http://orcid.org/0000-0002-8304-840X
Figures
Abstract
Background
Chlamydia trachomatis causes the most prevalent bacterial Sexual Transmitted Infection. In pregnant women, untreated chlamydial infections are associated with abortions, premature rupture of membranes, postpartum endometritis, low birth weight and transmission to the newborn. In Córdoba, Argentina, there is little knowledge about the prevalence of Chlamydia trachomatis in women in their third trimester of pregnancy, so, the aim of this study was to evaluate Chlamydia trachomatis prevalence and genotypes present in Cordovan pregnant women with different age and socioeconomic status.
Methods and findings
Design: prospective study.
Settings: Women population from Cordoba city, Argentina.
Population: Pregnant women having 35 to 37 weeks of gestation.
Methods: Five hundred and nine cervical swabs were collected. Each sample was subjected to DNA extraction and PCR for Chlamydia trachomatis using primers NRO/NLO and CTP1/CTP2. Positives samples were sequenced to determine genotype. Main outcome measures: Demographic data of the patients were collected to detect a population at risk for this infection.
Results
A prevalence of 6.9% (35/509) for Chlamydia trachomatis infection was detected, with 32/295 and 3/214 from pregnant women with low or better economic resources respectively (p = 0,0001). Results showed a significantly increased rate of 11.6% (30/258) in women under 25 years compared with 2% (5/251) in patients over that age (p = 0,00003). Genotype E was the most prevalent.
Citation: Kiguen AX, Marramá M, Ruiz S, Estofan P, Venezuela RF, Mosmann JP, et al. (2019) Prevalence, risk factors and molecular characterization of Chlamydia trachomatis in pregnant women from Córdoba, Argentina: A prospective study. PLoS ONE 14(5): e0217245. https://doi.org/10.1371/journal.pone.0217245
Editor: Guangming Zhong, University of Texas Health Science Center at San Antonio, UNITED STATES
Received: January 31, 2019; Accepted: May 7, 2019; Published: May 31, 2019
Copyright: © 2019 Kiguen et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All files are available from the figshare database (https://doi.org/10.6084/m9.figshare.7952444.v1).
Funding: This study was supported by AXKiguen: Fundación Roemmers 2014, AXKiguen: Secyt 2014 (Res Secyt UNC 203/2014. RHCD: 1565/2014), and AXKiguen: Secyt 2016 (Res Secyt UNC 202/2016. RHCD: 1634/2016). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Additional support was provided by Laboratorios LACE Sociedad Anónima (https://www.laboratoriolace.com.ar/) in the form of salary for Susana Ruiz, but the funder did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.
Competing interests: The specific roles of these authors are articulated in the ‘author contributions’ section. Susana Ruiz is an employee of Laboratorios LACE Sociedad Anónima (https://www.laboratoriolace.com.ar/). There are no patents, products in development or marketed products to declare, and this does not alter our adherence to PLOS ONE policies on sharing data and materials. All other authors declare that no competing interests exist.
Introduction
Chlamydia trachomatis (C. trachomatis) is an obligate intracellular Gram negative bacterium causing the most prevalent bacterial Sexual Transmitted Infection (STI) throughout the world. The World Health Organization (WHO) estimated that annually some 357 million people get one STI include: chlamydia, gonorrhea, syphilis or trichomoniasis [1]. According to ompA gene molecular differences, C. trachomatis could be divided into different genotypes that are responsible for various diseases: genotypes A, B, Ba and C causing trachoma; genotypes D, Da, E, F, G, H, I, Ia, J and K responsible for urogenital infections in adults and respiratory and conjunctival infections in neonates and genotypes L1, L2, L2a and L3 causing Lymphogranuloma venereum [2, 3]. The most important characteristic of C. trachomatis is the ability to produce acute complications and long-term sequelae in upper genital tract, thus affecting the reproductive health.
In women, C. trachomatis infection presents asymptomatically in 70–75% of cases. Eng and Butler found that 30–40% of sexually active teenagers were infected [4] and up to 40% of them may develop pelvic inflammatory disease (PID) if not received the specific antimicrobial treatment [5]. C. trachomatis mainly affects women and adolescents younger than 20 years old. It has been postulated the immature cervix is more susceptible to C. trachomatis infection, so younger women are more prone to infection than older women [6, 7].
