Advertisement

  • Loading metrics

Open Access

Correction

Correction: Code-Assisted Discovery of TAL Effector Targets in Bacterial Leaf Streak of Rice Reveals Contrast with Bacterial Blight and a Novel Susceptibility Gene

  • The PLOS Pathogens Staff
  • Article
  • Metrics
  • Comments
  • Media Coverage

There are data and labeling errors in Figure 3. In the original Figure 3, the gel image for Os07g06970 is incorrect. It is a duplicate of the image for Os01g40290. The new Figure 3 contains the correct image. Also, the original Figure 3 was generated using Locus IDs from Release 5.0 of the Rice Genome Annotation Project. Relative to Release 7.0, used for all other reporting in the article, one of these Locus IDs, Os10g38495, is obsolete. It has been updated in the new Figure 3 to the corresponding Release 7.0 Locus ID, Os10g38489. The remaining Locus IDs are the same in Release 5.0 and Release 7.0 and unchanged in the new Figure 3.

thumbnail
Download:
Figure 3. Type III secretion system dependence of the most significant rice gene expression changes.

RT-PCR results reflecting transcript abundance are shown for rice genes identified by GeneChip expression analysis as the ten (or fewer) most significantly differentially expressed in response to (A) X. oryzae pv. oryzicola BLS256 (Xoc), (B) X. oryzae pv. oryzae strain PXO99A (Xoo), (C) Xoc and Xoo similarly, or (D) Xoc and Xoo to different extents. Leaf samples were harvested at 36 hours after inoculation with wild-type strains or with the type III secretion (T3S−) deficient derivatives. RT-PCR results for previously reported Xoo-induced genes, OsSWEET11 and TFIIAγ1 [9], [10], are omitted. An actin gene (Os04g57210) that is not differentially expressed was used as a reference for relative transcript abundance across samples. The experiment was repeated twice and yielded the same results.

https://doi.org/10.1371/journal.ppat.1003972.g003

Please see the corrected Figure 3 here. The legend remains unchanged.

There is an error in Figure 2, Table S1, Table S6, and Table S9. Release 7.0 Locus ID Os10g38489 correctly corresponds to Os10g38495 from Release 5.0, i.e. to probeset Os.2612.1.S1_at. However, the Release 7.0 Locus ID recorded for data associated with this probeset in Figure 2, Table S1, Table S6, and Table S9 is the paralog Os10g38640 and is incorrect. Os.2612.1.S1_at does not represent Os10g38640. Os10g38640 should be replaced with Os10g38489 in Figure 2, Table S1, Table S6, and Table S9, in each of which it occurs exactly once. The primers listed for Os10g38640 in Table S9 correspond uniquely to Os10g38489. They were designed for the Release 5.0 gene model at that coordinate, Os10g38495, and should be left unchanged.

There is an additional error in Figure 2 and Table S1, that is also in Table S4. In Figure 2, Table S1, and Table S4, the Release 7.0 Locus ID recorded for data associated with probeset Os.46631.1.S1_x_at is Os07g29750 and is incorrect. Os.46631.1.S1_x_at does not represent Os07g29750. The correct Locus ID for Os.46631.1.S1_x_at is the paralog Os10g39840. Os10g39840 is unchanged from Release 5.0 to Release 7.0 and appears correctly in Figure 3. Os07g29750 should be replaced with Os10g39840 in Figure 2, Table S1, and Table S4, in each of which it occurs exactly once.

There is additional information to add to Table S9. Primers used to amplify Os10g39840 (to generate the corresponding data in Figure 3) are (5’ to 3’) forward primer CCGATCAGGAGGTACGAGAAGAAGG and reverse primer GCACGCCTCAACTACCAAATTGC.

There are two errors in Table 1 and Table S7. Os10g38489, unlike Os10g38640, is a predicted target, displaying a candidate EBE for Tal1b of Xoc. Os10g38489 with associated data is added to the corrected Table 1 and corrected Table S7. Os07g29750 is incorrectly included in Table 1 and Table S7 as a predicted target of Xoc Tal4c. Based on the probeset that correctly maps to Os07g29750, OsAffx16482.1.S1_x_at, Os07g29750 is not differentially expressed in any pairwise comparison, and therefore would not be considered a predicted target, despite its candidate EBE for Tal4c. Os07g29750 is removed from the new Table 1 and Table S7. It is not be replaced in these tables with Os10g39840 because Os10g39840 displays no candidate EBE for any Xoc TAL effector. There is therefore no net change in the total number of predicted targets.

thumbnail
Download:
Table 1. Predicted X. oryzae pv. oryzicola BL256 TAL effector targets in rice (cv. Nipponbare) induced during infection and results of verification experiments.a

https://doi.org/10.1371/journal.ppat.1003972.t001

The corrected Table 1 can be seen here.

The corrected Table S7 can be downloaded here. The legend remains unchanged.

Supporting Information

Table S7.

All computationally predicted targets in rice (cv. Nipponbare) of TAL effectors of Xanthomonas oryzae pv. oryzicola BLS256 (Xoc) and TAL effectors of Xanthomonas oryzae pv. oryzae PXO99A (Xoo).

https://doi.org/10.1371/journal.ppat.1004126.s001

(XLSX)

Reference

  1. 1. Cernadas RA, Doyle EL, Niño-Liu DO, Wilkins KE, Bancroft T, et al. (2014) Code-Assisted Discovery of TAL Effector Targets in Bacterial Leaf Streak of Rice Reveals Contrast with Bacterial Blight and a Novel Susceptibility Gene. PLoS Pathog 10(2): e1003972

Citation: The PLOS Pathogens Staff (2014) Correction: Code-Assisted Discovery of TAL Effector Targets in Bacterial Leaf Streak of Rice Reveals Contrast with Bacterial Blight and a Novel Susceptibility Gene. PLoS Pathog 10(4): e1004126. https://doi.org/10.1371/journal.ppat.1004126

Published: April 16, 2014

Copyright: © 2014 The PLOS Pathogens Staff. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.