KSHV LANA acts on mTRs to establish episome persistence

Since KSHV and MHV68 LANAs share homology (Fig 1A), we assessed if kLANA can mediate episome persistence of MHV68 TR (mTR) elements. We transfected DNA (encoding G418 resistance) containing 8 (m8TR), 4 (m4TR), or 2 (m2TR) MHV68 TR copies, 8 KSHV TR (pk8TR) copies, or vector (pRepCK) into human BJAB B lymphoma cells stably expressing kLANA (BJAB-kLANA). k8TR exhibited much higher outgrowth from kLANA expressing cells as compared with control BJAB cells (S1 Table). The higher outgrowth is due to the much higher efficiency of kLANA mediated episome persistence compared with integration. Similarly, m8TR, m4TR, and m2TR G418 resistant outgrowth was also increased in BJAB-kLANA cells compared with BJAB cells, consistent with possible kLANA mediated episome persistence.

G148 resistant cell lines were expanded and assessed for the presence of episomes by Gardella gels. In Gardella gels, live cells are loaded into gel wells, and lysed in situ. During electrophoresis, chromosomal DNA remains at the gel origin, whereas episomal DNA as large as several hundred kilobases migrates into the gel. As expected, BJAB-kLANA cells transfected with pk8TR showed strong episomal signal in all tested cell lines (Fig 1B–1D)(Table 1). Also, as expected, BJAB-kLANA cells transfected with vector pRepCK, which does not contain TR sequence, lacked episomes (Fig 1B and 1D). Transfection of m2TR DNA into BJAB-kLANA cells resulted in only one of 31 (3%) G418 resistant cell lines with episomes (Table 1). After transfection of m4TR DNA into BJAB-kLANA cells and G418 selection for 27 days, episomes were detected in five (Fig 1B, (indicated with asterisks)) of 17 lanes, and in three experiments, 12 of 37 (32%) G418 resistant cell lines contained episomes. The episomal signal was substantially weaker for the m4TR episomes compared to the pk8TR episomal DNA (Fig 1B, compare pk8TR with m4TR lanes), indicating less episomal DNA in these cells. For m8TR DNA, episomes were detected in 10 of 17 lanes (Fig 1C), and in three experiments, 19 of 50 (38%) of G418 resistant cell lines had episomes. Although the m8TR episomal signal was weaker compared to that of the pk8TR cells (Fig 1C), there was substantially more m8TR episomal signal compared to that of m4TR (Fig 1B). Probe used in Fig 1B and 1C detected only vector backbone and therefore the efficiency of detection for all plasmids was the same. In general, mTR episomes migrated much more slowly than the ccc plasmid DNA (e.g. Fig 1B, lane 3 or Fig 1C, lane 2), and also more slowly than most pk8TR episomal DNA at 27 days of selection. The large, recombinant episomes were due to recombination events, and were primarily comprised of input plasmids arranged in tandem head to tail multimers, with expansion and contraction of tandem mTRs also occurring (S1 Text, S1 and S2 Figs). Therefore, kLANA can mediate episome persistence of mTR DNA and the efficiency of episome persistence is greater with higher mTR copy number.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Episome maintenance of mTR or kTR DNA in mLANA or kLANA expressing cells.

https://doi.org/10.1371/journal.ppat.1006555.t001

We investigated kLANA’s ability to maintain mTR episomes over a longer time period. Of four cell lines (Fig 1B, cell lines b, e, f, i) that initially had m4TR episomes after 27 days of G418 selection, three (Fig 1B, cell lines b, e, f) no longer contained episomes after ~2 months in continuous culture and the fourth m4TR cell line (Fig 1B, cell line i) had lost nearly all episomal DNA after 87 days of G418 selection (Fig 1D, lane 19, asterisk indicates faint band). In contrast, eight G418 resistant m8TR cell lines containing episomal DNA at 27 days continued to maintain m8TR episomal DNA after 87 days of selection (Fig 1D), while, as expected two cell lines which lacked episomes at 27 days, cell lines a and e, remained negative. Therefore, kLANA acts on m8TR DNA to mediate longterm episome persistence for at least ~3 months whereas m4TR episomal DNA was lost over time.

kLANA redistributes and concentrates to dots along mitotic chromosomes in the presence of mTR episomes

kLANA was detected in BJAB cells expressing kLANA either in the presence or absence of episomes that had been under G418 selection for over three months. Both interphase and metaphase arrested cells were assessed (Fig 1E). As expected, in the absence of episomes, kLANA (green) distributed broadly throughout the nucleus (red) in interphase (overlay of red and green generates yellow) and over mitotic chromosomes (red). In contrast, kLANA (green) concentrated to dots both in interphase nuclei (red), and along mitotic chromosomes (red) in cells containing k8TR episomes. Previous work demonstrated that each kLANA dot colocalizes with an episome[7]. In cells with m8TR episomes (from Fig 1C and 1D, cell line d used as a representative example), kLANA concentrated to dots in interphase and along mitotic chromosomes (red), but some kLANA also broadly distributed throughout the nucleus in interphase and broadly along mitotic chromosomes. In addition, there were generally fewer kLANA dots in cells with m8TR compared with k8TR, consistent with fewer m8TR episomes per cell. Therefore, kLANA relocalized to dots in both k8TR and m8TR cells, although the relocalization was less pronounced in cells with m8TR episomes compared with k8TR episomes.