Infection prevalence reported in pregnant women is 3.5% in USA [8], 12.1% in the UK [9], 6.4% in Australia [10], 11% in Brazil and 10% in Perú [11, 12]. Untreated chlamydial infection in pregnant women is associated with miscarriage, postpartum endometritis, premature rupture of membranes, low birth weight and transmission to the newborn [13]. Some studies suggest that the risk of infection in a newborn from infected mothers is about 50% and can cause bronchitis, pneumonia and neonatal conjunctivitis [14].
The antimicrobial treatment for pregnant patients with C. trachomatis infection is Erythromycin or Azithromycin. The 1980s implementation of antenatal screening and treatment for chlamydial infection in the USA significantly lowered the incidence of both neonatal chlamydial pneumonia and conjunctivitis, which was previously the most common cause of neonatal conjunctivitis there [15]
Currently, there are no programs routinely conducted for C. trachomatis screening in antenatal care in Latin America, and there are no WHO recommendations for C. trachomatis screening and treatment in pregnant women [16]. In addition, in Córdoba, Argentina, there is little knowledge about the prevalence of C. trachomatis in women in their third trimester of pregnancy. Taking into account data mentioned above, in this work we evaluated C. trachomatis prevalence and genotypes present in Cordovan pregnant women with different age and socioeconomic status. Our results demonstrated that younger and low income pregnant women are most affected.
Methods
Study design
We conducted a prospective study with patients from two Health Centers in Córdoba, Argentina: Medical Specialties of Córdoba Municipality (MSCM) and a private laboratory from Cordoba city named LACE (LACE). Both MSCM participants (n = 301) and LACE participants (n = 208) were recruited between September 2014 and February 2015. Women ≥ 14 years old having 35 weeks of gestation and interested in participate were enrolled after providing informed consent approved by the Ethics Committee (C.I.E.S. Oulton- Romagosa. Date of approval: 03/12/2014. Reference number: 014). It is important to emphasize that the Ethics Committee approved the lack of parent or guardian consent in patients under 18 years, according to the law 26,742 (Rights of the Patient in its relationship with Professionals and Health Institutions). Health care professionals collected demographic data and swabs samples from each patient. It should be noted that none of the patients enrolled in this study had compatible symptoms with C. trachomatis infection.
Clinical Samples: Five hundred and nine cervical swabs were collected from pregnant women. All samples were placed in sterile tubes containing 1 ml of SPG (sucrose, phosphate, glutamic acid), and subsequently sent to the Instituto de Virología, Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Argentina to be processed.
DNA Extraction: Two hundred μl of each sample were subjected to DNA extraction using the Accuprep Genomic DNA Extraction Kit (BIONEER, Alameda, CA, USA) according to the manufacturer’s instructions.
OmpA gene PCR: PCR DNA extract (5 μl) was used to amplify a 1087 pb fragment of the ompA gene of C. trachomatis, using primers NRO (5’CTCAACTGTAACTGCGTATTT3’) and NLO (5’ATGAAAAAACTCTTGAAATCG3´). PCR amplification processes commenced with a 4-minute denaturation step at 95°C and continued with 49 amplification cycles. Each cycle consisted of a first denaturation step at 95°C for 1 min, an annealing step at 55°C for 1 min and a final step of chain elongation at 72° C for 1.5 min [17].
Cryptic Plasmid PCR: The primers used to generate a 201-bp fragment from the cryptic plasmid of C. trachomatis were CTP1 (5'-TAGTAACTGCCAClTCATCA-3') and CTP2 (5'-TTCCCCTTGTAATTCGTTGC-3'). The PCR amplification consisted of DNA denaturation at 95°C for 4 min followed by 35 cycles of amplification. Each cycle consisted of 1 min at 95°C, 1 min at 55°C and 1.5 min at 72°C followed by a final elongation at 72°C for 4 min. The ompA gene and cryptic plasmid PCR products were visualized after electrophoresis in a 1% agarose gel by ECO-Gel 20.000X Highway staining [17]. Positive and negative controls were used in all determinations of PCR (dx.doi.org/10.17504/protocols.io.zeef3be).
