A computational coevolution-based method recapitulates DENV glycoproteins structural organization

We have previously reported that BIS, a combinatorial-based coevolution analysis method (S1 Fig), can accurately detect coevolution signals within a wide range of well-characterized cellular and viral proteins [22–24]. As BIS has not been previously tested for its ability to predict viral envelope glycoproteins structural organization and rearrangements, we first performed a coevolution analysis of the well-characterized DENV envelope glycoproteins, E and PrM [2,3]. During virus maturation, M protein (a mainly transmembranous protein) is associated to Pr, a peptide that protect the E fusion peptide and is cleaved prior viral budding [25]. Briefly, the PrM-E complex protrude as trimer at the surface of immature viral particles in the endoplasmic reticulum, a neutral pH compartment. Immature particle then navigates toward the trans-Golgi network, a more acidic compartment, where PrM-E complex form dimeric structures that lie down onto the surface of the particles. Pr, which initially concealed E fusion peptide, is then cleaved by the Furin. This cleavage achieves the maturation of viral particles that are then released into the extracellular compartment. As M is mostly a transmembrane protein with only very partial structural information available, we aimed to determine whether BIS can recapitulate the diversity of E-Pr structural organization at the surface of immature viral particles. BIS analysis of 17 DENV PrM-E serotype 2 sequences led to the identification of 14 groups of coevolving residues (possibly organized in blocks of consecutive amino-acids), further referred as clusters (S1 Table). Among those, three clusters (cluster 2, 7 and 9) displayed a strong statistical significance (with associated p values of 8e-5, 8e-5 and 7e-3 respectively) and involved coevolving blocks between E and Pr. When E is assembled as dimer at low pH condition, cluster 2 coevolving block positions supported the close proximity of E DIII and Pr (Fig 1A and 1B-left). Similarly, cluster 7 also recapitulated the close proximity between Pr and E domain DII on a trimeric E-Pr structure that form at neutral pH in the endoplasmic reticulum (Fig 1A and 1B-center). On a trimeric Pr-E structure (one dimer + one monomer of PrM-E) found at low pH when particles mature in the trans-Golgi, cluster 9 also supported a close proximity between Pr and E DII, but also between E dimers (Fig 1A and 1B-right). Two other clusters (cluster 3 and 8) of strong statistical significance (with respective p values of 1.34e-5 and 4.11e-5) were identified by BIS but did not involve coevolving residues located within E protein (S1 Table). Although cluster 8 was composed of two coevolving blocks located within M protein only, clusters 3 involved coevolving residues located within both M and Pr. As cluster 3, cluster 2 and 9 also supported the existence of interactions between Pr and M (Fig 1A and 1B). As M and Pr are the two cleavage products of a single PrM protein, these three clusters hence represent additional evidence of BIS ability to recapitulate biologically significant protein interactions. Taken together, our results demonstrate that BIS has the ability to accurately predict the tridimensional assembly of two viral proteins within different conformational states.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. BIS analysis of dengue E-Pr coevolving residues.

(A) Tridimensional representation of DENV Pr (Black, PDB 3C6R) and E (multi-color, PDB 1K4R). A linear representation of the PrM-E polyprotein is depicted below the protein structures. Starting and ending residue positions of each protein (Pr, M and E) and E domain are indicated. E domains are annotated by distinct colors: DI, domain I (red); DII, domain II (yellow); DIII, domain III (blue); Tmd, transmembrane (black). (B) Organization and positions of the PrM-E cluster 2 (orange), 7 (blue) and 9 (pink) on tridimensional representations of the DENV E and Pr proteins. Cluster 2 and 9 are depicted on a dimeric or trimeric E-Pr structure respectively at low pH condition (PDB 3C6R). Cluster 7 is depicted on a trimeric E-Pr structure at neutral pH condition (PDB 3XIY). Linear representation of the two proteins are also depicted on the top of each structure and cluster block location are indicated (precise cluster positions are reported in S1 Table). The close proximity between DENV E and Pr cluster 2 blocks is enlarged.

https://doi.org/10.1371/journal.ppat.1006908.g001

BIS can predict DENV E fusogenic conformational changes

As DENV E has been demonstrated to mediate DENV viral fusion, we then aimed to study the intra-protein coevolution signals within DENV E only (Fig 2A; see new E numbering by BIS in comparison to Fig 1A), and determined whether coevolution signals can also predict E fusogenic rearrangements. Using 17 different DENV E serotype 2 sequences, BIS identified 12 clusters (S2 Table). Among them, nine clusters (clusters 2–8 and 11,12) displayed associated p-values ranging between 7e-3 to 2e-7 and two clusters (clusters 9 and 10) exhibited associated p-values of 0.058 (S2 Table). Cluster 1 and 2 were either conserved (p-value = 1) or too large respectively to be considered. Several clusters (3,4,6 and 7) displayed small blocks located within a single region of E both in the linear protein sequence and on the tridimensional structure, suggesting that coevolution signals might contribute to the structural organization of secondary protein sub-domains (such as internal loops) (S2 Fig). DENV E DI and DII are composed of two or three sub-domains that are distant on the linear protein sequence but form single structured domains in the protein tertiary structure. Cluster 8 blocks were mostly located within the two sub-domains of DII and were consistent with the tridimensional organization of this protein domain (Fig 2B). Cluster 8 blocks located within the second sub-domain of DII (DII-2) of each E monomer were in close contact on the dimeric E structure (especially at the level of the DII α-helix), hence suggesting that coevolution signals can predict point of contacts between E monomers once organized as dimer (Fig 2B). Despite lower statistical significance (p<0.06), cluster 9 and 10 coevolving blocks also supported E structural organization as these blocks were distant on the linear structure but close on the E dimer structure (S2 Fig). Finally, three clusters (5, 11 and 12) displayed coevolving blocks that were both distant on the linear and tridimensional E structure. During fusion, E DIII folds-over toward DII, and DII becomes at close proximity with the E transmembrane domain [3] (Fig 2C). Cluster 5 and 11 coevolving blocks organization were consistent with these structural rearrangements (Fig 2C), suggesting that BIS can recapitulate viral glycoprotein fusogenic conformational changes.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. BIS analysis of dengue E coevolving networks during pre- and post-fusion steps.

(A) Linear representation of Dengue E protein. Starting and ending residue positions of each E domain are indicated. E domains are annotated by distinct colors: DI, domain I (red); DII, domain II (yellow); DIII, domain III (blue); Tmd, transmembrane (black). (B) Organization and positions of the DENV E cluster 8 blocks (dark blue) on a mature E dimeric structure (PDB 1K4R). A linear representation of E is depicted and cluster block locations are indicated (precise cluster positions are reported in S2 Table). Cluster 8 coevolving residues located in areas where the two E monomers are in close contact are enlarged (green square). Structural proximity of two-coevolving cluster 8 internal loops located into two distinct Domain II (DII) sub-domains on the linear structure is also highlighted (red square). (C) Positions of E cluster 5 (red) and 10 (green) blocks on a mature tridimensional E monomer at a pre-fusion state (left, PDB 1K4R) and post-fusion state (right, PDB 1OK8). Stem and transmembrane domains are represented by a grey dotted line. A linear representation of E and cluster block locations are indicated for each cluster (precise cluster positions are reported in S2 Table). At the top of the panel, a schematic represents the current experimentally-validated fusion model of DENV, and how DENV E rearranges during this process. DENV E domains are colored into distinct colors (red, domain I; yellow, domain II; blue, domain III) as in Fig 1A.

https://doi.org/10.1371/journal.ppat.1006908.g002

HCV E1 and E2 are strong coevolving partners that likely refold interdependently during fusion

Following validation of BIS ability to model viral envelope glycoprotein structural rearrangements, we then applied the BIS methodology to HCV E1E2. We analyzed independently using BIS ten groups of E1E2 sequences from different genotypes (gt) or sub-types (1a, 1b, 1 = 1a+1b, 2a, 2b, 2 = 2a+2b, 3, 4a, 5a and 6a) (S3 Table). Interestingly, most of the identified clusters involved residues in both E1 and in E2 suggesting the existence of conserved tight dialogs between E1 and E2 proteins (Fig 3A). Only a few number of statistically significant clusters were found among genotype 4a to 6a sequences, due to the low number of sequences available and to their very low genetic divergence.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. BIS analysis of HCV E1E2 coevolving residues.

