An overlapping upstream open reading frame inhibits the expression of a glass reporter

In the developing eye, expression of glass is initiated at the morphogenetic furrow in the eye-imaginal disc of third instar larvae and is detectable in the nuclei of all cells posterior to the morphogenetic furrow [7]. The same expression pattern is obtained with a reporter construct containing a 5.2 kb DNA fragment upstream of glass [8], spanning from -4190 bp to the AUG at +960 (Fig 1A) [8]. Surprisingly, using this 5.2 kb upstream genomic sequence to drive a GFP reporter we observed that GFP expression was barely detectable in the eye imaginal discs (Fig 1B and 1B”). By increasing the gain at the confocal microscope, we were able to detect a weak GFP signal posterior to the morphogenetic furrow, barely above background level (Fig 1B”’ and 1B””). A closer inspection of our reporter construct revealed the presence of two potential start codons in the 5’UTR of glass, that were also present in the GFP reporter construct, one at position +889 relative to the predicted transcription start, the other at position +955. Translation from the first start codon, if functional, may compete with the GFP start codon thus generating a protein that overlaps, but is not in frame, with the GFP coding sequence, resulting in the production of a 316 amino acid long protein (Fig 1B’).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. glass reporter constructs.

A: genomic region of glass including the 5.2 kb regulatory region (yellow), the three glass isoforms (RA, RB, RC) with their intron-exon structures, stop codons (asterisks), the protein coding regions (purple), and the positions of the five zinc fingers (magenta). The position of the upstream overlapping open reading frame (smORF) is indicated in blue. A non-coding RNA (orange) is located upstream of the glass gene. The 5.2 kb upstream genomic region including the non-coding exon 1 and the 5’end of exon 2 were cloned in front of eGFP (green). B: eye imaginal disc of a fly transgenic for the glass-GFP reporter construct (-4301 to +959). The GFP expression level is very low. B’: sequence fragment of the glass-GFP reporter construct including the 5’end of exon 2, the linker, and the first two codons of GFP (MV). The positions of the two upstream start codons and the GFP start codon are indicated by arrows. Translation from the upstream start codon results in the production of a protein encoded by the 3^rd reading frame of eGFP (first 44 amino acids shown in blue box). B”: GFP channel alone of the disc shown in panel B. No GFP is detectable (gain: 621.7). B”‘: close up of the region indicated by the white box in B. B”“: GFP channel alone of the region outlined in panel B imaged with a higher gain (827.1). GFP levels are slightly higher in the posterior region of the disc. C: eye disc of a transgenic fly expressing a glass-GFP reporter construct in which the two upstream start codons were deleted. GFP is expressed at high level in the posterior region of the disc that will give rise to the adult eye. C’: Sequence fragment of the GFP reporter construct indicating the part that was excised to remove the upstream start codons (-4301 to +886). Translation can only start at the GFP start codon. C”: GFP channel alone of the disc shown in panel C (gain: 621.7). C”‘: close up of the region indicated by the white box in C. C”“: GFP channel alone of the region outlined in panel C (gain 621.7). eGFP is mainly cytoplasmic. D: eye disc of a transgenic fly expressing a glass-GFP reporter construct in which the GFP start codon was deleted and the GFP coding sequence is in frame with the upstream start codon(s). D’ Sequence fragment of the GFP reporter construct indicating the part that was excised to remove the GFP start codon (-4301 to +959 in frame). The N-terminus of the resulting fusion protein between the upstream translation product and GFP is shown below). D”: GFP channel alone of the disc shown in panel D (gain: 757.2). D”‘: close up of the region indicated by the white box in D. D”“: GFP channel alone of the region outlined in panel D (gain 757.2). GFP shows nuclear localization. All discs are oriented with the posterior to the right. Discs were stained with antibodies against GFP (green), Elav (red), FasIII (blue in panels B”‘, C”‘ and D”‘) and with DAPI (blue in panels B, C and D). Scale bars in panels B, B”, C, C”, D and D” represent 50 μm, in panels B”‘, B”“, C”‘, C”“, D”‘ and D”“they represent 20 μm.

https://doi.org/10.1371/journal.pgen.1008269.g001

To test whether translation of GFP in our reporter construct was affected by the presence of the upstream start codon(s), we generated two additional reporter constructs: one, in which the potential upstream start codons were deleted (Fig 1C’), and another, in which the GFP start codon was deleted and the GFP coding sequence was brought into frame with the upstream start codons (Fig 1D’). Both GFP reporter variants resulted in strong GFP expression posterior of the morphogenetic furrow (Fig 1C, 1C”, 1D and 1D”). Thus, the reduced GFP expression observed in the original reporter construct was caused by the translation of the reporter construct in a different reading frame due to the presence of additional start codons upstream of the GFP coding sequence. Since the GFP reporter we used does not contain a nuclear localization signal, GFP produced from its own start codon, as in construct C’, is mainly localized in the cytoplasm (Fig 1C”’ and 1C””). However, when GFP was fused in frame with the smORF, it showed strong nuclear localization (Fig 1D”’ and 1D””), suggesting that the first 24 amino acids added to the GFP coding sequence contain a nuclear localization signal. Indeed, amino acids 2 to 20 of this fusion protein are predicted to affect nuclear localization [9]. Thus, the translation of this fusion protein starts at the first AUG codon at position +889.