mLANA acts in trans on kTR DNA to mediate episome persistence

Since kLANA mediated episome persistence of mTR DNA, we asked if mLANA can mediate episome persistence of k8TR DNA. mLANA acts on mTRs to mediate episome persistence when both are in cis[33], and we first performed experiments that demonstrated mLANA also acts in trans to mediate persistence (S3 Fig, S2 Text). To assess if mLANA mediates episome persistence of kTR DNA, pk8TR-P or pRepCK-P vector (encoding puroymcin resistance) was transfected into murine A20 cells or A20 cells expressing mLANAF. As expected, puromycin resistant outgrowth was low after transfection of vector pRepCK-P or pk8TR-P into A20 cells (S1 Table). In contrast, transfection of pk8TR-P into A20-mLANAF cells resulted in much higher outgrowth, consistent with episome maintenance.

Cells were assessed by Gardella gel for episomes. As expected, mLANA expressing cells transfected with vector control or A20 cells transfected with k8TR-P lacked episomes (Fig 2). In contrast, after transfection of pk8TR-P into A20-mLANAF(B) cells, 11 of 12 (Fig 2) cell lines had episomes and in a total of 4 experiments, 27 of 29 (93%) of puromycin resistant cells contained episomes (Table 1). Therefore, mLANA mediates episome persistence of k8TR DNA at relatively high efficiency. Consistent with these results, and with those that showed kLANA mediates episome persistence of mTR DNA (Fig 1), we found that kLANA and mLANA bind reciprocally to each other’s TR DNA recognition sequences (S3 Text, S4 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. mLANA mediates kTR episome persistence.

Gardella gel after transfection of A20 or A20/mLANA cells with pRepCK vector or k8TR DNA. Lanes contain 2-3x10⁶ cells. Gel was performed at 24 days of puromycin selection. Blot was probed with ³²P-pk8TR DNA. O, gel origin; E, S11 episomes; L, S11 linear genomes due to lytic replication; ccc plasmid DNA is indicated.

https://doi.org/10.1371/journal.ppat.1006555.g002

Generation of kLANA-MHV68 chimeric viruses

Since kLANA supported episome maintenance of mTR DNA, we asked if kLANA can functionally replace mLANA in MHV68 to support infection in vivo. The kLANA ORF and 5´ UTR, but not the kLANA promoter[37], were inserted into MHV68 at the mLANA locus. The mORF72 (noncoding) exon, which overlaps with N-terminal mLANA, was retained to preserve splicing events important for expression of mORF72 and LANA. Thus, kLANA expression is driven by native mLANA promoters (Fig 3A)[38,39] in the absence of mLANA. The resulting chimeric virus was termed v-kLANA. We also engineered viruses with mutations in kLANA that abolish nucleosome binding (termed v-8A10, where LANA residues ₈LRS₁₀ were mutated to ₈AAA₁₀)[40] or LANA DNA binding (termed v-Δ_1007–21, where residues 1007 to 1021 were deleted) [41] (Fig 3A). These mutations abolish kLANA episome persistence[40,41]. All kLANA-MHV68 recombinants were generated in backgrounds of wild type MHV68 or yellow fluorescent protein (yfp) MHV68[42].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Generation and lytic growth of MHV68 chimeric viruses.

(A) Schematic diagram. The kLANA cassette was inserted between the M11 stop codon and the mORF72 exon in place of MHV68 103,935–104,709, which includes most of the mLANA ORF. p1, p2, p3, are mLANA promoters[38,39]. The mORF72 noncoding exon (black) is located within the mLANA coding region. The E2 splice acceptor site (nt 104,871) and the mORF72 exon splice donor site (nt 104,715) were left intact to ensure expression of kLANA and mORF72. The mLANA start codon and three downstream ATGs were mutated to ATT to prevent initiation of translation (indicated by black dots). The BamHI-G fragment (genomic nt 101,653–106,902) is indicated. mLANA ORF, nt 104,868–103,927. (B) Confocal immunofluorescence detection of mLANA (top panels) or kLANA (lower panels) from yfp viruses. Magnification 630x. (C) Immunoblot of viral proteins. (D) Growth curves of virus in BHK-21 cells after infection with 0.01 PFU/cell. There was no significant difference between infection groups (p>0.05 using one-way non-parametric ANOVA Kruskal-Wallis). (E) Lung virus titers 7 days after infection with 10⁴ PFU of the indicated viruses. Circles represent titers of individual mice (n = 19). Bars indicate the mean. v-Δ1007-21.yfp had significantly lower titers than v-WT.yfp (**p<0.01, using one-way non-parametric ANOVA Kruskal-Wallis followed by Dunn´s multiple comparison test). There were no other statistically significant differences between groups.