(A) Number of intra-E1 (red), intra-E2 (blue) and inter-E1E2 (purple) clusters detected by BIS following analysis of E1E2 sequences belonging to genotype 1 through 6. (B) Linear representation of HCV E1E2 glycoproteins and tridimensional representation of E2core structure (PDB 4MWF). E2 domains and their residue positions are indicated. E2core layers and domains are highlighted by distinct colors (Green, BL; Red, central β-sandwich; Blue, front layer; Dark blue, CD81 BinL/CD81 binding loop; Light grey, central β-sandwich–back layer linker; Black dotted line, VR2/Variable Region 2; Grey dotted line, Stem; Black rectangle, Tmd/Transmembrane). HVR1, Hyper Variable Region 1. Rotation angles of the E2core structure are indicated. Viewing angle of E2core is indicated by a black cross harboring 4 color points at each extremity. (C-E) HCV E1E2 gt1a (C-D) and gt2 (2a+2b, (E)) fusion clusters are plotted on a vertical linear representation of E1 combined to the tridimensional view of E2core (PDB 4MWF). Each cluster is composed of blocks harboring a similar color, according to S3 Fig (gt1a) or S6 Fig (gt2). Panel C shows E1E2 dialogs mediated by gt1a fusion cluster 5 and 7 and panel D underlines E1E2 dialogs mediated by gt1a fusion cluster 8, 10 and 12. Panel E shows E1E2 dialogs mediated by gt2 fusion cluster 10 and 13. The Stem region (Stem) is represented by a dotted line following the C-terminal part of the BL. The transmembrane domain (Tmd) is represented as a rectangle following the Stem region. Bold lines link E1 and E2 cluster blocks that coevolved. For each cluster, block positions in E1 (at the left of the linear structure) and E2 (below boxes whose color match the color of the corresponding cluster) are indicated. Rotation angles of the E2core structure are indicated and the viewing angle of E2core is indicated by a black cross (as in Fig 3B).

https://doi.org/10.1371/journal.ppat.1006908.g003

Unlike Dengue E and PrM, the full panel of HCV E2 conformations still remain unknown and E2core only represent a single of these possible conformations, in a given biochemical context. When BIS coevolution analysis is applied to protein(s) for which only a fraction of its/their conformations have been characterized (which is the case for HCV E1 and E2), BIS coevolution clusters can thus only suggest, but not contradict a given conformational hypothesis, this unless the full panel of a protein conformations is known. Consequently, in vitro and/or in vivo experiments are then critical to ascertain the functional significance of a given conformational hypothesis.

Given this particular experimental context and in order to identify putative E1E2 rearrangements during HCV fusion, we thus adopted the following approach. First, we aimed to assign to each E1E2 cluster a given function by mapping clusters blocks with residues previously identified in the literature to impact E1E2 folding/heterodimerization, binding or fusion. Second, we sought to identify among BIS clusters classified as “fusion clusters” a putative protein rearrangement supported by several fusion clusters across multiple genotypes, prior experimental challenge through in vitro experiments.

We first focused our efforts on analyzing gt1a clusters. Detailed analysis of these clusters (S4 Table; S3 Fig; note that BIS numbered E1 and E2 residues by considering the first amino acid of E1 as residue #1) showed E1 as coevolving systematically with all the E2 domains. Plotting the gt1a coevolving blocks onto reference sequences (S4 Fig) revealed a strong correlation between blocks and residues previously identified in the literature to be important for heterodimer folding or viral binding site conformation (grouped both under the term “structural”) or fusion. This correlation allowed us to propose functions (structural, fusion, or multifunctional clusters) for most gt1a clusters (S5 and S6 Tables). When plotted on the E2core structure (Fig 3B), most fusion clusters involved blocks located within the E2 BL (Fig 3C and 3D) in contrast to structural or multifunctional clusters for which blocks were broadly distributed across E2 (S5 Fig). Interestingly, some of the fusion clusters involved distant blocks in both E1 and E2 (clusters 5,7,10; Fig 3C and 3D), highlighting that E1 terminal regions and the E2 BL could be in close proximity during fusogenic rearrangements. In addition, BIS also suggested an association between fusogenic rearrangements and a potential packing of E2 domains (clusters 8,10; Fig 3C and 3D). Thus, BIS proposed that interdependent rearrangements of E1 and BL could represent a hallmark of E1E2 fusogenic conformational changes.

Analysis of clusters from another HCV genotype (gt2) provided similar findings as fusion clusters also involved the BL (cluster 10,13) as well as distant blocks on E1 (cluster 6,10) and E2 (cluster 10,16) (Fig 3E; S6–S8 Figs; S7–S9 Tables). Statistically significant coevolution networks between E1 and BL were also found among genotype 3 sequences (S9 Fig). Similar networks were also found among sequences of genotype 4 to 6, but displayed poor statistical significance for the reason described above. Genotype 3 to 6a cluster positions are available through the webpages indicated in the data availability statement.

HCV E1 and E2 transmembrane were previously shown to be critical for E1E2 heterodimerization and correct E1E2 functions [26–28]. Consistently, BIS was also able to identify several coevolution clusters between the transmembrane of E1 and E2 using sequences of genotype 1 and 2 (S10 Table), hence strengthening the functional significance of BIS analysis.

In parallel, BIS also revealed several gt1a and gt2 structural and multifunctional clusters as supportive of the E2core central scaffold structure (S5 and S8 Figs), reinforcing BIS as a relevant method to model viral protein conformations. The detailed analysis of all the clusters of gt1a and 2, regardless of their attributed function, can be found in S1 and S2 Texts respectively.

Altogether, BIS coevolution analysis of E1E2 sequences suggested that E2 may adopt a pre-fusion structure distinct from E2core as well as yet unreported molecular rearrangements that could occur during fusion. We hence hypothesized that a movement of the BL (green; Fig 4A), through dialogs with E1, could mediate the evolution from a potential stretched E2 pre-fusion structure toward a domain-packed E2 post-fusion structure (Fig 4B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. An E2 BLd-derived peptide inhibits HCV infection.

(A) Putative BL movements that can modulate E2 rearrangements within E1E2 heterodimers. Rotation angles of the E2core structure are indicated (Reference: Fig 3B) and illustrated by a black cross harboring 4 color extremities. (B) Schematic representation of the E2 core structure and of the two hypothetical E2 conformational states prior (stretched) and following (packed) virus fusion when E1E2 are associated as heterodimer (color code and angle of E2 structures refer to Fig 3B). (C) Schematic representation of the expression construct encoding for the BLd-H77 peptide derived from the gt1a H77 E2 glycoprotein. SP, signal peptide; 6H, 6His-tag. (D) Detection of BLd-H77 in non-reducing condition following SDS-Page electrophoresis and coomassie blue staining. Molecular weight of the reference ladder are indicated on the left (kDa). (E) Detection of BLd-H77 peptide by Western Blot using a 6His-tag antibody. A 6His-tagged soluble E2 was used as a positive control. (F) Dose-dependent inhibition of HCVcc infection. HCVcc H77/JFH-1 or JC1 were pre-incubated with different doses of BLd-H77 (μg/ml) and used to infect Huh7.5 cells. Percentages of primary infection were calculated according to the viral titers of HCVcc particles incubated without BLd-H77 (mean ± SD; n = 3). (G) Kinetic of action of BLd-H77 on HCVcc infection. Huh7.5 cells were incubated 1h with BLd-H77 prior infection (35μg/ml) of HCVcc H77/JFH-1 (2), during the 4h infection (3) or following infection (secondary infection; 4). As control, cells were incubated at each step with equivalent volume of PBS (1). Percentages of primary infection were calculated according to viral titers of control conditions (mean ± SD; n = 3). Statistical significances (*p<0.05, **p<0.01, ***p<0.001) were determined for each experimental condition versus control condition (100%). (H) Dose-dependent inhibition of HCVpp harboring H77 envelope (HCVpp-H77) or control pseudoparticles harboring VSV-G (VSVGpp) envelope glycoprotein. Pseudoparticles were pre-incubated with different doses of BLd-H77 (μg/ml) or with PBS and used to infect Huh7.5 cells. Percentage of GFP positive cells was determined and expressed as percentages of infection, according to the viral titers of HCVpp incubated with PBS (mean ± SD; n = 3). (I) Kinetic of action of BLd-H77 on HCVpp infection. Huh7.5 cells were incubated 1h with BLd-H77 prior HCVpp H77 infection (50μg/ml) (2), during the 4h infection (3) or following infection (4). As control, cells were incubated at each step with equivalent volume of PBS (1). Percentages of infection according to viral titers of control conditions are reported (mean ± SD; n = 3). Statistical significances (**p<0.01, ns non-significant) were determined for each experimental condition versus control condition (100%). (J) Dose-dependent inhibition of HCVcc JC1 virus infection of primary human hepatocytes (PHH). JC1 particles were pre-incubated with different doses of BLd-H77 (μg/ml) or with PBS and then used to infect PHH. PHH cell culture media were harvested four days post-infection and used to infect naïve Huh7.5 cells. Percentages of secondary infection are shown and calculated according to the viral titers of JC1 virus pre-incubated with PBS (mean ± SD; n = 3). (K) Dose-dependent inhibition of JC1-derived HCVpc (HCV primary cell culture-derived) of Huh7.5. HCVpc particles were pre-incubated with different doses of BLd-H77 (μg/ml) or with PBS and used to infect naïve Huh7.5 cells. Percentages of primary infection using HCVpc particles are shown and calculated according to the viral titers of JC1 virus pre-incubated with PBS (mean ± SD; n = 3). (L). Inhibition of HCV infection in vivo in humanized liver mice. JC1 infectious titers (FFU/ml) were obtained from two independent mice cohorts treated with 30μg (red, n = 3) or 150μg (blue, n = 2) of BLd-H77, or with PBS (black; cohort = 6) under a “prophylactic” protocol. BLd-H77 or PBS was injected one day prior virus infection with JC1 HCVcc particles and subsequent injections were performed at day 1, 7 and 14 post-infection. Sera were harvested 7 (Week 1), 14 (Week 2) and 21 days (Week 3) post-infection. HCV viral titers were determined through infection of Huh7.5 cells with mouse sera and quantification of FFU/ml. One non-engrafted liver mice and one non-infected mice were used as negative controls (green, n = 2). N.D., non-detected.