Sequencing of the ompA gene: For sequence analysis, the PCR products were purified with the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, US) and subjected to direct nucleotide sequencing reaction in both directions using an ABI automatic sequencer. The sequences were analyzed using the Molecular Evolutionary Genetics Analysis software package, MEGA 6 [18]. Sequences of the ompA derived from strains used in this study were analyzed along with the next sequences from strains available in GenBank: VR-348-E (accession number JX559522.1), VR-346-F (JX564244.1), VR-885-D (JX559520.1), VR-1477-C (559519.1), VR-573-B (JX559518.1), VR-347-Ba (KP120856.1), VR-878-G (JX564245.1), VR-879-H (JX564246.1), VR-880-I (JX564247.1), VR-886-J(JX648604.1), VR-887-K (JX564248.1), VR-901B-L1 (JX569832.1), VR-577-L2 (JX569836.1), VR-903-L3 (JX569834.1), China-F (EU339316), Tailandia-F (KM369937), Rusia-F (KU963178), Holanda-F (AF265240), Australia-F (AY464145), Brasil-F (DQ442881), USA-F (CP006674), Dinamarca-F (AM901152), Japon-F (AB915586), Argentina-D (EU191085), India-D (KP015822), USA-D (CP00677), Francia-D (X62919), Japon-D (AB915583), Dinamarca-D(AM901213), Australia-D (AY464176), Brasil-D (DQ442877), Islandia-D (AF414950), Suiza-L2 (DQ217607), Portugal-L2 (EU296834), Holanda-L2 (AY586530), USA-L2 (CP002682), Japon-L2 (AB915593), Japon-E (AB915585), Rusia-E (KU963184), Argentina-E (KC120818), Dinamarca-E (AM901208), Tailandia-E (KM369935), Australia-E (AY464144), Francia-E (JN192145), India-E (KP015823), Grecia-E (HQ637270), Brasil-E (FJ418802), Argentina-E (DQ890028), Holanda-E (AF265237), USA-E (CP006675), USA-B (DQ064297), Italia-B (U80075), Australia-B (AY464143), UK-B (M33636), Argentina-G (KC120822), Argentina-G (KC120825), India-G (KP015825), Australia-G (AY464159), USA-G (DQ064299), Japon-G (AB915587), Dinamarca-G (AM901157), India-Ia (KP015824), Japon-Ia (AB915589), USA-Ia (AF063201), Portugal-Ia (DQ116398), USA-Ia (DQ064291), Argentina-Ia (EU000492), and the tree was rooted with the ompA sequence of the Chlamydia suis (C. suis) strain (accession number AY687631). Phylogenetic tree was constructed using the neighbor-joining method. Branching pattern confidence levels were estimated by the bootstrap resampling of the data based on 1000 random replicates.
Statistical Analysis: A descriptive analysis of the sociodemographic characteristics of the patients was carried out. The results of the diagnostic tests were also analyzed. The normal distribution of the variables were expressed by the average and standard deviation and categorized. The prevalence of C. trachomatis infection was calculated with their respective 95% CI. Possible risk factors were evaluated using bivariate and multivariate logistic regression analysis. Values of p <0.05 were considered significant. The analysis was performed with Epi info software [19].
Results
We studied patients from 14 to 43 years of age with a median of 25 years. From 509 samples analyzed in the present work, 35 were positive for C. trachomatis DNA, revealing a total prevalence of 6.9% in the pregnant population included in our study.
Thirty two samples were from patients with Low Economic Resources (LER) while the 3 remaining had Better Economic Resources (BER), revealing a very increased positivity in the first patients mentioned (p 0,0001). In order to establish the LER, the patients had to be under a Program called Universal Assignment per child. It is an economic aid provided by the Argentine State to people with very low resources. Prevalence studies showed that positive samples belong mainly to young women. The positive samples were distributed in different age groups as can be seen in Table 1. Combining the age groups, we observed a significantly increased rate of 11.6% (30/258) in women under 25 years, compared with 2% (5/251) in patients over that age (p = 0,00003). It is interesting to note that pregnant patients between 21 and 25 years old have 2,9 more risk of suffering C. trachomatis infection than the rest of them (OR: 2,9. CI: 1,4–5,8. p = 0,001) (Table 1).
Using OmpA sequencing C. trachomatis samples showed 7 different genotypes (B, D, E, F, G, Ia and L2, Fig 1) of which genotype E was the most prevalent, as can be seen in Fig 1.
The distribution of C. trachomatis genotypes found in pregnant women is shown.
When a phylogenetic analysis was performed in sequenced samples three constructed with three major subdivisions could be detected. Main branches do not match the patterns of tissue tropisms and associated clinical presentation C. trachomatis infection in human hosts. (Fig 2).
The neighbor-joining method was used in MEGA& to generate phylogenetic trees for ompA from DNA sequences (596bp). Initial nucleotide alignments generated with strains that belong to this study are initiated by CO.