https://doi.org/10.1371/journal.ppat.1006555.g003

Lytic replication of kLANA MHV68 viruses

mLANA promoters are predicted to drive transcription of transgenic kLANA during lytic replication in vitro, as they do for mLANA and mORF72[38,43]. We assessed LANA expression after infecting BHK-21 cells with MHV68 (v-WT), v-kLANA, v8A10, or v-Δ_1007–21. As expected, v-WT expressed mLANA, which distributed broadly throughout the nucleus (Fig 3B and S5A Fig, top panels)[43]. kLANA or kLANA mutants distributed similarly to mLANA (Fig 3B and S5A Fig, bottom panels) after infection with the chimeric viruses. Immunoblots confirmed mLANA or kLANA expression after infection with WT or chimeric viruses (Fig 3C, S5B Fig). The multiple kLANA bands are due to alternative initiation of translation and an alternative poly adenylation signal[44,45]. vCyclin (ORF72) and M3 (a chemokine binding protein expressed in lytic infection) levels were similar for v-WT and chimeric viruses (Fig 3C, S5B Fig), indicating preserved expression and comparable infection levels.

Growth kinetics of v-kLANA, v8A10, or v-Δ_1007–21 in BHK-21 cells infected at MOI of 0.01 was similar to that of v-WT virus (Fig 3D and S5C Fig). To assess lytic replication in vivo, we inoculated by intranasal (i.n.) route C57 BL/6 mice with 10⁴ PFU of v-WT or v-kLANA virus and determined lung titers. While titers of all viruses were similar at day 3 (S5D Fig), at day 7 after infection titers were slightly lower for v-kLANA viruses, particularly for the kLANA mutants, compared to v-WT (Fig 3E and S5D Fig). At day 14 no virus was detected in the lungs (S5D Fig). The reduction of titers at day 7 indicates that kLANA cannot fully replace mLANA during lytic replication in vivo, and disruption of kLANA N-terminal chromosome binding or C-terminal DNA binding affected this phase of infection.

kLANA rescues MHV68 in vivo latent infection in the absence of mLANA

To assess if kLANA can support MHV68 latent infection in vivo we assessed viral latency in spleens of mice infected with v-WT or kLANA chimeric virus. To identify latently infected splenocytes at day 14 after infection (the peak of latent infection), cells were incubated with BHK cells (permissive for lytic infection) to detect virus produced after lytic reactivation. As expected, splenocytes from v-WT infected mice produced virions. Splenocytes from v-kLANA infected mice also produced virus, although titers were 2 to 2 ½-log lower than those of v-WT infected animals (Fig 4A). In striking contrast, no detectable reactivating virus was observed in the v-8A10 or v-Δ_1007–21 infection groups (Fig 4A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. v-kLANA latent infection.

Viral latency in spleens of C57 BL/6 mice 14 days after i.n. infection with 10⁴ PFU of the indicated viruses. (A) Latent titers determined by co-culture reactivation assay (closed circles) and titers of pre-formed infectious virus by plaque assay (open circles). Circles are titers of individual mice. Bars indicate mean and dashed line shows the limit of assay detection. v-kLANA titers were significantly lower than v-WT (Mann-Whitney test). *p<0.05. (B) Quantification of viral DNA-positive cells in total splenocytes and in sorted GC B cells (CD19⁺CD95⁺GL7⁺). Data are from pools of five spleens per group. Bars are frequency of viral DNA-positive cells. Error bars indicate 95% confidence intervals. (C-E) Flow cytometry analyses. Representative FACS plots from individual mice are shown in left panels. Quantification graphs in which each point represents an individual mouse are shown at the right. Bars are mean values. Data were combined from 2 independent experiments with 5 mice in each group. (C) Total number of GC B cells (CD19⁺CD95⁺GL7⁺). NS, not significant; *p<0.05 using the Mann-Whitney test. (D) Percentage of GC B cells that were YFP positive. (E) Percentage of YFP positive cells that were GC B cells. ***p<0.001 in (D) and (E) using the Mann-Whitney test.

https://doi.org/10.1371/journal.ppat.1006555.g004

We also investigated the frequency of infected cells by limiting dilution PCR, in total splenocytes or in germinal centre (GC) B cells, since this approach directly indicates numbers of latently infected cells in the absence of a requirement for lytic reactivation. The frequency of latently infected splenocytes or GC B cells for v-kLANA was ~1 log lower compared to that of v-WT. In direct contrast, latently infected cells were at much lower levels for v-8A10 or v-Δ_1007–21 (Fig 4B).

We assessed the possibility that the reduction in v-kLANA latent infection at day 14 could be due to differing kinetics of infection of v-kLANA compared to v-WT by examining levels of latency at days 11 and 21. Results demonstrated that v-kLANA latent infection was similarly reduced compared to v-WT at days 11 and 21, indicating a consistent deficiency over time rather than differing infection kinetics (S6 Fig). We also asked if the lower level of latently infected splenocytes might be due to v-kLANA’s reduced lytic replication in the lungs. However, after intraperitoneal infection, which bypasses the lungs to provide virus access to the spleen, latent infection remained lower for v-kLANA compared to v-WT (S6A and S6B Fig).