https://doi.org/10.1371/journal.ppat.1006908.g004

A soluble form of the back layer inhibits HCV infection

To challenge the potential role of the BL in E1E2 rearrangements, we generated a soluble 9kDa 6His-tagged BL domain (71 aa; named BLd-H77; Fig 4C; S10A Fig) from the H77 gt1a strain, detectable through Coomassie blue staining and Western immunoblotting (Fig 4D and 4E). Non-reducing SDS-Page electrophoresis and Dynamic Light Scattering (DLS) analysis (S10B and S10C Fig) confirmed the homogeneity of the peptide in solution and suggested that BLd-H77 fold as a monomer. The far UV circular dichroism (CD) spectrum of BLd-H77 eluted from size exclusion chromatography displays the molar ellipticity per residue expected for a protein folded mainly in α-helix (S10D Fig). We next assessed its effect on HCV infection. Interestingly, BLd-H77 was able to inhibit, in a dose-dependent manner, infection of Huh7.5 cells by replicative hepatoma cell line-derived HCV particles (HCVcc) harboring envelope glycoproteins of gt1a (H77/JFH-1) but also gt2a (JC1) (Fig 4F; S11A Fig). Although BLd-H77 was able to slightly inhibit HCVcc infection when pre-incubated with cells prior infection, it showed a strong potency to inhibit infection when present during the first four hours of infection (Fig 4G) thus suggesting that BLd-H77 might likely act on early steps of the virus life cycle. Consistently, BLd-H77 was able to efficiently inhibit infection of Huh7.5 by non-replicative retroviral pseudoparticles harboring HCV E1E2 (HCVpp) from different genotypes (Fig 4H and 4I; S11B Fig). This inhibition was specific as BLd-H77 was not able to inhibit infection by pseudoparticles harboring VSVG envelope (VSVGpp). Time-course experiments using BLd-H77 (Fig 4I) as well as two additional entry inhibitors, Bafilomycin A1 that acts on cell endosome acidification [29]) and an anti-E2 neutralizing antibody (that binds to E1E2 complexes [30]), demonstrated that BLd-H77 is an entry inhibitor that likely acts on viral particles (S11C Fig) but not on cells. No effect of BLd-H77 on HCV cell entry receptors expression could be observed (S11D Fig). Moreover, BLd-H77 was also able to inhibit cell-to-cell transmission (S11E Fig) in addition to cell-free infection (Fig 4F and 4G). Altogether, these results highlighted that BLd-H77 likely inhibits a conserved mechanism during HCV entry without affecting cell susceptibility for infection. Importantly, BLd-H77 was able to inhibit HCVcc and primary human hepatocytes-derived HCVcc virus (or HCVpc) infection of primary human hepatocytes (PHH) and Huh7.5 respectively (Fig 4J and 4K; S11F Fig). Finally, we assessed the ability of BLd-H77 to inhibit infection in vivo. BLd-H77 showed a potency to inhibit HCVcc JC1 infection over time in humanized liver mice treated with 150 μg of BLd-H77 under a prophylactic protocol (Fig 4L). Despite their uneven infectivity [31], our results also suggested that BLd-H77 is able to inhibit patient-derived HCV particles infection in humanized mice p = 0.02 for all quantifiable values equal and above the detection limit) as well as in PHH (S11G and S11H Fig). BLd-H77 had no impact on human hepatocyte viability in mice as assessed by serum albumin concentration over the course of infection (S11I Fig). Altogether, our results indicate that BLd-H77 is able to inhibit entry of different types of HCV particles in vitro and in vivo and thus target a strongly conserved virus entry mechanism.

BLd-H77 binds viral particles via E2

We then sought to elucidate how BLd-H77 blocks HCV entry. By pre-incubating viral particles with BLd-H77 and diluting the mix prior to infection to reach a BLd-H77 concentration below its efficient neutralizing activity (determined in Fig 4F and 4H), we showed that BLd-H77 could irreversibly neutralize HCV particles regardless of mix dilution, hence suggesting that BLd-H77 can bind native viral particles prior viral entry (Fig 5A). To assess the presence of an interaction between HCV particles and the BLd-H77, we constructed a transmembrane form of BLd-H77 (called BLd-tm) (Fig 5B). Following lentiviral transduction, BLd-tm expression was detectable at Huh7.5-BLd-tm surface (S12A Fig), and did not impact HCV receptor expression (S12B Fig). BLd-tm expression at Huh7.5 surface, but not expression of a similar construct encoding for an anchored HIV-1 fusion inhibitor (namely C46), inhibited HCVcc propagation both in a cell-free and cell-to-cell transmission manner (Fig 5C and 5D; S12C Fig). HCVpp entry, but not VSVpp entry, (Fig 5E) was inhibited following infection of Huh7.5-BLd-tm, hence highlighting that BLd-H77 specifically inhibits HCV entry likely through binding of E1E2 glycoproteins. Consistently, more HCVpp were detected at Huh7.5-BLd-tm cell surface 4h post infection in comparison to Huh7.5 (S12D Fig), suggesting a potential containment of HCV particles by BLd-tm at the cell surface. The ability of recombinant soluble E2 (sE2) to bind more efficiently Huh7.5-BLd-tm cells than Huh7.5 cells in a dose dependent manner (Fig 5F) further suggested that virus entry is inhibited through an interaction between E2 and BLd-tm. In order to explore more precisely a putative interaction between E2 and BLd-H77, we designed an ELISA assay to quantify the ability of sE2 to be captured by coated BLd-H77. Our result showed a significant ability of sE2 to bind coated-BLd-H77 and coated-anti-E2 antibody AR3B [32] but not a coated-mouse IgG isotype (Fig 5G; S12E Fig). Altogether, these results strong suggest that BLd-H77 inhibit HCV entry by binding to E2 glycoprotein.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. A transmembranous form of BLd-H77 inhibits HCV infection.

