Glandular metaplasia, epithelial hyperplasia, and failure of filiform papilla formation upon loss of SMO in the lingual epithelium

To decipher the function of SHH in patterning of and cell type specification in the LE, we first irreversibly ablated SHH signaling in epithelial cells that express Shh and their progeny by ShhGFPCRE-mediated removal of Smo in mutants carrying Smo floxed (f) alleles (ShhGFPCRE/Smo^f/f). The ShhGFPCRE/Smo^f/f mutants die shortly after birth due to unknown causes. Littermates not carrying the ShhGFPCRE knockin and/or the Smo floxed alleles and heterozygotes, which are viable and phenotypically normal, were used as controls. Tongues from embryos carrying the R26R transgene (ShhGFPCRE/R26R) showed robust CRE activity in the LE (S1A–S1D Fig). Probes targeting Ptch1 and Gli1, which are readouts of Hedgehog activity [6,9,17–19], confirmed the absence of Ptch1 and Gli1 transcripts in the ShhGFPCRE/Smo^f/f LE, indicating efficient Smo ablation in this tissue. By contrast, and as expected, the LM retained endogenous hedgehog signaling (S1E–S1H’ Fig). Consistent with these findings, RT-qPCR revealed downregulation of Ptch1 in ShhGFPCRE/Smo^f/f tongues (S1I Fig).

To assess the impact of epithelial SMO ablation on tongue development, we compared control and ShhGFPCRE/Smo^f/f tongues at E17.5, E18.5, and shortly after birth (postnatal day P0). Alcian blue van Gieson staining and immunohistochemistry for Keratin 8 (K8) revealed striking defects within the LE and its derivatives in the ShhGFPCRE/Smo^f/f cohort with 100% penetrance. Specifically, the oral tongue, a territory normally bereft of glands, exhibited heterotopic serous and sero-mucous glands (Fig 1C–1F). Furthermore, the LE was hyperplastic, lacked filiform papillae (Fig 1C’–1D’), and displayed overgrown von Ebner’s glands transformed into a sero-mucous type (Fig 1G and 1H; see also S6 Fig), as well as epithelial foci virtually devoid of K8, Keratin 6, and Keratin 15 immunostaining (Fig 1I–1N). 7.6% of mutants also showed adhesions between the LE and epithelia of the floor of the oral cavity (Fig 1F). Taken together, these findings indicate that an altered antero-posterior patterning and differentiation program in the SMO-deficient LE is translated into development of glands in the oral tongue, abnormal development of von Ebner’s glands, and formation of epithelial regions exhibiting a molecular signature different from that of the normal LE.

The ShhGFPCRE/Smo^f/f tongue undergoes Merkel cell metaplasia

Closer examination revealed abnormal formation of K8-positive (+) (Fig 2A and 2B) and SOX2+ (Fig 2C and 2D) solitary cells in the basal layer of the LE in all ShhGFPCRE/Smo^f/f mutants examined at E17.5 to P0. We postulated that these cells could be stray TB cells or ectopic epithelial tactile cells called Merkel cells, as both cell types express high levels of Sox2 and Krt8 [20–22]. Merkel cells do not express Shh (Fig 2P) [21], whereas all TB cells express SHH at least up to the perinatal period (Fig 2E and 2F) [4]. K8/SHH immunostaining revealed absence of SHH+ solitary cells in the basal layer of the ShhGFPCRE/Smo^f/f LE and showed that the K8+ solitary cells were SHH-negative (–) (Fig 2F; S1 Table), suggesting that these were not TB cells. To further assess this notion, we immunostained sections for Homer1, a scaffolding protein found in skeletal muscle and brain [23] which we serendipitously identified as a reliable TB marker in the course of this study; Homer1 expression in the LE of control and ShhGFPCRE/Smo^f/f tongues is not only restricted to the TBs, but also readily detectable in all TB cell types (Fig 2G–2J; S1 Table), differing from other marker proteins that are only expressed in subsets of TB cells [1,4]. Neither orthotopic K8+ Merkel cells in whisker pads (Fig 2Q) [21] nor the K8+ solitary cells in the basal layer of the ShhGFPCRE/Smo^f/f LE (Fig 2K; S1 Table) were Homer1+. Thus, two TB markers, SHH and Homer1, excluded a TB cell type and supported a Merkel cell identity of the solitary cells in the mutant LE. To confirm that these cells were Merkel cells, we examined expression of Rab3c, a protein known to be enriched in Merkel cell cytoplasmic vesicles (Fig 2R) [21]. We found that while the basal layer of the LE in controls as well as K8+ TBs in controls and ShhGFPCRE/Smo^f/f mutants were Rab3c(–), the ectopic K8+ solitary cells within the ShhGFPCRE/Smo^f/f LE were Rab3c+ (Fig 2L and 2M; S1 Table). These data show that the K8+, SOX2+, and Rab3c+ cells were indeed ectopic Merkel cells, indicating that the LE, a tissue normally devoid of Merkel cells in humans and mice, underwent Merkel cell metaplasia upon loss of SMO.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. The ShhGFPCRE/Smo^f/f lingual epithelium undergoes Merkel cell metaplasia.

(A-O) Parasagittal tongue sections from newborn (P0) controls and ShhGFPCRE/Smo^f/f mutants. (A-D) Sections of control (A,C) and mutant (B,D) tongues immunostained (purple) for Keratin 8 (K8; A,B) and SOX2 (C,D). The inset in (B) is an enlarged image of the boxed area in (B). The mutant tongues exhibit K8-positive (+) and SOX2+ ectopic Merkel cells (MC) in the epithelial basal layer. Taste buds (TB) are also K8+ and SOX2+. (E,F) Sections of control (E) and mutant (F) tongues after double staining for K8 (green) and Sonic Hedgehog (SHH; red). TBs are K8+/SHH+. The K8+ ectopic Merkel cells in the mutant are SHH-negative (–). (G,H) Anti-Homer1-stained (purple) sections of control (G) and mutant (H) tongues showing Homer1(+) TBs. (I-K) Sections of control (I) and mutant (J,K) tongues after double staining for K8 (red) and Homer1 (green), showing K8+/Homer1+ TBs (I,J) and K8+/Homer1(–) ectopic Merkel cells (K). (L,M) Sections of control (L) and mutant (M) tongues after double staining for K8 (red) and Rab3c (green). The ectopic Merkel cells (arrowheads in M) are K8+/Rab3c+, whereas TBs are K8+/Rab3c(–). (N) Section across a mutant tongue after double staining for K8 (green) and NF-200 (NF; red) showing ectopic Merkel cells wrapped by NF-200+ neurites (arrowheads). The insets in (N) are non-merged, enlarged images of the boxed area in (N). (O) Section of a mutant tongue after double staining for K8 (green) and P2X2 (red) showing that the ectopic Merkel cells are not associated with P2X2+ gustatory neurites. (P-R) Sections across the whisker pad of control newborns after double staining for K8/SHH (P), K8/Homer1(Q) and K8/Rab3c (R). Merkel cells of the whisker follicles and adjacent epidermis are K8+/SHH(–), K8+/Homer1(–), and K8+/Rab3c+. FuP, fungiform papillae; HF, hair follicle; SG, sebaceous glands; Wh, whisker follicle. Scale bars: 200 μm (A,B), 50 μm (C-J, L,M, O-R), and 20 μm (K,N).

https://doi.org/10.1371/journal.pgen.1006914.g002

In mice, Merkel cells develop in whisker pads and touch domes of hairy and glabrous skin [24] and become innervated postnatally [24,25]. Remarkably, we found that the majority of the K8+ ectopic Merkel cells in the ShhGFPCRE/Smo^f/f LE were innervated by NF-200+ neurites (Fig 2N; S1 Table), suggesting that they might be functional in this foreign environment. TBs in fungiform papillae are innervated by P2X2+ gustatory axons [26], however, none of the K8+ basally located solitary cells in the ShhGFPCRE/Smo^f/f LE were innervated by P2X2+ axons (Fig 2O; S1 Table), further supporting our conclusion that these cells are ectopic Merkel cells and not TB cells.