We assessed latent infection and GC B cell populations in the spleen by flow cytometry 14 days after infection with WT or kLANA yfp viruses. The percentage of B cells that were GC B cells varied between ~3–6% among infection groups (Fig 4C). Total number of GC B cells was slightly higher in mice infected with WT when compared to kLANA, and significantly lower numbers were observed for the kLANA mutants compared to v-WT (Fig 4C, right panel). This result is not unexpected, in light of results in Fig 4A and 4B since the magnitude of GC B cell amplification after MHV68 infection correlates with latent virus load[46]. The frequency of GC B cells that were infected was determined from YFP expression. Mean percent of YFP⁺ GC B cells was 5.8% for v-WT.yfp and 1.4% for v-kLANA.yfp infected mice (Fig 4D, right panel). Mice infected with the kLANA mutant yfp viruses had over 10-fold lower percent of YFP⁺ GC B cells compared with v-kLANA.yfp (Fig 4D). About 80% of v-WT.yfp infected cells infected had a GC phenotype. Similarly, ~60% of v-kLANA.yfp infected cells had a GC phenotype (Fig 4E, right panel). In contrast, of the very few infected YFP+ B cells in the v-8A10.yfp and v-Δ_1007-21.yfp groups, only small percentages, 14% and 22%, respectively, were GC B cells (Fig 4E, right panel). Thus, kLANA largely rescued MHV68 in vivo latency in the absence of mLANA, whereas kLANA containing mutations that abolish episome persistence did not.

kLANA chimeric virus persists at WT levels in latently infected cells

To further investigate v-kLANA latency we assessed kLANA expression in vivo. We first confirmed latent v-kLANA infection in spleen sections by detection of MHV68 miRNAs 1–6, which are expressed in latently infected cells[30]. As expected, signal was detected in v-kLANA infected mice, although in fewer cells compared to v-WT (Fig 5A). LANA concentrates to dots at sites of episomal DNA in nuclei of latently infected cells[7]. kLANA was detected by immunohistochemistry, sometimes as nuclear dots, in adjacent sections in B cell follicles of v-kLANA mice (Fig 5B, arrow). mLANA distributed similarly in nuclear dots in v-WT sections (Fig 5C). We also detected LANA dots by immunofluorescence in v-WT (Fig 5D) or v-kLANA (Fig 5E) infected B cell follicles.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. mLANA and kLANA expression in vivo.

Spleen sections of mice infected with 10⁴ PFU of v-WT or v-kLANA for 14 days. (A) In situ hybridization (brown) with probes for viral miRNAs 1–6. Sections were counter stained with Mayer´s Haemalum. (B, C) Detection of kLANA (B) and mLANA (C) by immunohistochemistry in sections adjacent to those shown in panel A. Arrows in panel B indicate the same kLANA positive cell. Arrow in panel C indicates a mLANA positive cell. Sections were counterstained with haematoxylin. No kLANA signal was detected in sections stained only with secondary antibody. (D, E) mLANA and kLANA nuclear dots detected by indirect immunofluorescence. Images are maximum intensity projections of Z-stacks acquired over the thickness of the spleen sections. No dots were observed in unstained sections or with secondary antibody alone. Magnification 630x. (F) Quantification of mLANA (n = 69 nuclei from 3 mice) or kLANA (n = 67 nuclei from 3 mice) dots per 100 μm³ nuclear volume. Bars indicate means. The number of dots per volume was not significantly different between v-WT and v-kLANA mice (Mann-Whitney test, p>0.05). (G) Viral genomes in FACS sorted YFP⁺ and YFP^- GC B cells from spleens of v-WT.yfp (n = 7) and v-kLANA.yfp (n = 6) infected mice. Circles represent individual mice. Bars indicate means. There was no significant difference between the two infection groups (Mann-Whitney test, p>0.05).

https://doi.org/10.1371/journal.ppat.1006555.g005

We quantified the number of nuclear dots since LANA concentrates to dots at viral episomes, and each dot therefore indicates a viral genome. Since entire nuclei were rarely present in sections, we counted the number of dots per nuclear volume across confocal z-stacks. The concentration of mLANA or kLANA dots was similar, with means of 8.2 (range 2.2–21.0) and 7.7 (range 1.3 to 21.8) dots per 100μm³, respectively (Fig 5F). Considering a 4:1 nucleus-cytoplasm volume and diameters of 7 to 10 μm for GC B cells[47], we estimate a nuclear volume of 144 to 419 μm³ for the infected cells. Based on these volumes, we predict a mean of 12 to 34 mLANA or kLANA dots, hence viral episomes, per nucleus in latently infected cells within B cell follicles. We also quantified viral genomes in FACS sorted GC B cells from infected mice by qPCR. In YFP⁺ GC B cells the mean number of copies per cell was 80.6 (range 56.5 to 120.1) and 84.9 (range 47 to 115.7) for v-WT.yfp and v-kLANA.yfp, respectively (Fig 5G). The greater number of epsiomes determined by PCR could relate to an underestimation of nuclear volume when calculating LANA dots per nucleus, or possibly to adjacent genomes being observed as single dots. Together these results indicate that kLANA chimeric virus persists at WT copy number in nuclei of latently infected splenocytes.