(A) BLd acts onto viral particles. H77 HCVpp or H77/JFH-1 HCVcc particles were pre-incubated with BLd-H77 (50μg/ml or 35μg/ml, respectively) or with PBS. Prior to infection of Huh7.5 cells, HCV particles and BLd-H77 mixes were diluted (1/5; +) or not (-) with cell culture media resulting in a BLd-H77 concentrations inhibiting infectivity by less than 20% (see Fig 4F and Fig 4H). Viral titers of primary infection were determined 72h (HCVpp) or 4 days (HCVcc) post-infection and expressed as percentages of infection according to PBS control experiments (mean ± SD; n = 3). Statistical significances (*p<0.05, ***p<0.001) were determined for each experimental condition versus control condition (100%). (B) Schematic representation of the BLd-H77 transmembrane form (BLd-tm) and its possible mode of action. An IgG2 hinge region (Hinge) and the transmembrane region of the CD34 molecule (MSD) were added to the C-terminal of BLd-H77. SP, signal peptide. (C) A BLd-H77 transmembranous form inhibits HCVcc infection. H77/JFH-1 HCVcc were used to infect non-transduced Huh7.5, Huh7.5-C46 (C46) and Huh7.5-BLd-tm (BLd-tm). Four days post-infection, FFU titers were determined for each cell type and percentages of primary infection were normalized according to the viral titers determined following Huh7.5 infection (mean ± SD; n = 3). Statistical significances (***p<0.001, ns non-significant) were determined for each experimental condition versus control condition (100%). (D). Propagation of HCVcc viral particles in Huh7.5-BLd-tm cell cultures. Huh7.5 and Huh7.5 BLd-tm cells were infected with HCVcc H77/JFH-1 at a m.o.i. of 0.1. At day, 1, 3 and 5 post-infection, cell culture supernatants were harvested and used to infect naïve Huh7.5 cells. Viral titers of secondary infection were determined by NS5A immunostaining four days post-infection (mean ± SD; n = 3). (E) BLd-tm inhibits cell entry. Non-transduced Huh7.5 and Huh7.5-BLd-tm were infected with HCVpp H77 and VSVpp. 72h post infection, amount of GFP positive cells were quantified. Percentage of infection of Huh7.5-BLd-tm is normalized for each type of particle on the percentage of infection of non-transduced Huh7.5 (mean ± SD; n = 3). Statistical significances (**p<0.01, ns non-significant) were determined for each experimental condition versus control condition (100%). (F) Soluble E2 binding to Huh7.5-BLd-tm cells. Different doses of soluble E2 were mixed with different concentrations of Huh7.5 and Huh7.5-BLd-tm cells and E2 binding was quantified by flow cytometry. Results represent E2 ability to bind Huh7.5-BLd-tm cells for each condition relatively to the basal E2 ability to bind Huh7.5 cells (determined as 0% binding) for the same condition (mean ± SD; n = 3). *p<0.05. (G) Interaction between BLd-H77 and sE2 detected by ELISA. Different amounts of mouse IgG isotype, AR3B and BLd-H77 were coated overnight into 96-well plates. Coated peptides and antibodies were then incubated with 10ng of soluble E2 (sE2) or not. After washing, soluble E2 was detected using the rat anti-E2 antibody 3/11 and an anti-rat HRP antibody. After measurement of the optical density (O.D.) at 450nm, relative E2 binding was determined by calculating the ratio of O.D. between condition with 10ng of sE2 and no sE2, for each coating condition (mean ± SD; n = 3). **p<0.01, ***p<0.001, ****p<0.0001, ns non-significant. (H) BLd-H77 does not affect HCVcc binding. JC1 HCVcc particles were pre-incubated with BLd-H77 (35 μg/ml), Heparine (250 μg/ml) or PBS and mixed with Huh7.5 cells for 2h at 4. After washing, amounts of cell-associated viral particles were determined by RT-qPCR (mean ± SD; n = 3). Data are shown as percentage of binding, according to binding of HCVcc particles in control condition (PBS). Statistical significances (*p<0.05, ns non-significant) were determined for each experimental condition versus control condition (100%). (I) BLd-H77 can inhibit HCV entry following particle binding. HCVpp particles (HCVpp-H77) were incubated with Huh7.5 in presence of BLd-H77 (50μg/ml) or AR4A (25 μg/ml) during binding (1h at 4°C; 2), entry (4h at 37°C following binding; 3), or following entry (72h at 37°C following media change; 4). GFP levels were quantified 72h post infection. Huh7.5 infected in a similar manner but non-treated with BLd-H77 or AR4A were used as control (1). Percentages of infection were calculated based on viral titer obtained from control conditions. (mean ± SD; n = 3). Statistical significances (***p<0.001, ns non-significant) were determined for each experimental condition versus control condition (100%). (J) Effect of BLd-H77 on cell-cell fusion. LTR-luciferase-transduced 293T cells expressing HCV-H77 E1E2 or VSVG glycoproteins were co-cultivated with Tat-expressing Huh7.5 cells. Following pre-incubation with PBS or with 50μg/ml of BLd-H77, co-cultured cells were exposed to an acid shock (pH5) or not (pH7) and luciferase activities were determined 72h post-exposure. Percentage of fusion of HCV and VSVG glycoproteins at pH5 between control (PBS) or BLd-H77 are indicated (mean ± SD; n = 3). Statistical significances (**p<0.01, ***p<0.001) were determined for each experimental condition versus control condition (100%). (K) Effect of BLd-H77 on virus-liposome fusion assays. H77 HCVpp particles were pre-incubated with different dose of BLd-H77 (50μg/ml, green; 100 μg/ml, blue; 150 μg/ml, red) or not (PBS, black), and mixed with R18-labelled liposomes. Dequenching of R18 was quantified following sample acidification (pH5). Data are represented as non-linear polynomial fitted curves for each experimental condition and display the evolution of the fusion rate (%) over time. Curves are representative of three independent experiments.

https://doi.org/10.1371/journal.ppat.1006908.g005

BLd-H77 inhibits virus fusion

Next, we explored which step of HCV entry is inhibited by BLd-H77. BLd-H77 had no significant effect on attachment of HCVcc (HCVcc JC1, Fig 5H), HCVpp-H77 particles or soluble E2 (S13A Fig) on Huh7.5 cells. Using a highly specific and previously established HCVpp binding assay [21], we confirmed that BLd-H77 does not abrogate HCVpp binding to either human CD81 or SR-BI when used at a highly neutralizing concentration (S13B–S13D Fig). Moreover, BLd-H77 neutralizing activity was not competing with the activity of a neutralizing anti-E2 antibody known to inhibit viral particle binding [30], and their use in combination showed a synergistic neutralization effect (S13E Fig). Consistently, BLd-H77 could bind viral particles following their binding at the cell surface, and was shown to have its more potent neutralizing activity during post-binding steps (Fig 5I). Using a cell-cell fusion assay, we showed that BLd-H77 could strongly inhibit cell-to-cell fusion in comparison to control envelope glycoproteins (Fig 5J; S14A Fig). Importantly, cell-to-cell fusion was only inhibited when cells were incubated with BLd-H77 before low pH exposure that activate membrane fusion (S14B Fig), underlining BLd-H77 ability to specifically binds E1E2 pre-fusion conformations. Finally, using a HCVpp fusion assay with liposomes, which are devoid of any receptors or cell factors, the BLd-H77 inhibited fusion in a dose-dependent manner (Fig 5K, S14C Fig). Altogether, these results suggest that BLd-H77 specifically blocks E1E2 fusogenic rearrangements and the formation of post-fusion structures through binding to E2 protein, in accordance with BIS predictions.

E1E2-BL dialog is critical for fusion

Beside highlighting potential E1E2 rearrangements during fusion, BIS can identify pairs of residues that need to mutate in concert to guarantee structural compensations and proper viral fitness. Indeed, we have previously demonstrated how HCV entry depends on strain-specific dialogs between particular E1 and E2 domains [21]. Thus, we aimed at addressing whether BIS is able to unveil specific dialogs between residues of E1 and the E2 BL that modulate HCV fusion. The BIS predictions identified the multifunctional gt2 cluster 5 (S7–S9 Tables) as an interesting candidate for supporting E1 and E2 dialogs, BL movements and transition from E1E2 pre-fusion to post-fusion states. This cluster, similar to gt1a fusion cluster 5, linked two central blocks in E1 (residues 104, 105, and 109) and one block in E2 BL (residues 427 to 436; orange; Fig 6A). In order to challenge its potential role during fusion, we used cluster 5 blocks to guide the rational design of E1E2 chimeric constructs. The E1 region containing two cluster 5 blocks (Fig 6B; Region 1) and E2 BL regions containing the other cluster 5 block (Fig 6B; Region 2) or not (Fig 6B; Region 3, non-coevolving cluster 5 block as a control of specificity) were swapped between two E1E2 heterodimers from different gt2 strains, one allowing efficient HCVpp entry (J6) and another one mediating sub-optimal HCVpp entry (2b1) (S15A and S15B Fig). All chimeras were similarly expressed and incorporated (S15C Fig). Although J6 chimera carrying 2b1 cluster 5 regions (J6-1/2) displayed a poor entry efficiency, similar to 2b1 parental glycoproteins, a 2b1 chimera carrying J6 cluster 5 regions (2b1-1/2) exhibited >10-fold improved entry ability (Fig 6C). In contrast, 2b1 chimera carrying J6 Region 1 and 3 (2b1-1/3; Fig 6C) were not optimal for entry, hence suggesting that the E1 cluster 5 blocks and the N-terminal half of the BL domain are involved in a dialog regulating virus entry. Production and titration of HCVcc particles harboring these different chimeric envelopes confirmed these results (Fig 6D, S15D Fig). Interestingly, 2b1-1/2 also displayed improved ability to mediate cell-to-cell fusion (Fig 6E) as well as higher fusion efficiency at neutral pH than at acidic pH (Fig 6F), suggesting that this chimera exhibited an E1E2 conformation already primed for fusion at neutral pH. In contrast, J6-1/2 chimera did not increase J6 fusion efficiency and abrogated E1E2 sensitivity to low pH at levels similar to those of 2b1 (Fig 6E and 6F). Altogether, consistently with BIS predictions, these results suggest that conserved interplays between the central region of E1 and the N-amino-terminus region of the BL likely govern E1E2 fusogenic conformational states. Our results also support the maintenance of such dialogs through coevolution as they appeared to be mediated by genotype-specific regions of E1 and the BL.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. A dialog between E1 residues and the BL modulates virus entry and fusion.