Discussion
In our knowledge this is the first report of C. trachomatis prevalence in women in their third trimester of pregnancy from Cordoba, Argentina. According to published studies, the prevalence of this bacterium differs greatly around the world, with values between 0.1% and 25.7% depending on the particular characteristics of the pregnant population and the methodology used in the study [20, 21]. In Latin America, there are a few studies regarding C. trachomatis prevalence in pregnant women and values reported are 5.9%, 10% and 11% for pregnant women from Chile, Peru and Brazil respectively [22, 12, 23]. In the present study we found a prevalence of 6.9%, which is within the range expected for the region. Highest percentages of positivity were found in women between 21 to 25 years and with limited financial resources. Young women are a vulnerable group of the population with regard to sexually transmitted diseases. This is thought to be because of the relative immaturity of the genital tract, making it prone to both trauma and infection, particularly in the developing transformation zone of the cervix [6–7].
One of the limitations of this study is that there is an inevitable selection bias due to the object of study, since women older than 25 years infected with C. trachomatis, might not have entered it because the complications of this infection did not allow their pregnancy.
The prevalence of 6.9% detected in pregnant women in our study is lower than that reported in asymptomatic young woman in Cordoba city, in which a prevalence of 8.9% was observed [24], and it is greater than that found by Zucotti et al. in pregnant patients in the first trimester who are seen in a private center where patients must pay for each medical practice they need [25].
This might be due to the fact that the population studied by Zucotti has a good economic level, which is why, according to our results; it is a protective factor for C. trachomatis infection.
As can be seen in Table 1, patients with LER have 8 times more risk of having C. trachomatis infection than patients with BER (OR: 8.6 CI: 2.6–28.5); the opposite happens with patients with BER since, according to statistics, this characteristic is protective for the aforementioned infection (OR: 0.1 CI: 0.03–0.3).
There are mechanisms that can explain the association of C. trachomatis infection with low socioeconomic status; these include a lower commitment to the control activities of STI, for example, not attending the instances of diagnosis of them. In addition, there would be individual, family and community factors that would negatively impact on safe sexual practices, such as the use of condoms [26].
The majority of published data clearly show that genotypes E and D are the most frequently isolated from genital tract infections [27]. Most traditional genotypes in patients with urogenital infection would be E, F, D, G and K, constituting between 60 and 80% of positive patients [28]. In our study genotypes E and F were the most frequently found in sequenced samples from pregnant women, followed by genotypes D, L2, G, B and Ia. Sexually active, asymptomatic patients from Córdoba, Argentina also showed genotype E as the most frequently detected, followed by genotype D and less frequently genotypes F and G [29]. In addition, genotypes E and D were the most frequently isolated in a study conducted in Buenos Aires, Argentina in adults and neonates with ophthalmia neonatarum [30].
In general, our results are consistent with those reported in most published studies, both in Argentina [29, 30] and elsewhere in the world, which detects a higher prevalence of genotype E, D and F in genital infections. However, our study reported also genotype L2, a finding not usually reported in bibliography.
Regarding the phylogenetic analysis, the distribution of genotypes observed in our study was similar to the distribution reported by Brunelle et al [31], which suggest that there is a marked trend in the group of serovars, which is not related to tissue tropism. Similar results were obtained by Monetti et al and Lutter et al [17, 32], who also proposes that the MOMP variability is due to antigenicity there of and immune selective pressure.
C. trachomatis infections are accompanied by psychosocial and economic complications. For this reason, screening programs have been implemented in different countries. Their main purpose is to reduce morbidity through early detection and appropriate specific treatment. As a secondary objective of these programs is to decrease the overall prevalence of C. trachomatis and subsequently reduce transmission in the population.
With regard to financial costs, it is considered that a screening program is effective when the costs associated with the logistics of screening and treatment of positive cases is less than or equal to the diagnosis and treatment of complications. Some publications show that screening programs put in place for this infection are profitable in selected populations [33–35].
With the data presented here, we would be able to state that low income pregnant women less than 25 years would be one of the populations selected for C. trachomatis screening programs.
References
- 1.
World Health Organization, Dept. of Reproductive Health and Research. Estrategia mundial del sector de la salud contra las infecciones de transmisión sexual, 2016–2021. 2016. http://apps.who.int/iris/bitstream/10665/250253/1/WHO-RHR-16.09-spa.pdf?ua=1.