Cell lines

A20 murine B lymphoma cells[65] (ATCC) were cultured with RPMI supplemented with 10% Fetalplex (Gemini) or bovine growth serum (BGS) (Hyclone), beta mercaptoethanol, sodium pyruvate, HEPES, Glutamax (Invitrogen), and 15μg/ml gentamicin. The latently infected cell lines, S11 (MHV68 infected)[66] and BCBL-1 (KSHV infected) (NIH AIDS Reagent Program) were maintained in RPMI with 20% BGS. S11 cells were also supplemented with beta mercaptoethanol. BJAB cells were grown in RPMI medium containing 10% BGS (Hyclone) or Fetalplex (Gemini) and 15μg/ml gentamicin. BJAB cells stably expressing KSHV LANA containing an N-terminal FLAG epitope tag (BJAB-kLANA)[7] were grown in RPMI containing 10% Fetalplex or BGS, and medium was supplemented with hygromycin B (200 units/ml; Calbiochem). 293T (ATCC) cells were grown in DMEM medium containing 10% BGS. NIH-3T3-CRE cells[67] were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat inactivated fetal bovine serum, 2mM glutamine, and 100U/ml penicillin and streptamicin. Baby hamster kidney fibroblasts (BHK-21, clone 13 CCL-10) (ATCC) were cultured in Glasgow´s modified Eagle´s medium (GMEM) supplemented as for NIH-3T3-CRE cells with the addition of 10% tryptose phosphate buffer. Cells were confirmed to be mycoplasma free.

Plasmids

mLANAF[33] contains mLANA with a 3x C-terminal FLAG tag driven by its native promoter. mLANA with N-terminal Myc and C terminal 3×FLAG epitope tags was generated by digesting pCMV-myc-mLANA-C3F with SacI and XhoI, and the resulting mLANA fragment ligated into pBluescript+II vector digested with SacI and XhoI. m2TR, m4TR and m8TR[33] contain two, four or eight mTR copies of the MHV68 terminal repeat elements. To generate m4TR-P, the neomycin resistance gene was removed from m4TR by digestion with BglII and HpaI and the BglII site blunted. The puromycin resistance gene was removed from pBabe puro[68] by digestion with ClaI and SnaBI, the ClaI site blunted, and the fragment inserted into the HpaI and BglII digested m4TR, generating m4TR-P. To generate pRepCK-P, the mTRs were removed from pm4TR-P by Not I digestion and the NotI site religated. To generate pk8TR-P, p8TR (pk8TR)[40] was digested with MluI and PsiI to release the neomycin resistance gene and then ligated with the MluI/PsiI DNA fragment containing the puromycin resistance gene from pm4TR-P.

Western blot and antibodies

Extracts derived from 0.25x10⁶ puromycin resistant cells were loaded per lane for FLAG antibody blots and 0.5x10⁶ cells per lane were loaded for the blot probed with anti-mLANA monoclonal antibody 6A3 in S3 Fig. Murine monoclonal antibody 6A3[55], which was raised against mLANA amino acids 140–314, was generated at the Monoclonal Antibody Core Facility, European Molecular Biology Laboratory. Proteins were resolved by 8% SDS-PAGE, transferred to nitrocellulose, and detected with anti-FLAG antibody conjugated to HRP (Sigma) used at a 1:750 dilution, mouse anti-tubulin monoclonal antibody B-5-1-2 (Sigma) used at a 1:1000 dilution, or 6A3 hybridoma supernatant used at a 1:2 dilution. Secondary anti mouse HRP conjugated antibody followed by chemiluminescence was used to detect the anti-tubulin and 6A3 antibodies. Anti-kLANA rat monoclonal antibody (LN53, ABI Sciences) was used at 1:1000, anti-vCyclin (mORF72)[69] (a gift from Samuel Speck) was used at 1:500, rabbit anti-M3 polyclonal[70] was used at 1:3000, mouse anti-eGFP (Clontech) was used at 1:1000 and rabbit anti-actin (Sigma) was used at 1:1000. Horse radish peroxidase (HRP) conjugated secondary antibodies were from GE Healthcare and Jackson Immunoresearch.

Generation of A20 cells with stable expression of mLANA

Ten million A20 cells in log phase were transfected with 35 μg of mLANAF or 35 μg of pRepCK vector in 400 μl RPMI containing 10% serum, but without antibiotics, by electroporation using the BTX Electroporation System Electrosquare Porator T820 by pulsing the cells at 225 volts for 65 milliseconds once. Three days post transfection, cells were seeded into microtiter plates at 5000, 1000, or 100 cells per well and placed under G418 (400 μg/ml) (Gemini) selection. G418 resistant clones were expanded and those transfected with mLANAF were screened for mLANAF expression by immunoblot with anti-FLAG antibody.