(A) Representation of the gt2 fusion cluster 5 (orange; dotted circle and linked by a bold line) as a putative mediator of E2 BL rearrangements and fusogenic conformational changes. Putative movements of the E2 BL are indicated by dotted double arrows. Rotation angles of the E2core structure and black cross are indicated as in Fig 3B. (B) Regions of interest to study the role of the cluster 5 (orange) and design of the gt2 chimera. Three regions were defined as cluster 5 blocks. One is located on E1 (30 aa; Region 1) and two are located in E2 BLd (Region 2: E2 408–436, N terminal region; Region 3: E2 437–456, C terminal region). (C-D) A dialog between E1 and the BL domain regulates virus entry. Infectious titers of HCVpp (GFP i.u./ml, C) and HCVcc (FFU/ml, D) viral particles harboring J6 (black), 2b1 (white) and J6/2b1 E1E2 chimera. Swapped regions (1, 2 or 3) are represented by white (2b1) or black (J6) boxes inserted into J6 or 2b1 linear representations, respectively (bottom). Infectious titers were quantified 72h (HCVpp) or 4 days (HCVcc) post infection of Huh7.5. (mean ± SD; n = 4); *p<0.05.; ns non-significant. (E-F) A dialog between E1 and the BL domain regulates membrane fusion. Cell-cell fusion induced by the different E1E2 chimera (as described in Fig 5J). HANA (Influenza Hemagglutinin-Neuraminidase) envelope glycoproteins were used as positive control. Data are presented as relative light unit (RLU) at pH5 (E) or as percentage of fusion (F) where pH7 RLU is considered as 100% fusion rate for each chimera (mean ± SD; n = 3); *p<0.05, **p<0.01, ***p<0.001 ns non-significant. For panel (F), statistical significances were determined for each experimental condition versus control condition (100%).

https://doi.org/10.1371/journal.ppat.1006908.g006

BIS identify genotype 1 coevolving amino acids in E1 and the Stem region that regulate HCV fusion

To extend our transfer between the bioinformatics identification of coevolving amino acid clusters to the functional linkage of these domains, we tested the ability of BIS to pinpoint specific amino acids located in other regions than BL and furthermore, in the context of another genotype than genotype 2 (studied above). For this purpose, we sought to challenge a gt1a fusion cluster identified by BIS (Fusion cluster 5, S4–S6 Tables), which involved four residues within E1 central region (position 78 and 113–115) and a domain of 10 amino acids (452–461) within the Stem region. We employed two poorly divergent genotype 1a E1E2 sequences, H77 and A40, that displayed two E1 (SI/GM; position 112 and 117) and one E2 (D/N; position 462) amino acid differences located at the borders of the gt1a fusion cluster 5 blocks (Fig 7A; S16A Fig). Unlike J6 and 2b1, the level of functionality of H77 and A40 were relatively close (2.4x10⁴ and 1.6x10⁴ GFP i.u. per ml respectively) despite being significantly different (Fig 7B), hence making it challenging to predict the influence of residue swaps on envelope functionality. H77 chimera harboring both swapped E1 and E2 A40 residues significantly impacted HCVpp infectivity, although swapped E1 or E2 residues alone did not impact H77 functionality (Fig 7B) despite similar E1E2 expression and incorporation (Fig 7C). Importantly, H77 chimeras harboring only the E1 or E2 A40 residues showed defect for cell-cell fusion compared to H77, although fusion ability of the H77 chimera harboring both the E1 and E2 mutations were enhanced (Fig 7D). Altogether, consistently with BIS predictions, our results suggest that these E1 and E2 residues −and to larger extend the E1 central region and the E2 stem− are part of a coevolving network that regulates the fusogenic properties of gt1a viral envelope.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. BIS uncovers a coevolving signal between E1 and the Stem region that regulate HCV fusion.

(A) Position of the three amino acid residues that differs between H77 (blue) and A40 (red) and are hypothesized to coevolve according to BIS prediction (gt1a cluster 5). The three H77 amino acids will be replaced by A40 residues individually or altogether to challenge BIS prediction. (B) Impact of the E1/Stem coevolution signal on HCV entry. Infectious titers of HCVpp viral particles harboring H77 (blue), A40 (red) and H77/A40 E1E2 chimera were determined. Two E1 H77 residues (S112, I117), a single H77 E2 residue (D462) or both (S112, I117, D462) were introduced into E1E2 A40. The different envelopes were incorporated at the surface of HCVpp, then used to infect Huh7.5. Infectious titers were quantified 72h post infection by flow cytometry (mean ± SD; n = 3). *p<0.05, ns non-significant. (C) H77/A40 E1 and E2 chimera expression and incorporation onto HCVpp. Expression in transfected 293T cells (Cell lysates) and incorporation onto concentrated pseudoparticles (Viral Pellets) of E1 and E2 from the different H77/A40 chimera. Detection of E1 and E2 onto pseudoparticles harboring no envelope glycoproteins was used as negative control. MLV-Capsid (CA) was detected to control equivalent HCVpp production between chimera. (D). Impact of the E1/Stem coevolution signal on HCV fusion. LTRhiv-luciferase vector transduced 293T cells expressing the different E1E2 H77/A40 chimeric envelope glycoproteins were co-cultured with Tat-expressing Huh7.5 cells. Co-cultured cells were exposed to an acid shock (pH5, orange) or not (pH7, red) and luciferase activities were determined 72h post-exposure. Results are presented in relative light units (RLU) for each experimental condition (mean ± SD; n = 3). *p<0.05, ***p<0.001.

https://doi.org/10.1371/journal.ppat.1006908.g007

Ethics statement

Experiments were performed in accordance with the EU guidelines (Directive 2010/63/EU) on approval of the protocols by the local ethical committee (Authorization Agreement C2EA-15; Ethic commitee: Comité d’Evaluation Commun au Centre Léon Bérard, à l’Animalerie de transit de l’ENS, au PBES et au laboratoire P4 (CECCAPP), Lyon, France.

Cell lines, reagents and biological materials

Human Huh-7.5 (kind gift of C. Rice, Rockefeller University, NY), BRL3A rat hepatoma (ATCC CRL-1442), and 293T kidney (ATCC CRL-1573) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (Invitrogen). Primary human hepatocytes (PHH; BD Biosciences) were centrifuged using a F-12 HAM medium (Sigma) and seeded overnight in collagen-coated 48 well plate (1x10⁵ cells/well) into Gentest seeding medium (BD Biosciences) completed with 5% FCS. The next morning, PHH were washed and cultured with the culture medium for PHH William’s E medium (W4128, Sigma) supplemented with 7,5% BSA, 1% ITS (insulin transferrin selenium, Gibco), 10-7M of Dexamethasone (Sigma), 1% of non-essential amino acids (Gibco), 1% of Glutamax (Gibco) and 1% Penicillin-Streptomycin solution (Gibco). Sera containing HCV particles were obtained from a gt1b infected patient (Hôpitaux Universitaires de Strasbourg, Strasbourg, France) and were subsequently amplified in uPA-SCID humanized liver mice. Viral loads (RNA copies number/ml) were determined by RT-qPCR using a clinical diagnostic kit (Abbot).

Antibodies

The rat anti-E2 clone 3/11 [47], the mouse anti-E2 AP33 (Clayton et al., 2002) and the conformational mouse anti-HCV E2 H53 [48] are kind gifts from J. McKeating (University of Birmingham, UK), Arvin Patel (MRC—University of Glasgow Centre for Virus Research, Glasgow, UK) and J. Dubuisson (Institut Pasteur de Lille, FR) respectively. AR3B [32] and AR4A [30] antibody are a kind gift from Mansun Law (The Script research institute, San Diego, USA). MLV Capsid was detected by a goat anti-MLV-CA antibody anti-p30 (Viromed). HCVcc foci forming units were stained with a mouse anti-HCV NS5A antibody 9E10 [49], a kind gift of C. Rice (Rockefeller University, NY, USA). Human CD81 were detected with JS81 mAb (BD Biosciences), human SRB1 with CLA-1 mAb (BD Pharmingen), human Claudin-1 with the MAB4618 mAb (R&D Syst.) and human Occludin with an anti-Occludin mAb targeting the C-terminal region of the protein (Laboratories Inc.). A Mouse anti-Human IgG2 antibody targeting human IgG2 hinge region (Novus Biological) was used to quantify BLd-tm expression at cell surface. A rabbit 6His-tag antibody (Pierce antibody) was used to detect soluble E2 and BLd-H77 6His-tag.