Unlike in the glabrous skin where Merkel cells develop in the absence of SHH inputs, Merkel cell specification in the hairy skin is dependent on SHH signaling [27]. Here we showed that in the absence of SMO, a subset of cells in the LE are diverted to a Merkel cell fate. Taken together, these observations suggest a context-dependent requirement for SHH signaling for Merkel cell specification. Polycomb genes have been shown to repress Sox2 which encodes a crucial factor for Merkel cell specification in the epidermis [28]. However, the LE expresses Sox2 mRNA and protein from early stages of tongue development onwards [22,29], and the ectopic Merkel cells in the ShhGFPCRE/Smo^f/f LE express SOX2 protein. These observations likely indicate that Polycomb genes are not effectors of the repression of Merkel cell formation in the LE. TBs and Merkel cells both degenerate after denervation [30,31] and share common markers such as Krt8, K20, Sox2, Advillin, Satb2, Cpe, Claudins 6/7, Mash1, Hes6, and Snap25 [1,21,22,32–34]. This raises the possibility that a subset of TB progenitors converted into Merkel cells in the SMO-deficient LE.

Overproduction of oversized fungiform placodes upon epithelial loss of SMO

In vitro modulation of SHH signaling in the developing rodent tongue impinges upon FP patterning [12–15], however, it is currently unclear whether this is due to altered SHH activities in the LE, LM, or both. Furthermore, whether SHH has a role in FP patterning in vivo is still unknown. To address these points, we analyzed the effects of loss of epithelial SMO on FP development by assessing the expression patterns of Shh mRNA and protein, an established taste placode marker. At E12.5, the LE and LM showed robust and weak SHH immunostaining, respectively, in both control and ShhGFPCRE/Smo^f/f tongues. The staining of the LM and interplacodal epithelium was the result of protein diffusion from taste placodes which produce SHH (Fig 3A and 3B). At E14, instead of being restricted to FPs as in control tongues, SHH staining was expanded in the LE of the ShhGFPCRE/Smo^f/f tongues (Fig 3C and 3D). At E14.5 FP induction normally ceases, and Shh transcripts become confined to developing TBs [4]. While at E14.5 and E15.5 the control tongues showed this expected Shh expression pattern, the ShhGFPCRE/Smo^f/f tongues displayed a remarkable expansion of Shh expression (Fig 3E–3H) and overproduced enlarged Shh-expressing spots (FPs and/or TBs), some of which developed ectopically (Fig 3G–3L). Quantification in E15.5 mutant and control tongues revealed increased numbers of Shh+ spots in the mutants (147 ± 8 in mutants vs 101 ± 7 in controls; mean ± SD; P = 0.000). Thus, loss of SMO in the LE not only caused Merkel cell and glandular metaplasiae, but also engendered mispatterning of FPs as a result of their overproduction. Despite displaying FP patterning defects, the ShhGFPCRE/Smo^f/f tongues developed K8+ TBs that were innervated by P2X2 neurites (Fig 3M and 3N; S1 Table).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. The ShhGFPCRE/Smo^f/f mutant tongues show expansion of Shh expression in the lingual epithelium, and develop innervated taste buds.

(A-D) Anti-Sonic hedgehog-stained (SHH; purple) parasagittal tongue sections from controls (A,C) and mutants (B,D) at E12.5 (A,B) and E14 (C,D) showing abnormally expanded SHH staining in the lingual epithelium (LE) of the E14 mutant. (E,F) Dark-field images of frontal tongue sections from E14.5 control (E) and mutant (F) embryos after Shh in situ hybridization showing abnormally expanded Shh expression in the LE of the mutant. (G-L) E14.5 (G-J) and E15.5 (K,L) control (G,I,K) and mutant (H,J,L) tongues after in situ hybridization (dark blue/brown; G,H,K,L) and green fluorescent protein (GFP) imaging (I,J) showing Shh expression. The mutant tongues exhibited abnormally enlarged Shh+ spots, some of which developed ectopically along the tongue midline (H,J,L). (M,N) Parasagittal tongue sections from control (M) and mutant (N) newborns (P0) after double staining for Keratin 8 (K8; green) and P2X2 (red) showing innervated TBs. CvP, circumvallate papilla; FP, fungiform placode; T, tongue; TB, taste bud; To, tooth bud. Scale bars: 500 μm (E-J), 300 μm (K,L), 200 μm (A-D), and 25 μm (M,N).

https://doi.org/10.1371/journal.pgen.1006914.g003

Temporal requirement for SHH inputs in the developing tongue for growth, morphogenesis, patterning and cell type specification

Having uncovered a stringent requirement for epithelial SHH signaling for patterning and differentiation of the LE, we sought to decipher the role of SHH inputs in the LE and LM by assessing the impact of loss of SHH production. We generated ShhCreER^T2/Shh^f mutant mice carrying both a Shh floxed allele and the tamoxifen (TAM) -inducible ShhCreER^T2 knockin allele. Without exposure to TAM, the ShhCreER^T2/Shh^f mice are viable and phenotypically normal. Ablation of Shh in the mutants was induced at E10.5. Immunostaining and in situ hybridization confirmed that TAM exposure led to a dramatic decrease of SHH protein in the LE and severe downregulation of Gli1 expression in the LE and LM (Fig 4A–4D) of the ShhCreER^T2/Shh^f tongues, indicating loss of SHH signaling. This was further confirmed by RT-qPCR for Ptch1 (Fig 4O). Upon dissection, we found that relative to their control littermates, the E10.5 TAM-induced ShhCreER^T2/Shh^f mutants developed abnormally small tongues (microglossia) with a bifid tip as well as epithelial foci of squamous hyperplasia (Fig 4A–4F). Of note, bifid tip of the tongue has been described in patients with Ellis-van Creveld syndrome, which is caused by mutations of the EVC and EVC2 genes that lead to decreased Hedgehog signaling [35–38].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Early loss of SHH signaling in the tongue impinges upon growth and morphogenesis but is conducive to taste bud differentiation.

(A-N) Tongues and parasagittal tongue sections from control and ShhCreER^T2/Shh^f mutant embryos first exposed to tamoxifen at E10.5. (A,B) Anti-Sonic hedgehog-stained (SHH; dark purple) sections of E15.5 control (A) and mutant (B) tongues showing focal epithelial hyperplasia (arrow in B) and severely decreased SHH immunostaining in the mutant. (C,D) Gli1 in situ hybridization (brown) in sections from E13.5 control (C) and mutant (D) tongues showing severe downregulation of Gli1 expression in the mutant. (E,F) E15 control (E) and mutant (F) tongues after in situ hybridization with a riboprobe targeting both deleted (exon2) and non-deleted (exon1) Shh-coding sequences (dark purple). Abnormally small mutant tongue with a bifid tip, and exhibiting oversized Shh+ spots (arrowheads in F). (G-L) Sections of E15.5 (G-I) and E17.5 (J-L) control (G,K) and mutant (H-J,L) tongues immunostained (dark purple) for keratin 8 (K8; G-I, K,L) and Rab3c (J). The insets in (K) and (L) are enlarged images of the boxed areas in (K) and (L), respectively. The control and mutant tongues show K8+ taste buds (TB) in fungiform papillae (FuP), and the mutant tongues exhibit K8+ and Rab3c+ ectopic Merkel cells (MC). (M,N) Tongue sections from E18 control (M) and mutant (N) embryos after K8 (green) and P2X2 (red) double staining showing innervated TBs. (O) RT-qPCR analysis for Ptch1 relative to Actb (β-actin) in tongues from E13.5 controls (n = 6) and mutants (n = 6) first exposed to tamoxifen (TAM) at E10.5. Severely decreased Ptch1 levels in the mutant tongues as compared to the controls (P = 0.0000; mean values ± SD). PD, periderm; CvP, circumvallate papilla; Ic, incisor; RP, rugae palatinae; T, tongue. Scale bars: 500 μm (E,F,K,L), 200 μm (A-D), 100 μm (G,H), 50 μm (I,J), and 25 μm (M,N).

