The following text replaces the corresponding text in the Materials and Methods section, which incorrectly described UAS>painlessFL constructs: "The full length painless cDNA from BDGP gold collection (RE03641) has been used as a template. In this cDNA, a TN10 transposon was found to be inserted following nucleotide 1795. To remove the TN10 transposon, we have used a two step PCR strategy. Painless sequences flanking the TN10 sequence were amplified using primers couples (forward/reverse): caaggagacgcagcgcgtcttagccg/ggtaccaacatttgaaattaaatatttactc and gcggccgcggtcgttgtctggatattaa /cggctaagacgcgctgcgtctccttg. Next, the products of these two PCR were mixed to use as a new template and amplified using the following primers couple (forward/reverse): ttaatagcggccgcggtcgttgtctggatattaa/ttaataggtaccaacatttgaaattaaatatttactc. NotI and KpnI restriction sites were respectively included in those forward and reverse primers. The PCR product was verified by sequencing and revealed a single silent mutation at nucleotide 1605 changing C in T. It was subsequently cloned into a KpnI/NotI-cut pUAST-attb transformation vector [46]. This pUAST-attb-pain is available on request."
Citation: Sénatore S, Rami Reddy V, Sémériva M, Perrin L, Lalevée N (2011) Correction: Response to Mechanical Stress Is Mediated by the TRPA Channel Painless in the Drosophila Heart. PLoS Genet 7(2): 10.1371/annotation/67b1f487-ed62-43b1-9010-ea89cf246b5d. https://doi.org/10.1371/annotation/67b1f487-ed62-43b1-9010-ea89cf246b5d
Published: February 17, 2011
Copyright: © 2011 . This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Competing interests: No competing interests declared.