BLd-H77 construction

In order to construct a relevant BLd soluble peptide derived from a genotype 1a sequence, we took into account the BL borders previously suggested (Fig 3B, see also reference [7]), but also aimed to refine these borders using the locations of BIS coevolution networks of genotype 1a. Indeed, BIS suggested that a 15 amino acids extension from residue 390 to 405, classified previously as an undefined domain [7] between the central Ig scaffold and the E2 BL, contained blocks (S4 Fig, block 7–1) that coevolve with another region of the BL (block 7–2), forming altogether a fusion cluster (cluster 7). Hence, in order to rigorously challenge BIS predictions that suggested a potential redefinition of the BL, we constructed a soluble BLd peptide from residue 390 to 460. Hence, DNA sequence of HCV E2 coding for the residues 390 to 640 was amplified from a genotype 1a envelope H77 (AF009606) cDNA sequence. This sequence was subcloned into a phCMV plasmid to fuse the last 18 amino acids from the C-term part of HCV core that act as a signal peptide, and a CH3-terminal 6 Histidine-tag was added. The resulting peptide of 77 amino acids (71+6) was then named as BLd-H77.

BLd-H77 production, purification and analysis

BLd-H77 was expressed in 293T following transient transfection and purified from cell culture supernatant (OptiMEM) by fast protein liquid chromatography on a Superdex G-75 gel filtration column (GE Healthcare). BLd-H77 was re-suspended in 1XPBS. The concentration of purified BLd-H77 peptides was determined by absorption at 205 nm. The mass of BLd-H77 peptide was measured by ESI mass spectrometry using a Finnigan LCQ ion trap mass spectrometer (Thermo Electron Corporation). Analysis by SDS-PAGE electrophoresis was performed using a standard Tris–glycine system and 11% acrylamide gels, in reducing or non-reducing condition. Electrophoresis was followed by either coomasie blue staining or western immunoblotting with an anti His tag antibody.

BLd-tm construction, expression and transduction

An anchored form of BLd-H77 was engineered by adding a hinge region (human IgG2) and the transmembrane domain of the CD34 protein to the E2 BLd. The construct, named BLd-tm, was then inserted into Gae-SFFV-IRES backbone harboring selectable marker gene P140K MGMT. A similar construct, but encoding for a HIV-1 gp41 fusion inhibitor peptide [50], namely C46, was used as a control. Construct details are available upon request. Lentiviral vectors transducing BLd-tm or C46 were produced from 293T cells. Stable expression in Huh-7.5 was obtained by transduction with vector particle-containing supernatants of 293T producer cells, followed by selection of O⁶-benzylguanine and BCNU. BLd-tm expression in Huh-7 cells was quantified by FACS analysis using a mouse anti human IgG2 and an anti-mouse APC antibody.

Proteins expression staining

BRL cells expressing CD81 or SRBI were washed and stained for 1h at 4°C with a mouse anti-human IgG2 antibody (for detection of C46 and BLd-tm), an anti-CD81 (JS81) and with an anti-human SR-BI (CLA-1) respectively. Cells were then washed and incubated with a secondary anti-mouse or rat APC antibody for 1h at 4°C. Cell surface expression levels were then quantified by flow cytometry (FACS CANTO II–BD Biosciences). For HCV receptor detection on Huh7.5 and Huh7.5-BLd-tm cells, cells were fixed with 2% formaldehyde for 20 min at room temperature and washed. For Occludin staining, cells were permeabilized with Perm/Wash Buffer (BD Biosciences) for 15 min at 4°C prior staining. Human CD81 was stained with JS81 mAb, human SRBI with CLA-1 mAb, human Claudin-1 with the MAB4618 and human Occludin with an anti-Occludin mAb targeting the human Occludin C-terminal region. To characterize the effect of BLd-H77 on HCV receptor expression, Huh7.5 were incubated overnight with BLd-H77 (50μg/ml) prior staining.

Production of HCVpp, infection and neutralization assay

HCVpp were produced as previously described [21,51] from 293T cells cotransfected with a murine leukemia virus (MLV) Gag-Pol packaging construct, an MLV-based transfer vector encoding the green fluorescent protein, and E1E2 envelope expression constructs H77 (AF009606), A40 (unreferenced), UKN1B 12.6 (AY734975), UKN2A 2.4 (AY734979), JFH-1(AB047639), J6 (AF177036), UKN2B 2.8 (AY734983), UKN3A 1.9(AY734985), UKN4 21.16 (AY734987), UKN5 14.4 (AY785283), HK 6A-2.1 (FJ230883) or control envelope HA-NA (CY077420) and VSV-G (AJ318514). All chimeric J6/2b1 E1E2 heterodimers were constructed by molecular cloning, PCR and/or digestion between the genotype 2a envelope J6 (AF177036) and a genotype 2b envelope UKN-2b1 (unreferenced). All chimeric H77/A40 E1E2 heterodimers were constructed using a similar strategy between the genotype 1a envelope H77 (AF009606) and A40 (unreferenced, but previously employed [21]). 72 to 96h following infection, percentage of infected cells was quantified by FACS Canto II or LSRII (BD Biosciences) to quantify GFP expression. For BLd-H77 dose-dependent neutralization assay, HCVpp H77 or VSVGpp were pre-incubated with different concentrations of BLd-H77 or with PBS for 1h at room temperature and were then used to infect Huh7.5. For the time-course neutralization assay, Huh7.5 were infected with HCVpp H77 for 4h prior washing. PBS, BLd-H77 (50 μg/ml), Bafylomycin A1 (20nM) or AR4A (25 μg/ml) were added into cell supernatant for 1h prior infection, during infection or after infection. Percentage of infected cells was determined 72h following infection. For HCVpp co-neutralization assay, HCVpp H77 pseudoparticles were pre-incubated for 1h at room temperature with BLd-H77 alone (35 or 50 μg/ml), AR4A alone (2 or 17 μg/ml) or with both BLd-H77 and AR4A (35 and 2 μg/ml, or 35 and 17 μg/ml). Pre-mixes were then used to infect Huh7.5 and media was changed 6h post infection. GFP intracellular levels were quantified 4 days post infection by flow cytometry. For HCVpp post-binding neutralization assay, HCVpp-H77 pseudoparticles were incubated with Huh7.5 in presence of BLd-H77 (50 μg/ml) or AR4A (25μg/ml) for 1h at 4°C (binding), for 4h at 37°C following binding (entry), or for 72h following entry (post-entry). As control, Huh7.5 were incubated and infected with HCVpp-H77 in a similar manner but not treated with BLd-H77 or AR4A.GFP intracellular levels and related percentage of infection were then quantified by flow cytometry. For HCVpp containment assay on Huh7.5-BLd-tm, Huh7.5 or Huh7.5-BLd-tm were infected or not with HCVpp H77 for 5h. Then, cells were washed and E2 cell surface expression was determined by flow cytometry following staining using the anti-E2 H53 antibody and a secondary anti-mouse APC antibody. Huh7.5 and Huh7.5-BLd-tm were infected similarly and GFP expression of infected cells was analyzed 72h post-infection.

Expression and incorporation of E1E2 glycoproteins onto HCVpp

Transfected 293T cells were lysed and nuclei were removed by centrifugation at 12 000 rpm for 10 min. HCVpps were purified and concentrated from the cell culture medium by ultracentrifugation at 82,000xg for 1h 45 min through a 20% sucrose cushion. Cell lysates and viral pellets were subjected to western blot analysis using 3/11 anti-E2 antibody and an anti-MLV-CA antibody as described previously [21].

