285–298. pmid:21777817
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref33] 33. Hu Z, Lin Y, Chen H, Mao Y, Wu J, et al. (2013) MicroRNA-101 suppresses motility of bladder cancer cells by targeting c-Met. Biochem Biophys Res Commun 435: 82–87. pmid:23618864
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref34] 34. Cao Y, Linden P, Farnebo J, Cao R, Eriksson A, et al. (1998) Vascular endothelial growth factor C induces angiogenesis in vivo. Proc Natl Acad Sci U S A 95: 14389–14394. pmid:9826710
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref35] 35. Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, et al. (1996) A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases. EMBO J 15: 290–298. pmid:8617204
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref36] 36. Jeltsch M, Kaipainen A, Joukov V, Meng X, Lakso M, et al. (1997) Hyperplasia of lymphatic vessels in VEGF-C transgenic mice. Science 276: 1423–1425. pmid:9162011
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref37] 37. Salven P, Lymboussaki A, Heikkila P, Jaaskela-Saari H, Enholm B, et al. (1998) Vascular endothelial growth factors VEGF-B and VEGF-C are expressed in human tumors. Am J Pathol 153: 103–108. pmid:9665470
View Article
PubMed/NCBI
Google Scholar

[146] View Article

[147] PubMed/NCBI

[148] Google Scholar

[ref38] 38. Suzuki K, Morita T, Tokue A (2005) Vascular endothelial growth factor-C (VEGF-C) expression predicts lymph node metastasis of transitional cell carcinoma of the bladder. Int J Urol 12: 152–158. pmid:15733109
View Article
PubMed/NCBI
Google Scholar

[150] View Article

[151] PubMed/NCBI

[152] Google Scholar

[ref39] 39. Tsurusaki T, Kanda S, Sakai H, Kanetake H, Saito Y, et al. (1999) Vascular endothelial growth factor-C expression in human prostatic carcinoma and its relationship to lymph node metastasis. Br J Cancer 80: 309–313. pmid:10390013
View Article
PubMed/NCBI
Google Scholar

[154] View Article

[155] PubMed/NCBI

[156] Google Scholar

[ref40] 40. Akagi K, Ikeda Y, Miyazaki M, Abe T, Kinoshita J, et al. (2000) Vascular endothelial growth factor-C (VEGF-C) expression in human colorectal cancer tissues. Br J Cancer 83: 887–891. pmid:10970690
View Article
PubMed/NCBI
Google Scholar

[158] View Article

[159] PubMed/NCBI

[160] Google Scholar

[ref41] 41. Yonemura Y, Endo Y, Fujita H, Fushida S, Ninomiya I, et al. (1999) Role of vascular endothelial growth factor C expression in the development of lymph node metastasis in gastric cancer. Clin Cancer Res 5: 1823–1829. pmid:10430087
View Article
PubMed/NCBI
Google Scholar

[162] View Article

[163] PubMed/NCBI

[164] Google Scholar

[ref42] 42. Fellmer PT, Sato K, Tanaka R, Okamoto T, Kato Y, et al. (1999) Vascular endothelial growth factor-C gene expression in papillary and follicular thyroid carcinomas. Surgery 126: 1056–1061; discussion 1061–1052. pmid:10598188
View Article
PubMed/NCBI
Google Scholar

[166] View Article

[167] PubMed/NCBI

[168] Google Scholar

[ref43] 43. Eggert A, Ikegaki N, Kwiatkowski J, Zhao H, Brodeur GM, et al. (2000) High-level expression of angiogenic factors is associated with advanced tumor stage in human neuroblastomas. Clin Cancer Res 6: 1900–1908. pmid:10815914
View Article
PubMed/NCBI
Google Scholar

[170] View Article

[171] PubMed/NCBI

[172] Google Scholar

[ref44] 44. Lim JJ, Yang K, Taylor-Harding B, Wiedemeyer WR, Buckanovich RJ (2014) VEGFR3 inhibition chemosensitizes ovarian cancer stemlike cells through down-regulation of BRCA1 and BRCA2. Neoplasia 16: 343–353 e341–342. pmid:24862760
View Article
PubMed/NCBI
Google Scholar

[174] View Article

[175] PubMed/NCBI

[176] Google Scholar

[ref45] 45. Drayton RM, Catto JW (2012) Molecular mechanisms of cisplatin resistance in bladder cancer. Expert Rev Anticancer Ther 12: 271–281. pmid:22316374
View Article
PubMed/NCBI
Google Scholar

[178] View Article

[179] PubMed/NCBI

[180] Google Scholar

[ref46] 46. Dai Y, Xie CH, Neis JP, Fan CY, Vural E, et al. (2011) MicroRNA expression profiles of head and neck squamous cell carcinoma with docetaxel-induced multidrug resistance. Head Neck 33: 786–791. pmid:21560177
View Article
PubMed/NCBI
Google Scholar

[182] View Article

[183] PubMed/NCBI

[184] Google Scholar

[ref47] 47. Xu L, Beckebaum S, Iacob S, Wu G, Kaiser GM, et al. (2014) MicroRNA-101 inhibits human hepatocellular carcinoma progression through EZH2 downregulation and increased cytostatic drug sensitivity. J Hepatol 60: 590–598. pmid:24211739
View Article
PubMed/NCBI
Google Scholar

[186] View Article

[187] PubMed/NCBI

[188] Google Scholar

[ref48] 48. Xu Y, An Y, Wang Y, Zhang C, Zhang H, et al. (2013) miR-101 inhibits autophagy and enhances cisplatin-induced apoptosis in hepatocellular carcinoma cells. Oncol Rep 29: 2019–2024. pmid:23483142
View Article
PubMed/NCBI
Google Scholar

[190] View Article

[191] PubMed/NCBI

[192] Google Scholar

[ref49] 49. Li D, Xie K, Ding G, Li J, Chen K, et al. (2014) Tumor resistance to anti-VEGF therapy through up-regulation of VEGF-C expression. Cancer Lett 346: 45–52. pmid:24333721
View Article
PubMed/NCBI
Google Scholar

[194] View Article

[195] PubMed/NCBI

[196] Google Scholar

Figures

Abstract

Background

Methods

Results

Conclusions

Introduction

Materials and Methods

Cell Culture

Plasmid Construction and Lentivirus Preparation

RNA Isolation and Quantitative PCR

Western Blot Analysis

VEGF-C 3’UTR Wild Type and Mutant Type Construction and Luciferase Reporter Assay

Wound Healing Assay

Transwell Assay

MTS Assay

Statistical Analysis

Results

miR-101 Inhibits Bladder Cancer Cell Migration and Invasion

miR-101 Directly Targets VEGF-C in 293T Cells

VEGF-C Overexpression Rescues miR-101’s Invasion Effects

miR-101 Overexpression and VEGF-C Knockdown Independently Enhance Bladder Cell Sensitivity to Cisplatin

VEGF-C Overexpression Rescues miR-101-Induced Cisplatin Sensitivity

Discussion

Supporting Information

S1 Data. The Construction of miR-101-overexpression Plasmid and VEGF-C-overexpression Plasmid

S1 Fig. Representative Image of Bladder Cancer T24 Cells Simultaneously Transfected with miR-101/green fluorescent Protein (miR-101/GFP) and VEGF-C/red fluorescent protein (VEGF-C/RFP)

S1 Table. Firely/Renilla Luciferase Analyses of the Transfection with wt and mut VEGF-C 3′UTR and Either miR-101-overexpressing Vector or a Scrambled-sequence Vector.

Author Contributions

References