https://doi.org/10.1371/journal.pgen.1006914.g004

In situ hybridization with a Shh riboprobe targeting both deleted (exon2) and non-deleted (exon1) Shh-coding sequences [39] revealed enlarged Shh+ spots, likely TBs or FPs, some of which were ectopically located along the midline of the E10.5 TAM-induced ShhCreER^T2/Shh^f tongues (Fig 4E and 4F). Furthermore, these tongues formed K8+ TBs (Fig 4H and 4L) innervated by P2X2+ neurites (Fig 4M and 4N; S2 Table). However, unlike the ShhGFPCRE/Smo^f/f tongues, the E10.5 TAM-induced ShhCreER^T2/Shh^f tongues were exempt from glandular metaplasia, i.e. no heterotopic glands developed in the oral tongue (Fig 4L), and displayed only a few scattered ectopic Merkel cells (Fig 4I and 4J). Thus, SHH is required for growth and morphogenesis of both the LE and LM, but it is dispensable for FP induction.

Remarkably, in ShhCreER^T2/Shh^f mutants first exposed to TAM at E11.5, the tongues grew normally (Fig 5F–5I) despite severely reduced SHH signaling as revealed by in situ hybridization with probes targeting Shh exon2 (Fig 5A and 5B) [40] and Gli1 (Fig 5C and 5D) as well as by Ptch1 RT-qPCR (Fig 5E). In situ hybridization for Shh-exon1/exon2 (Fig 5F and 5G) and immunostaining for K8 and SOX2 (Fig 5H–5N) revealed that the E11.5 TAM-induced ShhCreER^T2/Shh^f tongues overproduced fungiform papillae harboring oversized TBs. Quantification in E15.5 control and ShhCreER^T2/Shh^f mutant tongues showed dramatically increased numbers of Shh+ spots (FPs and/or TBs) in the mutants (150 ± 6 in mutants vs 112 ± 4 in controls; mean ± SD; P = 0.000). Furthermore, quantification of K8+ cell clusters (TBs or parts of TBs) within fungiform papillae at E18.5 revealed a higher number of K8+ cell clusters in ShhCreER^T2/Shh^f mutants when compared to controls (3.50 ± 0.50 K8+ clusters/section in mutants vs 1.43 ± 0.23 K8+ clusters/section in controls; mean ± SD; P<0.02). However, the mutant tongues assessed by K8 immuostaining were free from glandular and Merkel cell metaplasiae (Fig 5I and 5J; S2 Table). Similar to TBs in the E10.5-induced ShhCreER^T2/Shh^f tongues, TBs within fungiform papillae in the E11.5 TAM-induced ShhCreER^T2/Shh^f tongues were innervated by P2X2+ axons (Fig 5M and 5N; S2 Table). Thus, unlike in the central nervous system where SHH can act as an axonal chemoattractant [41], SHH is not required for local guidance of gustatory neurites towards fungiform papillae.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Tamoxifen induction at E11.5 causes overproduction of oversized, innervated taste buds in ShhCreER^T2/Shh^f mutant tongues.

(A-N) Analyses of tongues from control and ShhCreER^T2/Shh^f mutant embryos first exposed to tamoxifen at E11.5. (A,B) In situ hybridization with a riboprobe targeting Shh exon2 (the deleted allele) in E13.5 control (A) and mutant (B) tongues showing severely decreased Shh expression (purple) in the mutant tongue. (C,D) Gli1 in situ hybridization (brown) in parasagittal sections of E14.5 control (C) and mutant (D) tongues showing severe downregulation of Gli1 expression in the mutant tongue, except in a small domain (arrows in D). (E) RT-qPCR analysis for Ptch1 relative to Actb (β-actin) in tongues from E13.5 controls (n = 9) and mutants (n = 9). Severely decreased Ptch1 levels in the mutant tongues as compared to the controls (P = 0.0000; mean values ± SD). (F,G) E15.5 control (F) and mutant (G) tongues after in situ hybridization with a riboprobe targeting both deleted (exon2) and non-deleted (exon1) Shh-coding sequences (brown) showing overproduction of oversized Shh-expressing taste buds in the mutant tongue. (H-L) Immunostaining (dark purple) for Keratin 8 (K8; H-J) and SOX2 (K,L) in parasagittal sections of E18.5 (H-J) and E16 (K,L) control (H,K) and mutant (I,J,L) tongues. The insets in (H) and (I) are enlarged images of the boxed areas in (H) and (I), respectively. The mutant tongues exhibit crowded and oversized taste buds (TB; I,L) and a fungiform papilla (FuP) abnormally harboring three TBs (J). Artefact (asterisk in I). (M,N) Parasagittal sections of E18 control (M) and mutant (N) tongues after K8 (green) and P2X2 (red) double staining showing innervated TBs. CvP, circumvallate papilla; T, tongue. Scale bars: 500 μm (A,B,F,G,H,I), 200 μm (C,D), 50 μm (J-L), and 25μm (M,N).

https://doi.org/10.1371/journal.pgen.1006914.g005

To further dissect the role of SHH in lingual cell fate specification, we analysed Wnt1-CRE/Smo^f/f mutants lacking SHH signaling specifically in the LM. As shown previously [6], the Wnt1-CRE/Smo^f/f tongues were abnormally small and cleft, and we found that they developed TBs and were free from glandular metaplasia (S2A–S2D Fig). The overlapping tongue anomalies in the E10.5 TAM-induced ShhCreER^T2/Shh^f mutants and the Wnt1-CRE/Smo^f/f mutants demonstrate that SHH activity in the LM is necessary for tongue growth and morphogenesis but not for TB induction. The lack of glandular metaplasia in the oral tongue of the Wnt1-CRE/Smo^f/f mutants as well as in the E10.5 and E11.5 TAM-induced ShhCreER^T2/Shh^f mutants, as compared to the ShhGFPCRE/Smo^f/f mutants, suggests the requirement for SHH-dependent mesenchymal inputs for ectopic gland formation. This situation is akin to that of the skin where induction of glandular metaplasia was found to require SHH signaling in the mesenchyme [19].

We also found that proper tongue development necessitates SHH inputs during a restricted period since the ShhCreER^T2/Shh^f mutants and the ShhCreER^T2/Smo^f/f mutants developed normal tongues following an initial TAM exposure at E12.5 (S2E–S2H’ Fig). That loss of SMO in the interplacodal epithelium of K14-CRE/Smo^f/f mutant tongues caused no tongue defects (S2I–S2J’ Fig) further demonstrates a temporal requirement for SHH signaling in tongue development. K14-CRE activity in the LE is late onset (≈ E13.5) (S2K–S2N Fig) [42], and taste placodes as well as TBs do not express K14 [29]. Together, these findings point to a restricted period before E12.5 during which loss of SHH signaling induces tongue defects and support previous findings in rat tongue organ cultures [15].

De novo taste placode formation upon loss of SHH signaling

The active phase of FP patterning during which FPs are induced normally occurs between E12.5 and E14, and the FPs subsequently form TBs. Strikingly, from E15.5 onwards, unlike in controls, the ShhGFPCRE/Smo^f/f tongues consistently displayed SHH/Shh-expressing placode-like structures underlain by a Ptch1+ mesenchyme, suggesting de novo formation of FPs well after their induction normally has ceased (Fig 6A–6H). Basally located SHH+ cell clusters were also detected in the E11.5 TAM-induced ShhCreER^T2/Shh^f mutant tongues. They displayed weaker SHH immunoreactivity than TBs in controls, likely subsequent to Shh gene expression ablation shortly after they express Shh (Fig 6I–6J’).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Ectopic and anachronic expression of Shh and Wnt10b in the lingual epithelium of ShhGFPCRE/Smo^f/f and tamoxifen-induced ShhCreER^T2/Shh^f mutants specify de novo taste placode formation.