Episome maintenance assays

G418 resistant A20 cells or G418 resistant A20 cells stably expressing mLANAF were transfected as above with 35 μg of m4TR-P, pk8TR-P, or pRepCK-P and cultured in RPMI supplemented with 400 μg/ml G418 (Gemini) for 3 days. Cells were then seeded into 96 well plates at 10, 100, or 1000 cells per well and puromycin 2.5μg/ml (Invitrogen) was included in the medium in addition to G418. Cell lines resistant to both puromycin and G418 were expanded.

BJAB-kLANA cells were grown in log phase for three consecutive days and then ten million cells were transfected with 35 μg of m2TR, m4TR, m8TR, pk8TR, pRepCK, or plasmid DNA rescued from episome containing cells, in 400 μl of RPMI medium with 10% serum at 200 V and 960 μF in a 0.4-cm-gap cuvette with a Bio-Rad electroporator. Three days post transfection, cells were seeded in micro titer plates at 1, 10, 100, or 1000 cells per well in medium containing G418 (600 μg/ml; Gibco or Gemini) and later expanded to 6 well plates.

Gardella gel analysis[71] was performed on A20 or BJAB cell lines. Cells were lysed in situ in gel-loading wells embedded with DNAse free protease (Sigma #P6911) and sodium dodecyl sulfate, and electrophoresis in Tris-borate-EDTA performed. DNA was then transferred to a nylon membrane and detected by autoradiography using ³²P-labeled probe.

Fluorescence microscopy of suspension cells

G418 resistant BJAB-kLANA cells transfected with m8TR, k8TR or pRepCK, were metaphase arrested by incubation for 16 hours with 1 μg/mL of colcemid (Calbiochem). 0.2 x10⁶ cells were resuspended in 1 mL hypotonic buffer (1% NaCitrate, 1mM MgCl₂, 1mM CaCl₂) for 5 minutes. 300 μL cells were spread onto a polylysine slide by cytopsin (Thermoshandon), fixed in 4% formaldehyde, permeabilized with 0.5% triton X-100 and blocked in 20% goat serum. kLANA was detected by incubating with anti-kLANA monoclonal antibody IA-2-12 (gift of Mary Ballestas)[72] diluted 1:1000 in 20% goat serum for two hours, followed by incubation with secondary anti-mouse antibody conjugated to Alexa Fluor 488 (Molecular Probes) diluted 1:1000 in 20% goat serum. DNA was detected using propidium iodide at 1 μg/mL (Invitrogen). Slides were dried in ethanol 70% followed by incubations in 90% and 100% ethanol before coverslips were applied with Aqua-Poly mount (Polysciences). Microscopy was performed with a Zeiss Axioskop, PCM2000 hardware, and C-imaging software (Compix, Inc.).