HCVcc production and infection

Plasmid pFK H77/JFH1/HQL (kind gift of R. Bartenschlager), termed as H77/JFH-1, displaying HCV genome with adaptive mutations (Y835H in NS2, K1402Q in NS3, and V2440L in NS5A) and harboring H77 sequence derived from the BLd-H77peptide, as well as plasmid pFKi389-Venus-Jc1, termed as Jc1, (an intra-genotypic recombinant between J6-CF sequence (AF177036) and JFH1 sequence) were used to produce and electroporate into Huh7.5 the respective H77/JFH-1 and JC1 viral RNAs as described previously [21]. Huh7.5 cells, Huh7.5-BLd-tm or Huh7.5-C46 were infected with different dilutions of culture supernatants harvested at 24h, 48h and 72h post electroporation. Four days post-infection, cells were fixed with EtOH 100% and foci forming units (FFUs) were visualized after NS5A immunostaining as described previously [21]. For BLd-H77 dose-dependent neutralization assay, HCVcc particles were pre-incubated with different concentrations of BLd-H77 or with PBS for 1h at room temperature and were then used to infect Huh7.5. For time-course neutralization assay, Huh7.5 were infected with HCVcc for 4h prior washing. PBS or BLd-H77 (35 μg/ml) were added into cell supernatant for 1h prior infection, during infection or after infection. FFU/ ml were determined 4 days post-infection. To construct HCVcc particles harboring 2b1, J6-1/2, 2b1-1/2 or 2b1-1/3 envelope, we inserted by molecular cloning the related envelope into the pFKi389-Venus-Jc1 molecular clone, that initially encodes for J6 envelope. Viral RNAs were electroporated into Huh7.5 as described above. At 72h post electroporation, cell culture supernatants were tittered and used to infect naïve Huh7.5. Number of foci forming units per ml were determined 4 days post infection as described above. In parallel, viral RNA were extracted from electroporated cell culture supernatants at 72h post (ZR viral RNA kit, Zymo). HCV viral RNA copy number was quantified by one-step reverse transcription-PCR (RT-PCR) using MultiCode-RTx Real-Time PCR (Luminex) according to manufacturer’instructions and run on a Step One Plus quantitative PCR machine (Life Technologies). Data were analyzed using the MultiCode Analysis Software v1.6.5 (Luminex). The following primers were used for the detection of HCV RNA: GCTCACGGACCTTTCA (sense) and GGCTCCATCTTAGCCC (antisense).

Huh7.5-BLd-tm infection assay

H77/JFH1 virus was used to infect Huh7.5 and Huh7.5-BLd-tm (m.o.i. 0,1). At day 1, 3 and 5 post infection, cells were fixed with 2% formaldehyde for 20 min at room temperature, washed and permeabilized with Perm/Wash Buffer (BD Biosciences) for 15 min at 4°C. NS5A expression levels were then quantified using anti-NS5A antibody 9E10 by flow cytometry (FACS CANTO II–BD Biosciences). In parallel, cell supernatants were harvested at each time point, filtered and used to infect naïve Huh7.5. 72h post infections, infectious titers (FFU/ml) of cell supernatant were determined as described above.

Infection-dilution assay

HCVpp H77 and H77/JFH-1 HCVcc particles were preincubated for 1h at room temperature with PBS or BLd-H77 (50 μg/ml or 35 μg/ml respectively). Then, BLd-H77 and concentrated viral particles were diluted (1/5) with cell culture media or not prior infection of Huh7.5. 4 days post infection, percentages of GFP-positive cells were determined by flow cytometry and FFUs/ml were determined by NS5A immunostaining as described above.

Cell-to-cell transmission assay

H77/JFH-1 were used to infect Huh7.5 for 4h at 37°C (m.o.i. 0,05). After washing, cells were incubated with anti-E2 antibody AP33 (25μg/ml) alone, or mixed with BLd-H77 (35μg/ml), or with PBS. 72h post infection, cells were fixed and numbers of cell per foci for each condition were quantified through NS5A immunostaining as described above.

PHH infection and neutralization assay

PHH were washed and infected by JC1 HCVcc virus at different m.o.i. (0,005; 0,001; 0,05; 0,1). 4 days post infection, cell culture supernatants were harvested and used to infect naïve Huh7.5. Infectious titers were revealed through NS5A immunostaining 4 days post infection as described above. Indirect titrations were performed as infected PHH were poorly detectable through NS5A immunostaining, making the indirect titration the only accurate method to quantify the amount of infectious viral particles (and not physical viral particles) in a PHH-cell culture supernatant. For neutralization assay, JC1 virus or JC1-derived HCVpc were pre-incubated with BLd-H77 (10, 20 and 40 μg/ml) or with PBS for 1h prior PHH (m.o.i. 0,05) or Huh7.5 infection respectively (m.o.i. 0,01 and 0,02). 4 days post infection, infectious titers of PHH cell culture supernatants were determined by infecting Huh7.5 as described above. In parallel, infectious titers of JC1-derived HCVpc following Huh7.5 infection were quantified as described above. Sera containing HCV particles were used to infect PHH at a m.o.i. of 0,1 following BLd-H77 (30 μg/ml) or PBS preincubation for 1h at room temperature. 4 days post infection, cell culture supernatants were harvested and viral loads (RNA copies number/ml) were determined by RT-qPCR using a clinical diagnostic kit (Abbot Real Time™ HCV assay) with a limit of quantification (LOQ) of 12 IU/mL (i.e. 51.6 HCV RNA copies/ml). Given a serum dilution of 1:100 in PBS, LOQ = 5160 HCV RNA copies/ml.

Establishment of BRL cell lines expressing human CD81 and human SR-BI

Retroviral vectors expressing human CD81 (NM_004356) and SR-BI (Z22555) were described previously [52]. Retroviral vectors containing these cDNAs were produced from 293T cells as VSV-G pseudotyped particles as described previously [53,54]. Stable expression of either receptor in BRL cells was obtained as described previously [52].

E2 and HCVpp binding assay

Binding assays were performed as described previously [21]. Briefly, 50μl of concentrated virus (100x) or 100 ul of concentrated soluble E2 (100x) were pre-incubated with BLd-H77 (50 μg/ml) or with PBS for 1h at room temperature. Then, pseudoparticles or soluble E2 were mixed with Huh7.5, BRL, BRL-CD81 or BRL-human SR-BI in presence of 0.1% sodium azide for 1h at 37°C. Cells were then washed with PBFA (PBS, 2% fetal bovine serum, and 0.1% sodium azide). Bound viruses were detected using the mouse H53 anti-HCV E2 antibody and soluble E2 was detected using either the H53 antibody or a rabbit 6His-tag antibody for 1h at 4°C. After washing, primary antibodies were quantified by flow cytometry (FACS Canto II, BD Biosciences) using APC goat anti-mouse immunoglobulin-G. In parallel, concentrated HCVpp were pre-incubated with 50 μg/ml of BLd-H77 and used to infect Huh7.5 in order to verify the neutralizing effect of BLd-H77 on the entry of concentrated HCVpp. For BLd-H77 binding assay, BLd-H77 (50 μg/ml) or PBS were mixed with Huh7.5 for 1h at 37°C prior 6His-tag staining using a rabbit 6His-tag antibody.

Binding enhancement assay

Concentrated soluble E2 (100x; 100 or 250 μl) were mixed with equivalent number of Huh7.5 or Huh7.5-BLd-tm (2x10⁵ or 5x10⁵ cells) in presence of 0.1% sodium azide for 1h at 37°C. After washing, bound soluble E2 were detected using anti-E2 H53 antibody as described above. Levels of binding enhancement were determined relatively to the basal E2 binding on naïve Huh7.5. For HCVpp binding enhancement assay, 1x10⁵ Huh7.5 cells or Huh7.5-BLd-tm were infected with HCVpp for 4 hours. Cells were then trypsinized and washed with PBFA (PBS, 2% fetal bovine serum, and 0.1% sodium azide). Bound viruses were quantified by flow cytometry (FACS Canto II, BD Biosciences) following cell staining with the mouse H53 anti-HCV E2 and an APC goat anti-mouse immunoglobulin-G.

HCVcc binding assay

JC1 HCVcc particles (5x10⁴ i.u.) were pre-incubated with BLd-H77 (35 μg/ml), Heparine (250 μg/ml) or with PBS for one hour at 37°C. Viral particles were then mixed with 1x10⁵ Huh7.5 cells for 2h at 4°C. After 3 washings, cells were lysed using the RLT Buffer (QIAGEN) complemented with β-mercaptoethanol. Total RNAs were then extracted using the RNeasy mini kit (QIAGEN) as recommended by the manufacturer. Extracted RNAs were reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad) and HCV viral RNA (5-CTTCACGCAGAAAGCGCCTA and 5-CAAGCGCCCTATCAGGCAGT) and human GAPDH (5- GAAGGTGAAGGTCGGAGTC and 5- GAAGATGGTGATGGGATTTC) were then quantified by qPCR using the FastStart Universal SYBR Green Master kit (Roche Applied Science) on an Step One Plus quantitative PCR machine (Life Technologies). Cell-associated viral RNA copies were normalized on human GAPDH expression for each sample.