(A-D) Anti-Sonic hedgehog-stained (SHH; dark purple) parasagittal tongue sections from controls (A,C) and ShhGFPCRE/Smo^f/f mutants (B,D) at E16.5 (A,B) and postnatal day P0 (C,D). (E-H) Shh (E,F) and Ptch1 (G,H) in situ hybridization in parasagittal tongue sections from E18.5 control (E,G) and ShhGFPCRE/Smo^f/f (F,H) embryos. The signals appear as black or shiny dots in bright-field (E,F) or dark-field (G,H) images, respectively. SHH protein and Shh mRNA (SHH/Shh) are confined to taste buds (TB) of fungiform papillae (FuP) in the control tongues (A,C,E). The ShhGFPCRE/Smo^f/f tongues display SHH+/Shh+ placode-like entities (arrows in B,D and F) underlain by a Ptch1+ mesenchyme (arrows in H). (I-J’) Anti-SHH-stained parasagittal tongue sections from E16 control (I) and ShhCreER^T2/Shh^f mutant (J) embryos first exposed to tamoxifen at E11.5. (I'), (J'), and insets in (I) and (J) are enlarged images of the boxed areas in (I) and (J), respectively. TBs within fungiform papillae of the mutant tongue (inset in J) exhibit weaker SHH staining than those of the control tongue (inset in I). The mutant tongue shows SHH staining in placode-like structures in the epithelial basal layer (arrows in J’). (K-P) Wnt10b in situ hybridization (black) in parasagittal tongue sections. Sections from 17.5 control (K) and ShhGFPCRE/Smo^f/f mutant (L) embryos. Sections from 17.5 control (M) and ShhCreER^T2/Shh^f mutant (N) embryos first exposed to tamoxifen (TAM) at E11.5. Sections from E15.5 control (O) and ShhCreER^T2/Shh^f mutant (P) embryos first exposed to TAM at E10.5. All the mutant tongues show abnormal expression of Wnt10b in the epithelial basal layer (arrows) separated by Wnt10b-negative gaps. Ic, incisor tooth. Scale bars: 250 μm (I,J), 200 μm (A,B,E-H,K-P), 100 μm (I';J'), and 50 μm (C,D).

https://doi.org/10.1371/journal.pgen.1006914.g006

We next used a probe targeting Wnt10b which, like Shh, marks taste placodes [4]. In contrast to control tongues, which were devoid of Wnt10b transcripts after E14.5, the ShhGFPCRE/Smo^f/f as well as the E10.5 and E11.5 TAM-induced ShhCreER^T2/Shh^f tongues abnormally exhibited Wnt10b expression separated by Wnt10b(–) regions within the basal layer of the LE (Fig 6K–6P). That the basally located placodes expressing Shh mRNA and protein (Shh/SHH) and Wnt10b were overlain by Shh/SHH(–) and Wnt10b(–) suprabasal epithelial cells (Fig 6A–6P) supports de novo induction of FPs. These data show sustained formation of taste placodes upon loss of SHH signaling, at least up to birth, and are reminiscent of the finding that K14-CRE/Smo^f/f mutants undergo de novo hair follicle formation [19]. Since de novo taste placode induction occurred in the ShhGFPCRE/Smo^f/f and TAM-induced ShhCreER^T2/Shh^f mutant tongues, it could be concluded that loss of SHH signaling in the LE is the main cause of this phenomenon.

Our work here utilized a genetic approach to reveal that upon loss of SHH signaling, the mutant tongues transcended the time when FP induction normally ceases (E14.5) and formed de novo taste placodes. This phenomenon was not observed in previous studies using rodent tongue organ cultures, since in those studies the assessment of the impact of loss of SHH signaling on taste placode formation was limited to the active phase of FP patterning [12–15]. Furthermore, our findings that in vivo SHH inhibits FP induction during the active period of FP patterning not only concur with prior work in vitro [12–15], but they also demonstrate that SHH signaling is required to prevent sustained taste placode induction and that SHH operates strictly within the LE to fulfill these functions, without inputs from the LM. Similarly, genetic studies have demonstrated that Wnt/β-catenin signaling within the LE is crucial for FP induction [1]. Loss of Wnt/β-catenin activity downregulates Shh in FPs and Ptch1 in FPs and their associated mesenchyme, whereas activation of Wnt/β-catenin signaling engenders expansion of Shh expression [14,43]. Moreover, findings from tongue organ cultures suggest that SHH inhibits Wnt/β-catenin activation, whereas Wnt/β-catenin signaling induces its own inhibitor, i.e. SHH [14]. However, how SHH impinges upon Wnt/β-catenin activity is unknown. Our findings of ectopic and anachronic induction of Wnt10b expression in mutants lacking SHH inputs suggest that SHH antagonizes Wnt/β-catenin signaling at least in part through inhibition of Wnt10b expression. Further supporting this notion is the finding that SHH inhibits Wnt10b expression in cultured teeth and whisker pads [44].

Loss of Shh signaling during tongue development enhances retinoic acid signaling

The ShhGFPCRE/Smo^f/f tongues not only underwent glandular metaplasia, but they also formed von Ebner’s glands displaying mucous metaplasia. We postulated that the dramatic tongue anomalies caused by disrupted SHH signaling were a result of enhanced retinoic acid (RA) signaling. Components of the RA pathway are expressed during tongue development [45–50], and it is well-established that excess RA or vitamin A (a RA precursor) induces glandular/mucous metaplasia of various epithelia [51–56]. Strikingly, rodent embryos overexposed to RA/vitamin A exhibit tongue anomalies phenocopying those occurring in the Shh^n/n [57] and the various mutants described in this work, including aglossia, microglossia, bifid tongue, and adhesion of the LE to epithelia of the oral mucosa [58–61].

To test our hypothesis, we first assessed the expression of RARb and RARg, well-established transcriptional targets of RA signaling that encode the nuclear retinoic acid receptors RARβ and RARγ, respectively [62]. We found that relative to controls, the LE of the ShhGFPCRE/Smo^f/f mutants (Figs 7A–7D’ and S3A–S3L) as well as that of the E10.5 (Figs 7E–7F’ and S3M–S3P) and E11.5 (Fig 7G–7H’) TAM-induced ShhCreER^T2/Shh^f mutants displayed stronger RARb and/or RARg hybridization signals. Furthermore, RT-qPCR revealed significant upregulation of RARb and RARg expression in the mutants (Fig 7I–7K).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Upregulation of RARb and RARg expression in ShhGFPCRE/Smo^f/f and ShhCreER^T2/Shh^f mutant tongues, indicating enhanced retinoic acid signaling.

(A-H’) RARg in situ hybridization with oligonucleotide probes (brown) in parasagittal tongue sections. The dotted lines highlight the junction between the lingual epithelium and lingual mesenchyme. (A-D’) Sections from E12.5 (A,B) and E13.5 (C,D) control (A,C) and ShhGFPCRE/Smo^f/f mutant (B,D) embryos. (A'-D') are enlarged images of the boxed areas in (A-D). (E-F’) Sections from E13.5 control (E) and ShhCreER^T2/Shh^f mutant (F) embryos first exposed to tamoxifen (TAM) at E10.5. (E’) and (F’) are enlarged images of the boxed areas in (E) and (F), respectively. (G-H’). Sections from E14 control (G) and ShhCreER^T2/Shh^f mutant (H) embryos first exposed to TAM at E11.5. (G’) and (H’) are enlarged images of the boxed (red) areas in (G) and (H), respectively. The inset in (H’) is an enlarged image of the boxed (green) area in (H). The RARg hybridization signals in the lingual epithelium (LE) of the controls, to a large extent, appear as punctae, whereas in the LE of the mutants they appear as globular aggregates, indicating higher levels of RARg expression in the mutants relative to the controls. Epithelial foci in the mutants with weaker RARg signals than the rest of the LE (arrow in H’). (I-K) RT-qPCR analysis for RARb and RARg relative to Actb (β-actin). (I) Upregulation of RARb (P = 0.0000) and RARg (P = 0.0000) levels in tongues from E13.5 ShhCreER^T2/Shh^f mutants (n = 6) as compared to tongues from controls (n = 6) first exposed to TAM at E11.5. (J) Upregulated RARb (P = 0.0000) and RARg (P = 0.0003) levels in tongues from E13.5 ShhCreER^T2/Shh^f mutants (n = 6) as compared to tongues from controls (n = 6) first exposed to TAM at E10.5. (K) Upregulation of RARb (P = 0.0015) and RARg (P = 0.0000) levels in tongues from E12.5 ShhGFPCRE/Smo^f/f mutants (n = 6) as compared to tongues from controls (n = 6). The data are mean values ± SD. CvP, circumvallate papilla; T, tongue. Scale bars: 500 μm (A-H) and 50 μm (A’-H’).