Recombinant viruses

DNA encoding the kLANA gene and 5´UTR, flanked by MuHV4 genomic sequence, was cloned into pSP72 (Promega). The 5´ end of mORF73 and upper flanking region (coordinates 104710–105092, GenBank accession U97553) were PCR amplified from the MuHV-4 genome with primers Imm_TR1 (AAAGAATTCAATCACCTTGGCATCC) and Imm_TR2 (AATGCCTGAAGATCTTCCAG). Primer Imm_TR1 introduces an EcoRI site (underlined) four bases downstream of the mORF72 splice donor site (double underlined) and a C104710A mutation (bold) to alter ATG (coordinate 104712) to ATT. Primer Imm_TR2 contains the BglII genomic site (coordinate 105087). The PCR fragment was cloned into the pSP72 using BglII /EcoRI sites to create pSP72_PCR1. The mORF73 ATG (coordinate 104869) and two downstream ATG sequences (coordinates 104779 and 104714) were altered to ATT in pSP72_PCR1 using QuikChange Multi Site-Directed Mutagenesis (Stratagene) and primers Imm_TR5_C104721A (GAATTCAATCACCTTGGAATCCCGGTGGTGG), Imm_TR6_C104777A (GCGTCTTTTAGGAGGAATGGCTGCTGGTTTG) and Imm_TR7_C104867A (CGGTGGGGATGTGGGAATTATCTGAAAGAG) (mutated nucleotides in bold.) The resulting plasmid was termed pSP72_PCR1_2. The region of KSHV encoding the N-terminal region of kLANA and 5´UTR (coordinates 126473–127886, GenBank accession U75698) was PCR amplified from L54 phage[73] DNA with primers Imm_TR8 (ATCACCCCAGGATCCCTCAGAC), and Imm_TR9 (AAAGAATTCATTTGGAGGCAGCTGCG). Imm_TR8 contains genomic BamHI site (underlined, coordinate 126473) and Imm_TR9 introduces an EcoRI site (underlined) before the kLANA 5´UTR. The PCR product was ligated into the BamHI/EcoRI sites of pSP72_PCR2 to generate pSP72_PCR1_3. The DNA encoding the remainder of kLANA (corresponding to genomic coordinates 123808–126473) was amplified by PCR from pEGFP kLANA[40] with primers Imm_TR10 (AAAAAGCTTTTATGTCATTTCCTGTGG) and Imm_TR11 (CTGAGGGATCCTGGGGTGATG). IMM_TR10 introduces a HindIII site (underlined) downstream of the kLANA stop codon (bold). Imm_TR11 contains a BamHI genomic site (underlined, coordinate 126473). The PCR product was ligated into pSP72_PCR1_3 using HindIII and BamHI sites to create pSP72_PCR1_4. The lower flanking region of mORF73 (coordinates 102728–103934) was obtained by PCR from MuHV-4 DNA with primers Imm_TR3 (AAACTCGAGCAGATGAGATCTGTACTC) and Imm_TR4 (AAAAAGCTTTCAGACATAAATCACATTC). Imm_TR3 introduces a XhoI site (underlined) 6 nucleotides from the genomic BglII site (coordinate 102728, double underlined) and IMM_TR4 introduces a HindIII site (underlined) after the M11 stop codon (bold). The PCR product was cloned into XhoI/HindIII sites of pSP72_PCR1_4 to generate pSP72_PCR1_5. Alanine substitutions 8LRS10 to 8AAA10 in kLANA were introduced by PCR into pSP72_PCR1_3 using primer kLANA_8AAA10 (CCGGGAATGCGCGCCGCAGCGGGACGGAGCACCGG) (mutated nucleotides in bold.) The mutated region was subcloned from pSP72_PCR1_3_8A into BamHI/SacI sites of pSP72_PCR1_5 to create pSP72_PCR1_5_8AAA10. DNA encoding kLANA Δ1007–21 was subcloned from pSG5 kLANA delta 1007–21[41] into pSP72_kLANA with BamHI and StuI to generate pSP72_PCR1_5_Δ1007–21. Sequence of PCR-derived regions was confirmed by DNA sequencing. The KSHV sequences flanked by MUHV4 genomic sequences from pSP72_PCR1_5, pSP72_8A and pSP72_Δ1007–21 were subcloned into the BamHI-G MuHV-4 genomic fragment cloned in the pST76K-SR shuttle plasmid, using BglII sites. Each recombinant BamHI-shuttle plasmid was transformed into E. coli harboring the WT MuHV-4 BAC (pHA3)[74] or yellow fluorescent protein (YFP)-WT MuHV-4 BAC[42]. Following a multi-step selection procedure[74], recombinant BAC genomes were identified by PCR and HindIII, BamHI and EcoRI digestion profiles. Viruses were reconstituted by transfection of BAC DNA into BHK-21 cells using X-tremeGENE HP (Roche Applied Science). The IoxP-flanked BAC cassette was removed by viral passage through NIH-3T3-CRE cells.

Ethics statement

Animal studies were performed in accordance with the Portuguese official Veterinary Directorate (Portaria 1005/92), European Guideline 86/609/EEC, and Federation of European Laboratory Animal Science Associations guidelines on laboratory animal welfare. Animal experiments were approved by the Portuguese official veterinary department for welfare licensing (protocol AEC_2010_017_PS_Rdt_General), and the IMM Animal Ethics Committee.

Viral stocks and in vivo assays

Virus stocks were prepared by infecting BHK-21 cells (0.001 PFU/cell). Viruses were harvested from cleared supernantants by centrifugation at 15000g for 2h at 4 C. Infectious virus titers were determined by plaque assay in BHK-21 cells. For experiments involving mice, sample size was based on our and other previous studies that produce biologically valid data. Specifically, sample size ranged from 3 mice per group to a maximum of 5 depending on the nature of the experiment. No specific randomization or blinding was applied. For in vivo infections, 6 to 8-week old C57BL/6 J female mice (Charles River Laboratories) were inoculated intranasally under isofluorane anaesthesia with 10⁴ of PFU in 20 μl PBS. At the indicated times after infection, mice were sacrificed and lungs or spleens harvested. Lungs were homogenized, freeze-thawed and titers determined by plaque assay. Single cell suspensions were prepared from spleens and reactivating virus was quantified by co-culture with BHK-21 cells. Plaque assay was performed in equivalent freezed-thawed samples to determine pre-formed infectious virus. Plates were incubated for 4 days (plaque assay) or 5 day (co-culture assay) then fixed with 4% formaldehyde and stained with 0.1% toluidine blue. Plaques were counted with a plate microscope.