- 2. López-Hurtado M, Guerra-Infante FM. Papel de los anticuerpos en el desarrollo de la infección por Chlamydia trachomatis y su utilidad en el diagnóstico. Perinatol Reprod Hum. 2002; 16: 140–150.
- 3.
Murray PR, Rosenthal KS, Pfaller MA. Chlamydiaceae. Microbiología Médica. 5° ed. PA: Elsevier; 2006. 463–472.
- 4.
Eng T, Butler W. The Hidden Epidemic: confronting sexually transmitted diseases. Washington, DC. National Academic Press; 2003.
- 5. Soper DE. Pelvic inflammatory disease. Obstet Gynecol. 2010; 116: 419–428. pmid:20664404
- 6. Lee V, Tobin JM, Foley E. Relationship of cervical ectopy to chlamydia infection in young women. J Fam Plann Reprod Health Care. 2006 Apr; 32(2):104–6. pmid:16824301
- 7. Nonato DR, Alves RR, Ribeiro AA, Saddi VA, Segati KD, Almeida KP, et al. Prevalence and factors associated with coinfection of human papillomavirus and Chlamydia trachomatis in adolescents and young women. American journal of obstetrics and gynecology. 2016 Dec 1;215(6):753–e1. pmid:27402054
- 8. Blatt AJ, Lieberman JM, Hoover DR, Kaufman HW. Chlamydial and gonococcal testing during pregnancy in the United States. Am J Obstet Gynecol. 2012; 207:55.e1–8.
- 9. Head MG, Fitchett JR, Cassell JA, Atun R. Investments in sexually transmitted infection research, 1997–2013: a systematic analysis of funding awarded to UK institutions. J. Glob. Health. 2015; 5(2): 1–9.
- 10. Bilardi JE, De Guingand D, Temple-Smith MJ. Garland S, Fairley CK, Grover S et al. Young pregnant women’s views on the acceptability of screening for Chlamydia as part of routine antenatal care. BMC Public Health. 2010; 10:505. pmid:20723264
- 11. Schmidt R, Muniz RR, Cola E, Stauffert D, Silveira MF, Miranda AE. Maternal Chlamydia trachomatis Infections and Preterm Births in a University Hospital in Vitoria, Brazil. PLoS One. 2015 Oct 27;10(10):e0141367. pmid:26505892
- 12. Cabeza J, García PJ, Segura E, García P, Escudero F, La Rosa S, et al. Feasibility of Chlamydia trachomatis screening and treatment in pregnant women in Lima, Peru: a prospective study in two large urban hospitals. Sex Transm Infect. 2015 Feb; 91(1):7–10. pmid:25107711
- 13. Gencay M, Koskiniemi M, Fellman V, Ammala P, Vaheri A, Puolakkainen M. Chlamydia trachomatis infection in mothers with preterm delivery and in their newborn infants. APMIS. 2001 Sep; 109(9):636–40. pmid:11878718
- 14. Kakar S, Bhalla P, Maria A, Rana M, Chawla R, Mathur NB. Chlamydia trachomatis causing neonatal conjunctivitis in a tertiary care center. Indian J Med Microbiol. 2010; 28: 45–47. pmid:20061763
- 15. Adachi K., Nielsen-Saines K., & Klausner JD. Chlamydia trachomatis infection in pregnancy: the global challenge of preventing adverse pregnancy and infant outcomes in Sub-Saharan Africa and Asia. BioMed research international, 2016.
- 16. Davey JDL, Shull HI, Billings JD, Wang D, Adachi K, Klausner JD. Prevalence of Curable Sexually Transmitted Infections in Pregnant Women in Low-and Middle-Income Countries From 2010 to 2015: A Systematic Review. Sex Transm Dis. 2016; 43(7):450–8. pmid:27322048
- 17. Monetti MS., Molina R., Estofan P., Frutos MC., Kiguen AX., Venezuela RF., et al. Distribution of Chlamydia trachomatis Genotypes in Infertile Patients of Córdoba, Argentina. International Journal of Virology and Molecular Biology. 2013; 2(1): 1–6.
- 18. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular biology and evolution. 2013; 30(12): 2725–2729. pmid:24132122
- 19.
Epi Info. Version 7. Atlanta, GA: Centers for Disease Control and Prevention; 1994.