ELISA assay

96-well plates (Corning) were coated overnight with different amounts of a mouse IgG isotype (10ng and 100ng; Abcam), anti-E2 antibody AR3B [32] (10 and 100ng), and BLd-H77 (10, 100 and 250ng). The next day, following a one-hour incubation step with a SuperBlock blocking buffer (Thermo Scientific) to prevent non-specific binding, each coating condition was incubated with 10ng of sE2 or not. Interactions were revealed using a rat anti-E2 antibody 3/11 [47] or a rat IgG isotype, then followed by an incubation with an anti-rat HRP antibody (Biorad). Optical density signals at 450 nm were then assessed using a TriStar Multimode Microplate reader (Berthold).

Mice and primary human hepatocytes (PHH) transplantation

FRG (Fah^–/–Rag2^–/–Il2rg^–/–) mice (mixed background: C57BL/6 and 129Sv) were housed in our animal facility (Plateau de Biologie Experimentale de la Souris, PBES, Lyon, France). Because of their lethal phenotype, mice are maintained on 8 mg/l of NTBC (nitro-4-trifluoro-methylbenzoylcyclohexanedione) in the drinking water. 48h prior the engraftment, adult (6–10 weeks old) mice were injected intravenously with 2x10⁹ p.f.u. of an adenoviral vector encoding the uPA transgene. 7x10⁵ to 1x10⁶ PHH (BD Biosciences) were injected intrasplenically as previously described [55]. Immediately after engraftment, the NTBC was progressively withdrawn as follow: 2 days at 10% of colony maintenance concentration, then 2 days at 5%, 2 days at 2.5%, then the NTBC was completely removed. During the phase without NTBC, mice were weighted every two days. After 2–6 weeks, mice with clinical symptoms (lethargy, hunched posture) or severe weight loss (>15%) were put again on NTBC for 3 days before second withdrawal (cycling). Cycling was repeated until clinical symptoms resolved. In order to prevent the development of a murine hepatocellular carcinoma, highly reconstituted mice selected for infectious experiments were subjected to further NTBC treatment (3–4 weeks w/o NTBC and 3 days with 100%).

FRG mice serological analyses

Blood from transplanted mice and controls were collected every 2–4 weeks after engraftment by retro orbital puncture. Sera were sent to a diagnostic laboratory for quantification of human Albumin (Cobas C501 analyzer, ROCHE).

HCV infection of humanized liver FRG mice

Highly reconstituted mice (HSA >15mg/ml) were infected with JC1 HCVcc particles inocula (10⁵ i.u.) or with patient-derived HCV particles (5x10⁴ i.u.) via intraperitoneal route. Mice sera were collected at day 7 and day 14 post-infection by retro-orbital bleeding. At day 21, mice were sacrificed, sera were collected and levels of human albumin were determined (Cobas C501 analyzer, ROCHE). JC1 infectious titers in mice sera were determined through infection of Huh7.5 with different dilutions of sera as described above. In parallel, for HCV particle containing sera, viral load was determined by RT-qPCR using a clinical diagnostic kit (Abbot Real Time™ HCV assay) with a limit of quantification (LOQ) of 12 IU/mL (i.e 51.6 HCV RNA copies/ml). Given a serum dilution of 1:100 in PBS, LOQ = 5160 HCV RNA copies/ml.

In vivo HCV inhibition assay

A first cohort of 11 mice was attributed for an in vivo inhibition assay of JC1 infection (9 mice + 2 negative controls; one non-infected and one non-engrafted). 7 mice were treated under a prophylactic protocol with PBS (4 mice) or with 30 μg (3 mice) of BLd-H77. Mice were treated via intra-peritoneal route one day prior infection, and at day 1, 7 and/or 14 post-infection infection. For all the mice, sera were harvested and viral titers were quantified at day 7, 14 and during sacrifice 21 post infection. A second independent cohort of 7 mice was attributed for another in vivo inhibition assay of JC1 infection (5 mice + 2 negative control). Here, JC1 infection was challenged with a dose of 150μg of BLd-H77 (2 mice) or with PBS (3 mice) under a prophylactic protocol similar as described above. A cohort of 14 mice (12 mice + 2 negative control) was attributed for an in vivo inhibition assay of serum-derived HCV particles infection, challenged with one dose of BLd-H77 (150 μg, 5 mice) or with PBS (7 mice) under a prophylactic protocol similarly to what has been described above. Serum-derived HCV particles viral load were determined as described above. Following sacrifice, the level of human Albumin was quantified for each untreated and treated mice in order to ensure that HCV infection inhibition was not due to a decrease of liver humanization caused by BLd-H77.

Cell-cell fusion assay

Cell-cell fusion assays were performed as described previously [13,19]. Briefly, HEK-293T cells (2.5x10⁵ cells/well seeded in six-well tissue culture dishes 24 h before transfection) were co-transfected using calcium phosphate reagent with a HCV (H77, J6, 2b1 or J6/2b1 chimera) or VSV-G envelope encoding-plasmids and with an HIV-1 LTR (long terminal repeat) luciferase reporter plasmid. After 12h, transfected HEK-293T cells were detached with versene (0.53 mM EDTA; Invitrogen) and co-cultured (5x10⁴ cells/well) with Huh-7-Tat indicator cells (5.10⁴cells/well) in a 24-well plate. After 24 h, the cells were washed with serum free DMEM, incubated for 3 min in either pH 7 or pH 5 buffer (130 mM NaCl, 15 mM sodium citrate, 10 mM Mes and 5 mM Hepes) and then washed three times with serum free DMEM. The luciferase activity was measured 72 h later using a luciferase assay kit according to the manufacturer’s instructions (Promega). For fusion neutralization assay, coculture were washed, pre-incubated with BLd-H77 (50μg/ml) or with PBS for 1h at 37°C prior a second washing and exposure to pH buffer. Alternatively, co-cultured cells pre-treated by BLd-H77 or PBS were incubated for an extension of 24h following pH shock by BLd-H77 (50μg/ml) or PBS.

Liposomes fusion assays

HCVpp/liposome lipid mixing was performed as previously described [21,56]. R18-labeled liposomes were obtained by mixing octa-decyl rhodamine B chloride (R18; Molecular Probes) and lipids (phosphatidylcholine and cholesterol; Aventi) and mixed with 40 μl of concentrated HCV pseudoparticles (non-enveloped HCVpp, HCVpp-H77 and HCVpp harboring the fusion defective envelope E140/E2H77 previously characterized [21]) or retroviral particles pseudotyped with Influenza Hemagglutinin-Neuraminidase (HANApp), all diluted in PBS (pH 7.4) within a 37°C thermostable 96-well plate. After pH decrease to 5 (acidification), dequenching of R18 due to lipid mixing between HCVpp and liposomes were recorded on a micro-plate fluorometer (InfiniteM1000 Tecan Group Ltd) for a period of 5 to 20min with an excitation wavelength (λexc) at 560 nm and an emission wavelength (λem) at 590 nm. Maximal R18 quenching was measured after the disruption of liposomes by the addition of 0.1% TritonX-100. For fusion-neutralization assays, pseudoparticles were pre-incubated with different doses of BLd-H77 or with PBS for 1h prior incubation with liposomes and acidification.

Structural analysis

Structural analysis of Dengue E pre-fusion structure (PDB 1K4R), E-Pr complex structure (3C6E), E post-fusion structure (1OK8) and E2core structure (4MWF) were realized using Chimera software [57] (UCSF).

Statistical analysis

GraphPad Prism software (version 6) was used for statistical analysis. Statistics were calculated using Student’ t test and/or two-way ANOVA when appropriate. (*p<0.05, **p<0.01, ***p<0.001).

Protein sequence alignment

Protein amino acid sequence alignments were realized using ClusterX2.1 and rendered as Post-script format.

Computational coevolution analysis using BIS

The BIS methodology and related-coevolution signal analysis are described in details in reference [22], [23] and [24]. Applicability of BIS for detecting coevolution signals in viral sequences is specifically described in reference [23].

Attribution of putative functions to E1E2 clusters in S4 Table and S7 Table

Literature describing amino acids mutations within E1E2 sequences impacting E1E2 folding/heterodimerization, E1E2 binding to cellular receptors or E1E2 fusion was used as references to attribute functions to clusters mapping specific regions within E1E2 sequences. The references used were the following: Folding/Heterodimerization [19,27,28,58–60], Viral binding site conformation [19,20,26,60–66] and Fusion [11,13,19–21,27,67].