https://doi.org/10.1371/journal.pgen.1006914.g007

Consistent with these findings, anti-RARγ staining revealed that the ShhGFPCRE/Smo^f/f tongues exhibited stronger RARγ immunolabelling in the LE than that of controls from E11.5 to E14.5 (S4A–S4G Fig) except in epithelial foci, which could be developing squamous hyperplastic sites (S4G Fig). Noticeably, RARγ was readily detectable in TBs which expressed RARg transcripts (S4E and S4H–S4K Fig), and the lingual glands were also RARγ+ (S4L–S4N Fig). These data show that the LE and its derivatives produce RARγ protein and that RA signaling is enhanced in the LE upon loss of SHH inputs.

Enhanced RA signaling upon loss of SHH signaling during tongue development is due to loss of SHH-dependent Cyp26a1/c1 expression

Transcripts encoding the RA synthesizing enzymes RALDH1-3 have been shown to be expressed in the LE at E14.5 and E16.5 [49]. To assess the distribution patterns of RALDH1-3 during tongue development and to determine whether they are altered in the ShhGFPCRE/Smo^f/f tongues, we immunostained sections from controls and mutants from E11.5 onwards. We found that RALDH1-3 were expressed in the LE from E11.5 onwards as well as in the orthotopic and heterotopic lingual glands (S5 and S6 Figs). We also found that FPs were RALDH3+ (S5Q and S5R Fig), whereas TBs were RALDH1+ (S5S–S5T and S5Y–S5Z Fig). Thus, the LE and its derivatives in controls and mutants are exposed to RALDH-derived RA. However, besides abnormal enhancement of RALDH3 and RALDH2 staining in the LE of the mutants at E11.5 (S5F Fig) and E16.5 (S5V Fig), respectively, there were no major alterations in RALDH1-3 distribution patterns in the mutants.

RA signaling is tightly regulated by activities of RALDH1-3 and the RA catabolic enzymes belonging to the CYP26 family [63,64]. As the ShhGFPCRE/Smo^f/f mutant tongues had no major alterations in RALDH distribution, we reasoned that the increased RA signaling could be caused by decreased production of CYP26A1 and CYP26C1 which are expressed in the LE [65–67]. We found that Cyp26a1/c1 transcripts were dramatically reduced in developing tongues dissected from ShhGFPCRE/Smo^f/f mutants as well as from E10.5 and E11.5 TAM-induced ShhCreER^T2/Shh^f mutants compared to controls (Fig 8 and Fig 9). However, some Cyp26a1/c1-expressing epithelial foci persisted in the mutants (Fig 8 and Fig 9). These are likely developing focal squamous hyperplasiae as shown in tissue sections (arrows in Fig 8), which consistently develop in the ShhGFPCRE/Smo^f/f and TAM-induced ShhCreER^T2/Shh ^f mutants. Strikingly, we found that during the active phase of FP patterning, Cyp26a1/c1 were excluded from FPs (Fig 8 and Fig 9). When FP induction is complete at E14.5 Cyp26a1/c1 levels started to diminish (Fig 9I, 9K and 9M), and after E16.5, Cyp26a1/c1 were no longer expressed in the LE [65,66]. Furthermore, Cyp26a1/c1 expression was excluded from the LE at the level of the developing circumvallate papilla and from the pharyngeal tongue (Fig 8 and Fig 9). Cyp26b1, another CYP26 family member, is expressed exclusively in the LM [65]. We found that Cyp26b1 levels (Fig 9U) in the mutant tongues were either essentially unaltered (ShhGFPCRE/Smo^f/f and E10.5 TAM-induced ShhCreER^T2/Shh^f) or upregulated (E11.5 TAM-induced ShhCreER^T2/Shh^f), confirming enhanced RARb and RARg levels in the LE of the mutants. Unlike in both the ShhGFPCRE/Smo^f/f and in the E10.5 and E11.5 TAM-induced ShhCreER^T2/Shh^f mutant tongues, Cyp26a1/c1 levels were unaltered in E12.5 TAM-induced ShhCreER^T2/Shh^f mutant tongues (Fig 9O–9R). Thus, a critical temporal window of SHH activity is necessary for expression of Cyp26a1/c1 in the LE. These data, together with our findings indicating a temporal window during which loss of SHH signaling causes FP mispatterning, suggest that early loss (before E12.5) of SHH signals is necessary for downregulation of Cyp26a1/c1 expression in the LE during FP patterning (E12.5-E14) and for the entailing patterning defects.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. Dramatic downregulation of Cyp26a1 and Cyp26c1 expression in the lingual epithelium of ShhGFPCRE/Smo^f/f and ShhCreER^T2/Shh^f mutant tongues.

(A-N’) Parasagittal tongue (T) sections from controls and mutants after in situ hybridization with a ³⁵S-UTP-labelled riboprobe for Cyp26c1 (A-F’) and oligonucleotide probes for Cyp26a1 (G-N’; black). Genotypes are indicated in the panels. (A-D) Dark-field images showing Cyp26c1 expression (shiny dots) in E12.5 (A,B) and E14 (C,D) control and ShhGFPCRE/Smo^f/f mutant tongues. (A’-D’) Enlarged bright-field images (hybridization signals appear as black dots) of the boxed areas in (A-D). (E,F) Dark-field images showing Cyp26c1 expression in tongue sections from E14 control and ShhCreER^T2/Shh^f mutant embryos first exposed to tamoxifen (TAM) at E10.5. (E’) and (F’) are enlarged, bright-field images of the boxed areas in (E) and (F), respectively. All mutants show virtual abrogation of Cyp26c1 expression (B,D,F), except in epithelial foci (arrows in D,D’,F and F’). Absence of Cyp26c1 transcripts in fungiform placodes (A’,C’) and pharyngeal tongue (A,C,E) in controls. (G-J’) Cyp26a1 expression in tongue sections from E12.5 (G,H) and E13.5 (I,J) control and ShhGFPCRE/Smo^f/f mutant embryos. (G’-J’) Enlarged images of the boxed areas in (G-J). (K-L’) Cyp26a1 expression in tongue sections from E13.5 control and ShhCreER^T2/Shh^f mutant embryos first exposed to TAM at E10.5. (K’) and (L’) are enlarged images of the boxed areas in (K) and (L), respectively. (M-N’) Cyp26a1 expression in tongue sections from E14 control and ShhCreER^T2/Shh^f mutant embryos first exposed to TAM at E11.5. (M’) and (N’) are enlarged images of the boxed areas in (M) and (N), respectively. All mutants show virtual absence of Cyp26a1 expression, except in epithelial foci (arrows in H’,J,J’,L’ and N’). Cyp26a1 transcripts are excluded from fungiform placodes (G’,I’,K’ and M’) and pharyngeal tongue (G,I,K,M) in the controls. FP, fungiform placode; PT, pharyngeal tongue. Scale bars: 500 μm (A-F,I-N), 200 μm (G,H), and 50 μm (A’-N’).

https://doi.org/10.1371/journal.pgen.1006914.g008

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 9. SHH signaling is required for maintenance/reinforcement but not for induction of Cyp26a1 and Cyp26c1 expression.