- 20. Davey JDL, Shull HI, Billings JD, Wang D, Adachi K, Klausner JD. Prevalence of Curable Sexually Transmitted Infections in Pregnant Women in Low-and Middle-Income Countries From 2010 to 2015: A Systematic Review. Sex Transm Dis. 2016 Jul; 43(7):450–8 pmid:27322048
- 21. Vidwan NK, Regi A., Steinhoff M., Huppert JS, Staat MA, Dodd C, et al. Low Prevalence of Chlamydia trachomatis Infection in Non-Urban Pregnant Women in Vellore, S. India. 2012. PLoS ONE; 7(5):e34794. pmid:22567090
- 22. Ovalle A, Martínez MA, De la Fuente F, Falcon N, Feliú F, Fuentealba F, et al. Prevalence of sexually transmitted infections in pregnant women attending a public hospital in Chile. Rev. chil. infectol. 2012; 29 (5): 517–520.
- 23. Borborema-Alfaia AP, Freitas NS, Astolfi Filho S, Borborema-Santos CM. Braz J Infect Dis. 2013; 17(5):545–550. pmid:23831212
- 24. Farinati A, Zitto T, Bottiglieri M, Gastaldello R, Cuffini C, Cannistraci R, et al. Infecciones asintomáticas por Chlamydia trachomatis: Un problema controlable en la población adolescente. Rev. panam. infectol, 2008; 10(1): 8–12.
- 25. Zucotti A., Bolaño L., Berruezo F. A., Vitozzi S., Bottiglieri M. Prevalencia de chlamydia trachomatis en embarazadas durante el primer trimestre en una institución privada de la ciudad de Córdoba. Revista de la Facultad de Ciencias Médicas. 2018; 75(3): 183–188.
- 26. Crichton J., Hickman M., Campbell R., Batista-Ferrer H., Macleod J. Socioeconomic factors and other sources of variation in the prevalence of genital chlamydia infections: A systematic review and meta-analysis. BMC Public Health, 2015; 15(1): 729.
- 27. Byrne GI. Chlamydia trachomatis strains and virulence: rethinking links to infection prevalence and disease severity. J Infect Dis. 2010; 201(2): 126–133.
- 28. Lagergard T, Hadad R, Tunbäck P, Lindholm L, Löwhagen GB, Unemo M. Distribution of Chlamydia trachomatis ompA genovars and the new variant of C. trachomatis in the Göteborg area, Sweden. Eur J Clin Microbiol. 2010; 29(5): 609–611.
- 29. Cuffini C, Bottiglieri M, Kiguen X, Alonso CE, Valdes Deimundo R, Isa MB, et al. Molecular epidemiology of genital Chlamydia trachomatis infection in asymptomatic adolescent-young people. J. Microbiol Research. 2012; 2(4): 114–117.
- 30. Vaulet LG, Entrocassi C, Corominas AI, Rodríguez Fermepin M. Distribution study of Chlamydia trachomatis genotypes in symptomatic patients in Buenos Aires, Argentina: association between genotype E and neonatal conjunctivitis. BMC Res. 2010; 3 (1): 34.
- 31. Brunelle BW, Sensabaugh GF. The ompA gene in Chlamydia trachomatis differs in phylogeny and rate of evolution from other regions of the genome. Infect Immun. 2006; 74 (1): 578–585. pmid:16369014
- 32. Lutter EI, Bonner C, Holland MJ, Suchland RJ., Stamm WE., Jewett TJ., et al. Phylogenetic analysis of Chlamydia trachomatis Tarp and correlation with clinical phenotype. Infect Immun. 2010; 78 (9): 3678–3688. pmid:20605986
- 33. Welte R, Kretzschmar M, Leidl R, Van den Hoek A, Jager JC, Postma MJ. Cost-effectiveness of screening programs for Chlamydia trachomatis: a population-based dynamic approach. Sex Transm Dis. 2000; 27 (9): 518–529. pmid:11034526
- 34. Andersen B., Gundgaard J., Kretzschmar M., Olsen J., Welte R., Øster-gaard L. Prediction of costs, effectiveness, and disease control of a population-based program using home sampling for diagnosis of urogenital Chlamydia trachomatis infections. Sexually transmitted diseases. 2006; 33(7), 407–415. pmid:16601656
- 35. De Vries R, Van Bergen JE, Jong‐van den Berg D, Postma MJ; PILOT-CT Study Group. Systematic screening for Chlamydia trachomatis: estimating cost‐effectiveness using dynamic modeling and Dutch data. Value Health. 2006; 9(1): 1–11. pmid:16441519