Flow cytometry

Single cell suspensions were prepared from spleens. After lysis of red blood cells in hypotonic NH₄Cl solution, the number of viable cells was determined by trypan blue exclusion. Fc receptors were blocked with anti-CD16/32 (2.4G2) (BD Pharmigen) diluted in FACS buffer (PBS containing 2% fetal bovine serum) for 15 minutes on ice. Cells were incubated for 25 minutes on ice with the following antibodies diluted in FACS buffer: APC-H7-conjugated anti-CD19 (1D3) (BD Pharmingen) used at 1:400, PE-conjugated anti-CD95 (Jo2) (BD Pharmingen) used at1:800 and eF660-conjugated anti-GL7 (GL7) (eBioSciences Inc) used at 1:200. YFP expression and cell surface markers and were detected on a LSR Fortessa (BD BioSciences) using DIVA software and data were analysed with FlowJo 9.3.2 (Tree Star). Cells were gated on live cells and singlets based on FSC/SSC and FSC-A parameters, respectively. Total number of GC cells was determined based on FACS data and cell count of splenocytes.

Frequencies of viral DNA positive cells

The frequency of viral DNA positive cells was determined in total splenocytes or GC B cells by limiting dilution combined with real time PCR. Splenocytes were pooled from 5 mice. GC B cells (CD19⁺GL7⁺CD95⁺) were purified from pools of 5 spleens using a BD FACSAria Fow Cytometer (BD BioSciences). The purity of sorted cells was≥ 95%. Cells were serially two-fold diluted and 8 replicates of each dilution analysed by real time PCR (Rotor Gene 6000, Corbett Life Science). The primer/probe sets were specific for the M9 MHV68 gene (primers M9-F 5’- GCCACGGTGGCCCTCTA and M9-R 5’–CAGGCCTCCCTCCCTTTG -3, and Taqman probe M9T, 5’- 6-FAM-CTTCTGTTGATCTTCC-MGB-3’). Positive and negative reactions were scored using Rotor Gene 6000 software and the frequency of infected cells was determined as described[46].

Viral genome quantification

YFP^- and YFP⁺ GC B cells (CD19⁺GL7⁺CD95⁺) were FACS sorted from individual spleens of infected mice using a BD FACSAria Fow Cytometer (BD BioSciences). Viral genomes were detected by real time PCR using M9 primers and Taqman probe described above. Cellular DNA was quantifed in parallel by detecting the ribosomal protein L8 (Rpl8) gene (primers mRpl8 F1 5´-CATCCCTTTGGAGGTGGTA and mRpl8 R1 5´-CATCTCTTCGGATGGTGGA and Taqman probe mRpl8T 5´-VIC-ACCACCAGCACATTGGCAAACC-MGB) as previously described. Reactions were performed in a Rotor Gene 6000 (Corbett Life Science) and data were analysed with Rotor Gene 6000 software. PCR products were converted to genome copies by comparison to a standard curve of a plasmid harboring the MHV68 M9 gene or the rpl8 mouse gene (mouse cDNA NM_012053, Origene) serially diluted in the same buffer as the samples. The number of viral genenome copies per cell was obtained by dividing the number of M9 copies by one half the number of Rpl8 copies.

Analysis of spleen sections

Spleens were fixed in 10% formalin in PBS for 24 hours at room temperature and paraffin embedded. In situ hybridization to detect MuHV-4-encoded miRNAs was performed in 5μm sections using digoxigenin-labelled riboprobes generated by T7 transcription of pEH1.4, as previously described[30]. For detection of LANA proteins, 4μm sections were cut, de-waxed, acid-treated for antigen recovery and blocked with Protein block (DAKO) for kLANA staining or using the Mouse on Mouse kit (DAKO) for mLANA staining. Sections were incubated for for 1 hour at room temperature with anti-mLANA mAb 6A3 (1:2 dilution of hybridoma supernatant) or rat anti-kLANA antibody (1:1000). For immunohistochemistry primary antibodies were detected with the anti-mouse ENVISION kit (DAKO) or ImmPress HRP anti-Rat IgG Peroxidase Polymer Detection Kit (Vector Laboratories), which use the Peroxidase/DAB detection system. Slides were counterstained with haematoxylin-eosin and images were acquired with a Leica DM2500 microscope coupled to a digital camera. For immunofluorescence, primary antibodies were detected with anti-mouse Alexa 594 or anti-rat Alexa-568 antibodies (Molecular Probes). Sections were mounted in Prolong gold reagent with DAPI (Molecular Probes) to stain DNA. Images were acquired with a Zeiss LSM 710 confocal microscope at 630x magnification and using Zen software. Images were processed with Image J. For quantification of dots, confocal z-stacks of nuclei, identified with DAPI staining, containing mLANA or kLANA dots were acquired from different areas of splenic follicles. The number of dots in individual nuclei was counted D across the z-stacks. Because most nuclei were not whole in the spleen sections, we determined the number of dots per nuclear volume. First we determined the nuclear volume in each slice, by multiplying the nuclei area, measured using ImageJ, by the thickness of the confocal slice. The final volume for each nucleus was the sum of the slice volumes.

Statistical analysis

Statistical significance was evaluated with unpaired two-tailed non-parametric Mann-Whitney U test or one-way non-parametric ANOVA (Kruskal-Wallis test), as appropriate, using GraphPad Prism software.