(A-R) In situ hybridization for Cyp26c1 and Cyp26a1 in the developing tongue (dark blue/brown). (A,B) E11.5 control (A) and ShhGFPCRE/Smo^f/f mutant (B) tongues showing Cyp26c1 expression in the control tongue (arrow in A) and absence of Cyp26c1 expression in the mutant tongue (arrow in B). (C,D) Cyp26c1 expression in E12.5-E13 control (C) and ShhGFPCRE/Smo^f/f mutant (D) tongues. (E,F) Cyp26c1 expression in tongues from E14-E14.5 control (E) and ShhCreER^T2/Shh^f mutant (F) embryos first exposed to tamoxifen (TAM) at E10.5. The inset in (E) is an enlarged image of the specimen in (E). (G,H) Cyp26a1 expression in E14 control (G) and ShhGFPCRE/Smo^f/f mutant (H) tongues. (I,J) Cyp26a1 expression in tongues from E14.5 control (I) and ShhCreER^T2/Shh^f mutant (J) embryos first exposed to TAM at E10.5. (K-N) Cyp26a1 (K,L) and Cyp26c1 (M,N) expression in tongues from E15 control (K,M) and ShhCreER^T2/Shh^f mutant (L,N) embryos first exposed to TAM at E11.5. Severe downregulation of Cyp26a1/Cyp26c1 expression in all mutants, except in epithelial foci (ef). Fungiform placodes or taste buds, which appear as unstained spots (C,G, inset in E), and the circumvallate papilla (CvP) are Cyp26a1/Cyp26c1-negative. Artefact due to loss of the thin epithelium of the intermolar eminence during tissue processing (arrowheads in G, I and K). (O-R) Unaltered Cyp26c1 (O,P) and Cyp26a1 (Q,R) expression in tongues from E14.5 control (O,Q) and ShhCreER^T2/Shh^f mutant (P,R) embryos first exposed to TAM at E12.5. (S,T) Cyp26a1 expression in tongue explants from E12 control embryos after in vitro culture for 2 days with DMSO (S) and 200 nM SAG (T). SAG enhanced Cyp26a1 hybridization signals in the anterior tongue (blue) but failed to induce ectopic Cyp26a1 expression in the posterior tongue and mandibular structures. (U) RT-qPCR analysis for Cyp26b1 relative to Actb (β-actin) in tongues from E12.5 controls (n = 6) and ShhGFPCRE/Smo^f/f mutants (n = 6), in tongues from E13.5 controls (n = 6) and ShhCreER^T2/Shh^f mutants (n = 6) first exposed to TAM at E10.5, and in tongues from E13.5 controls (n = 8) and ShhCreER^T2/Shh^f mutants (n = 8) first exposed to TAM at E11.5. Cyp26b1 levels are upregulated in mutants relative to controls first exposed to TAM at E11.5 (P = 0.0000). The data are mean values ± SD. Scale bars: 500 μm (A-N,Q,R) and 300 μm (O,P,S,T).

https://doi.org/10.1371/journal.pgen.1006914.g009

While our data indicate that Cyp26a1/c1 expression in the LE requires SHH inputs, it is unlikely that the transcripts are direct targets of SHH signaling. At E11.5, despite the presence of significant SHH activity in the tongue primordium [6,8], only weak Cyp26a1/c1 signals were detectable (Fig 9A) [67]. Furthermore, treatment of tongue/mandible explants with SAG, a SMO agonist, enhanced Cyp26a1 signals in the LE but failed to induce ectopic Cyp26a1 expression in epithelia of the pharyngeal tongue and mandible (Fig 9S and 9T). These observations suggest that SHH signaling is required for maintenance and/or reinforcement of Cyp26a1/c1 expression in the LE but not for their initial induction.

The virtual absence of Cyp26a1/c1 transcripts in taste placodes and TBs amid high expression levels in the interplacodal LE is a conundrum in view of the data indicating the requirement of SHH signaling for Cyp26a1/c1 expression. However, taste placodes and TBs, similar to other SHH-producing signaling centers including the notochord, neural floor plate and tooth enamel knots [18,68,69], did not exhibit higher levels of Ptch1 and Gli1 than the nearby Shh-negative-SHH-responsive tissues. Furthermore, Gli1-lacZ mice revealed that Shh-expressing cells in taste placodes and papillae are less SHH-responsive than the neighbouring epithelial and mesenchymal cells [70]. Moreover, taste placodes, the notochord, and tooth enamel knots are induced after loss of Shh or Smo [our present data; 9,18,40,71]. In light of these observations, we propose that SHH signaling is attenuated in taste placodes and TBs and that this, combined with inputs from yet to be identified factor(s), leads to absence of Cyp26a1/c1 in these structures.

RA signaling is required for orthotopic lingual gland formation, and enhanced RA activity causes glandular but not Merkel cell metaplasiae in the SMO-deficient LE

That RA signaling is activated upon loss of SHH signaling strongly suggests that the glandular metaplasia, i.e. cell fate switch prompting the LE in the ShhGFPCRE/Smo^f/f oral tongue to form heterotopic glands, is a direct consequence of hyperactivation of RA signaling. Indeed, it is well-established that excess RA and Vitamin A induces glandular/mucous metaplasia of various epithelia [51–56]. To functionally test this scenario, we cultured E11.5 tongues and the surrounding mandibular structures in the presence of retinoids and inhibitors of RA signaling. We found that treating explants from control embryos with retinoids, including all-trans RA, CD1530 (RARγ selective agonist) and CD2314 (RARβ selective agonist) induced formation of K8+ heterotopic glands in the oral tongue, mimicking the ShhGFPCRE/Smo^f/f in vivo phenotype (S7A–S7E Fig; S3 Table). ShhGFPCRE/Smo^f/f tongue explants treated with vehicle (DMSO) recapitulated the in vivo defects, including glandular and Merkel cell metaplasiae as well as formation of K8(–) epithelial foci (S7F and S7I Fig; S3 Table). Importantly, exposure to BMS493 (pan-RAR antagonist) and DEAB (RA synthesis inhibitor) inhibited heterotopic gland formation in the ShhGFPCRE/Smo^f/f explants (S7F–S7K Fig; S3 Table). Neither BMS493 nor DEAB inhibited lingual Merkel cell metaplasia in the mutant explants (S7H and S7J Fig). Thus, lingual Merkel cell metaplasia is not caused by enhanced RA signaling. Furthermore, BMS493 and DEAB failed to inhibit development of the K8(–) foci in the mutants (S7H and S7J Fig), consistent with our findings suggesting that these are subjected to low RA signaling owing to persistent Cyp26a1/c1 expression. To determine whether RA signaling is required for development of von Ebner’s glands and posterior lingual glands, which normally develop in Cyp26a1/c1-free domains, we treated E12.5 control tongues/mandibles with DMSO or BMS493 (S3 Table). While the DMSO-treated explants formed K8+ von Ebners’ glands and K8+ posterior lingual glands, the BMS493-treated explants failed to develop von Ebners’ glands and displayed developmentally arrested posterior lingual glands (S7L–S7M’ Fig; S3 Table). These data demonstrate that abnormal RA activation in the ShhGFPCRE/Smo^f/f tongues causes glandular metaplasia and that development of von Ebners’ glands and posterior lingual glands requires RA inputs. They also show that the LE responds to RA. Despite this evidence and well-established expression of components of the RA pathway during tongue development, various transgenic mice reporting RA activity failed to show transgene activity in the LE and its derivatives [72–75]. Likewise, we were unable to detect RA activity in the LE except in subsets of desquamating cells of controls and ShhGFPCRE/Smo^f/f mutants carrying the RARE-hsp68-LacZ transgene, another reporter of RA activity [76] (S8A–S8F Fig). Moreover, retinoid-treated tongue explants from RARE-hsp68-LacZ embryos failed to undergo epithelial RARE-hsp68-LacZ activation, whereas tails from these embryos displayed transgene activity (S8G–S8I Fig). These observations and findings suggest that all the above transgenes are inactive in the LE and its derivatives. Accordingly, several studies pointed to lack of accuracy of such transgenic mice for visualization of RA activity in various tissues [77–79].

RA signaling promotes fungiform placode formation

We found that loss of SHH signaling elicits enhanced development of FPs amidst increased RA activity. This strongly suggests that RA signaling promotes FP formation. To test for direct evidence of the phenomenon, we treated tongue explants from control embryos with retinoids and found that they induced development of oversized Shh+ placodes (Fig 10C–10M; S4 Table). Furthermore, explants exposed to CD2314 and CD1530 exhibited ectopic Shh expression along the tongue midline and enhanced Shh signals, including in enlarged spots within two domains flanking the prospective intermolar eminence (Fig 10J, 10L and 10M). By contrast, explants from controls (Fig 10A and 10B; S4 Table) and ShhGFPCRE/Smo^f/f mutants (Fig 10N–10Q; S4 Table) exposed to BMS493 or DEAB exhibited large areas with weak or no Shh signals. Taken together with our findings of occurrence of RA signaling in taste placodes (expression of RALDHs amid absence of Cyp26a1/c1), these data show that RA promotes taste placode formation.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 10. Retinoids induce formation of oversized fungiform placodes, whereas inhibitors of RA signaling impinge upon their development.

(A-Q) Shh in situ hybridization (dark blue) in E12 tongue explants from control (without the CRE and/or the Smo floxed alleles; A-M) and ShhGFPCRE/Smo^f/f mutant (N-Q) embryos after in vitro culture for 48h. The explants were treated with DMSO (control for each treatment/concentration), BMS493, DEAB and retinoids [all trans-retinoic acid (RA), CD2314 and CD1530]. (A,B) DMSO (A) and 12.5 μM BMS493 (B). The BMS493-treated tongue exhibit large areas devoid of Shh expression. (C,D) DMSO (C) and 3 μM RA (D). (E-G) DMSO (E), 0.5 μM CD2314 (F), and 0.5 μM CD1530 (G). (H-J) DMSO (H), 1 μM CD2314 (I), and 1 μM CD1530 (J). (K-M) DMSO (K), 1.5 μM CD2314 (L), and 1.5 μM CD1530 (M). The retinoids promoted the formation of relatively oversized Shh+ spots, likely fungiform placodes. Relative to DMSO (arrows in H and K), CD2314 at 1.5 μM as well as CD1530 at 1 μM and 1.5 μM, promoted development of oversized Shh+ spots in the areas flanking the presumptive intermolar eminence (arrows in J, L and M). (N-Q) Tongue explants from mutant embryos treated with DMSO (N,P), 12 μM BMS493 (O), and 25 μM DEAB (Q) showing large areas virtually devoid of Shh expression after BMS493 and DEAB treatment. CvP, circumvallate papilla; IME, presumptive intermolar eminence. Scale bars: 200 μm (A-Q).

https://doi.org/10.1371/journal.pgen.1006914.g010

Conclusions

In this study, we adopted in vivo genetic approaches and experimental manipulation in tongue organ cultures in vitro which enabled us to reveal a temporal requirement for SHH signaling for proper tongue development. Before E12.5, SHH signaling in the LE controls patterning and cell fate specification, whereas in the LM, SHH inputs are required to drive growth and morphogenesis (S9 Fig). We uncovered unanticipated relationships between SHH and RA signaling during patterning of the LE (S9 Fig). We discovered that genetic loss of SHH activity in the LE leads to enhanced RA signaling and that in the absence of SHH inputs, the LE overproduces oversized FPs and TBs and can even undergo de novo taste placode formation. We showed that Cyp26a1/c1 expression in the interplacodal epithelium requires SHH inputs and that retinoids or RA signaling inhibitors induce or inhibit FP formation, respectively. These findings provide compelling evidence that SHH inhibits FP induction by abating RA activity in the interplacodal epithelium.

It is well-established that RA signaling plays a central role in controlling antero-posterior patterning of the limb, hindbrain, gut, and trunk [80–83]. Our genetic studies showed that loss of SHH signaling in the LE not only leads to formation of heterotopic glands in the oral tongue, but also causes overgrowth and mucous metaplasia of von Ebner’s glands. Furthermore, in tongue explants retinoids and RA inhibitors induced and inhibited lingual gland formation, respectively. These findings strongly suggest that antero-posterior patterning of the LE is controlled by antagonistic SHH and RA activities, where SHH inhibits and RA promotes lingual gland formation in the oral and pharyngeal tongues (S9 Fig). To our knowledge, neither de novo taste placode induction nor cell fate switch causing glandular and Merkel cell metaplasiae in the oral tongue, as in the ShhGFPCRE/Smo^f/f mutants, have been reported in mouse models or in experimental studies in vitro, suggesting that SHH and RA pathways play key roles in cell fate specification within the LE (S9 Fig). Our findings may provide insight into the etiopathogenesis of Merkel cell carcinoma of the tongue which remains an enigma [84].

We found that genetic loss of SHH signaling in the LE causes ectopic expression of Shh amidst abnormal activation of RA signaling and that retinoids induce expansion of Shh expression in tongue organ cultures. As normal levels of Shh expression in FPs require Wnt/β-catenin inputs [14,43], these observations raise the question as to the relationships between RA and Wnt/β-catenin signaling during FP patterning. The Hedgehog and RA pathways are crucial for development and homeostasis of a vast array of tissues and organs, and deregulated Hedgehog signaling generates neoplasia [10,11,81–83]. Our findings thus constitute a basis for future research aimed at deciphering the interactions between these pathways during development and disease, a largely unexplored topic.

Ethics statement

The experiments using mice were reviewed and approved by the Animal Research Ethics Committee in Göteborg, Sweden (Dnr. 230–2010, 174–2013 and 40–2016). Mouse studies were also carried out under approved protocols in strict accordance with the policies and procedures established by the University of California, San Francisco (UCSF) Institutional Animal Care and Use Committees (UCSF protocol AN084146). Mice were euthanised by cervical dislocation.

Mouse lines and tamoxifen induction of alleles

The different transgenic or knockin mice used in this work include the K14-CRE [40], ShhGFPCRE and ShhCreER^T2 [85], Wnt1-CRE [6], and R26R [86] mice. We crossed K14-CRE, ShhGFPCRE or Wnt1-CRE males with females carrying the Shh or Smo floxed alleles (Shh^f/fand Smo^f/f) as described previously [17,18,40,87,88]. Thereafter K14-CRE/Smo^+/f, ShhGFPCRE/Smo^+/f, ShhCreER^T2, ShhCreER^T2/Smo^+/f, or Wnt1-CRE/Smo^+/f males were crossed with Shh^f/f or Smo^f/f females to generate mutants. K14-CRE, or ShhGFPCRE males were crossed with R26R females to generate reporter embryos carrying the CRE and R26R alleles (K14-CRE/R26R and ShhGFPCRE/R26R). The RARE-hsp68-LacZ transgenic mice were as described [76]. We generated ShhGFPCRE/Smo^+/f/RARE-hsp68-LacZ males which were thereafter crossed with Smo^f/f females to generate ShhGFPCRE/Smo^f/f/RARE-hsp68-LacZ mutants and controls (without the CRE and/or the Smo floxed alleles). ShhGFPCRE/Smo^+/f (or without CRE) without the RARE-hsp68-LacZ transgene were used as negative controls. For tamoxifen (TAM) induction of the ShhCreER^T2/Shh^f and ShhCreER^T2/Smo^f/f mutants, pregnant females received intraperitoneal injections of TAM (dissolved in corn oil) every other day (excluding the day of embryo harvest) with the first injection consisting of 0.2 mg/g body weight (bw) TAM and the subsequent injections consisting of 0.1 mg/g bw. All mutants and their control littermates were identified by genotyping using DNA from the tip of the tail or a piece of embryonic tissue and/or, when possible, by their external phenotypes.

Histology, immunostaining, in situ hybridization, Lac-Z staining and GFP imaging

The number of tongues from control and mutant embryos processed for in vivo studies is described in S1 Text. Heads or mandibles/tongues from the various mutants and their control littermates were prepared for sectioning or used as whole-mounts. For histological staining (alcian blue van Gieson), immunohistochemistry, and immunofluorescence, specimens were fixed in ethanol-acetic acid as previously described [89,90] or in 4% paraformaldehyde in 1X PBS (PFA/PBS). For in situ hybridization, specimens were fixed in 4% PFA/PBS at 4°C. The specimens were thereafter processed for whole-mount in situ hybridization or embedded in paraffin. Six-μm paraffin sections were used for immunostaining and in situ hybridization. For histology, immunostaining, and in situ hybridization the specimens were processed as previously described [18,19,89–91]. Sections were counterstained with Richardson’s azure II-methylene blue and methyl green after in situ hybridization and immunostaining, respectively. For green fluorescent protein imaging, tongues from ShhGFPCRE/+ (controls) and ShhGFPCRE/Smo^f/f mutants were fixed overnight in 1% PFA/PBS at 4°C, rinsed in PBS, and imaged as whole-mounts. For visualization of LacZ activity, specimens were fixed overnight in 2% PFA/PBS at 4°C. Whole-mounts and cryostat tissue sections were subsequently processed for β-galactosidase histochemistry as previously described [19,90].

Antibodies and probes

The following antibodies were obtained and used for immunostaining: the Troma-1 (anti-Keratin 8) rat monoclonal antibody (1:3000) developed by P. Brulet and R. Kemler from the DSHB developed under the auspices of the NICHD and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA, USA; goat anti-ALDH1A2 (RALDH2, 1:400) and goat anti-SOX2 (1:3500) from Santa Cruz Biotechnology; rabbit anti-Keratin 6 (1:10,000) and chicken anti-Keratin 15 (1:10,000) from Covance; rabbit anti-Homer 1 (1:3000) and rabbit anti-Rab3c (1:1000) from Proteintech Group; rabbit Mab anti-ALDH1A1 (RALDH1, 1:400) and chicken anti-200 kD Neurofilament heavy (NF200; 1:4000) from Abcam; rabbit anti-ALDH1A3 (RALDH3, 1:400) from Sigma Life Science; rabbit anti-RARγ (1:3000) from LifeSpan Biosciences; goat anti-SHH (1:200) from R&D Systems; rabbit anti-P2X2 (1:200) from US Biological; and rabbit anti-SHH (Ab80; 1:800) [89,92]. Ab80 recognizes both SHH and Indian hedgehog (IHH) proteins [89,92], hence staining of craniofacial cartilage which produces IHH was used as internal control in sections from mutants lacking Shh gene function.

The following riboprobes were generated from linearized plasmids and used for in situ hybridization on tissue sections (³⁵S-UTP-labelled riboprobes) and/or whole-mount in situ hybridization (Dig-labelled riboprobes): Shh targeting exon1 and exon2 [39; AP. McMahon, personal communication]; Ptch1, Gli1, and Shh/exon2 [40]; Cyp26a1 [93]; RARg and RARb [45]; and Cyp26c1 [66]. Tissue sections were processed for in situ hybridization with oligonucleotide probes targeting Mm-Gli1 (NM_010296.2; target sequences: 25–1205); Mm-Cyp26a1 (NM_007811.2; target sequences: 303–1556), Mm-Ptch1 (NM_008957.2; target sequences: 2260–3220), Mm-RARg (NM_007811.2; target sequences: 944–2623) and Mm-Wnt10b (NM_011718.2; target: 989–2133) using the RNAscope technology (Advanced Cell Diagnostics).

Quantification of taste buds and ectopic Merkel cells

In vitro explant cultures

Mandibular arches with the developing tongue were dissected from control embryos (without the CRE and/or the Smo floxed alleles) and ShhGFPCRE/Smo^f/f embryos. E11.5 and E12.5 explants were cultured for 6 and 9 days, respectively, in the presence of vehicle control (DMSO), retinoids [all-trans retinoic acid (RA) and the retinoic acid receptor γ (RARγ) and RARβ selective agonists, CD1530 and CD2341, respectively], the pan-RAR antagonist BMS493, or the retinoic acid synthesis inhibitor 4-diethylaminobenzaldehyde (DEAB) (S3 Table). The specimens were thereafter processed for paraffin embedding and immunostaining for K8 as described above. All sections of explants from the ShhGFPCRE/Smo^f/f mutants treated with DEAB or BMS493 were processed for K8 immunostaining. The E11.5 specimens cultured for 6 days were exposed to DMSO, BMS493 (10 μM or 12.5 μM), DEAB (20 μM during the first 3 days of culture and 10 μM during the last 3 days of culture), CD1530 (1 μM), CD2314 (1 μM) or RA (3 μM). The E12.5 explants cultured for 9 days were treated with DMSO or 10 μM BMS493.

Tongue and tail explants from E11.5 RARE-hsp68-LacZ embryos were cultured together in the same dishes for 6 or 2 days, respectively, in the presence of RA (3 μM; n = 2), CD1530 (1 μM, n = 1) and CD2314 (1 μM, n = 1). They were thereafter processed for LacZ staining following cryostat sectioning.

E12 explants were cultured for 2 days in the presence of retinoids, BMS493, or DEAB (S4 Table), and processed for Shh in situ hybridization. These were treated with DMSO, DEAB (25 μM), RA (3 μM), BMS493 (12.5 μM), CD1530 (0.5 μM, 1 μM or 1.5 μM) and CD2314 (0.5 μM, 1 μM or 1.5 μM). E12 explants from control embryos were cultured for 2 days in the presence of vehicle (DMSO; n = 4) or 0.2 μM SAG (n = 7), a Smoothened agonist [94], and processed for Shh in situ hybridization. The media containing freshly added compounds were changed daily.

RA, SAG, BMS493, and DEAB were from Sigma-Aldrich, St. Louis, MO, USA. CD1530 and CD2314 were from Tocris Bioscience, Abingdon, UK. All explants were cultured for the indicated periods at 37°C in an atmosphere of 5% CO₂ in air. The culture medium consisted of DMEM/F-12 mix containing 2% fetal bovine serum, 2% vitamin A-free B27 supplement, 0.5% ITS, 0.5% glutamax, and penicillin/streptomycin (50 IU/ml and 50 μg/ml) from Life Technologies.

RT-quantitative PCR

Tongues from ShhCreER^T2/Shh^f mutants (first exposed to TAM at E10.5 or E11.5) and ShhGFPCRE/Smo^f/f mutants as well as their respective controls were dissected up to the level and including the circumvallate papilla. RNA was extracted using the RNAeasy Mini Kit (Qiagen), and cDNA was synthesized by reverse transcriptase (Qiagen). Quantitative PCR was performed using the iTAq Universal SYBR Green Supermix (Biorad) with the following primer sets: mRARg Forward 5'-GCAAGTACACCACGAACTCC, mRARg Reverse 3' AGGATGTCCAGACAAGCAGC; mRARb Forward 5'-GGAGAACTTGGGATCGGTGC mRARb Reverse 3'-TCTCGATGGCATTTTCCAGGC); mCyp26b1 Forward 5’- CCGTGAGAAGCTGCAGTGTA, mCyp26b1 Reverse 3’- GGGTTCCATCCTTCAGCTCC [95]; mPtch1 Forward 5’- CTAGCAATAGGGACCGCTCA mPtch1 Reverse 3’- GTCTCAGGGTAGCTCTCATAGC [96], and mActb Forward 5'-AGAGGGAAATCGTGCGTGAC, mActb Reverse 3'-CAATAGTGATGACCTGGCCGT). Student’s t-test was used for statistical analyses.