Defined enhancer elements confine cell type specificity and temporal restricted expression

In order to understand the cis-regulatory logic of glass expression we further dissected this genomic region in the construct that does not contain the two upstream start codons (Fig 1C’). Using a number of restriction sites located in the upstream regulatory sequence, we generated truncations of our GFP reporter, similar to those used by Liu et al. [8], and also tested some deletions within this upstream sequence (Fig 2A). After deleting half of the 5.2 kb fragment (construct B: -1885 to +886), GFP expression is still restricted to the region posterior of the morphogenetic furrow (Fig 2B). Further deletion of a small fragment between the BamHI and EcoRI sites (construct C: -1598 to +886) shows patchy GFP expression in the developing photoreceptor precursors (Fig 2C). While construct B is expressed in all cell types forming the presumptive eye, the expression of construct C is restricted to presumptive photoreceptor cells with variable expression levels (S1A Fig), suggesting that the fragment from -1885 to -1598 might contain some non-photoreceptor specific enhancer. A fragment truncated at the XbaI site (construct D: -703 to +886) is expressed in all the photoreceptor precursors posterior of the morphogenetic furrow with the highest levels directly after the furrow and reduced levels towards the posterior end (Fig 2D). This construct also shows ectopic expression in a stripe anterior of the furrow (Fig 2D’ arrowhead). This misexpression of GFP is spreading over the entire eye-antenna-disc in a construct starting at the XhoI site (construct E: -239 to +886, Fig 2E), suggesting that this fragment contains a minimal promoter whose activation is independent of eye specific enhancers. We used this minimal promoter region in combination with other fragments of the enhancer to analyse the expression patterns conferred by the 5’ enhancer elements. We tested the 287 bp fragment between the BamHI and EcoRI sites that we suspected to drive expression specifically in non-photoreceptor cells based on the different expression patterns between constructs B and C. We found that this small fragment in combination with the minimal promoter (construct F: -1885 to -1598 / -239 to +886) can restrict GFP expression to the region posterior to the morphogenetic furrow (Fig 2F). With this enhancer fragment, the GFP signal is absent in the presumptive photoreceptor cells and restricted to the cells surrounding the photoreceptor precursors (Fig 2F”’, S1B Fig). A complementary construct lacking only this small region (construct G: -4301 to -1906 / -1598 to +886), shows a reciprocal expression pattern posterior of the furrow with expression restricted to presumptive photoreceptors (Fig 2G). The 1.2 kb region located at the 5’ end of the glass enhancer fragment in combination with the minimal promoter (construct H: -4301 to -3123 / -239 to +886), also restricts GFP expression to cells posterior of the morphogenetic furrow (Fig 2H). In this case GFP is only expressed in three of the eight presumptive photoreceptors (Fig 2H”’). We identified these as R2, R5, and R8 using defined markers [10] (S1C Fig). In addition, this part of the glass enhancer is required for expression in the ocelli anlage (Fig 2G and 2H arrows). Finally, the fragment between the two BamHI sites (construct I: -3123 to -1906 / -239 to +886) drives GFP expression in all presumptive photoreceptors (Fig 2I and 2I’, S1D Fig), similar to construct D, but with lower expression levels directly after the furrow and increasing GFP levels towards the posterior end.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Functional analysis of the glass enhancer region.

A: enhancer fragments used to drive GFP expression. The construct with the deleted upstream start codons (top) was fragmented using the restriction sites indicated above. The resulting reporter constructs are shown below. B-I: GFP expression patterns of constructs B to I. All discs are oriented with the posterior end to the right. Scale bars: 50μm. Arrow heads: GFP expression anterior of the morphogenetic furrow. Arrows: ocelli anlage. B”–I”‘: close ups of the regions marked by the rectangles in panel B to I. Scale bars: 20 μm. Discs were stained with antibodies against GFP (green), Elav (red), FasIII (blue in panels B’ to I’), and with DAPI (blue in panels B-I).

https://doi.org/10.1371/journal.pgen.1008269.g002

Taken together, the 5.2 kb glass regulatory region contains a general promoter region (-239 to +886), an ocelli enhancer region (-4301 to -3123), that also drives expression in a subset of photoreceptor precursors, a non-photoreceptor enhancer element (-1886 to -1598), two general photoreceptor enhancer elements (-3123 to -1906 and -1598 to -239), and a repressor region (-1598 to -703) (S2A Fig).

glass expression is directly regulated by Sine oculis, a member of the retina determination network [1]. The 5.2 kb enhancer region contains 31 potential Sine oculis binding sites (altogether 10 sites with a perfect AGATAC consensus sequence [11] and 22 sites with a more degenerate version YGATAY [12], S2A Fig). Expression of a reporter gene driven by the non-photoreceptor enhancer fragment (-1886 to -1598) is lost if the three Sine oculis binding sites present in this fragment are mutated [1]. Thus, Sine oculis might act as a general activator of glass expression by binding to all enhancer elements, while other transcription factors might be binding more specifically to an individual enhancer element conferring expression in only a subset of the cells. We performed an in silico analysis looking for additional transcription factor binding sites in the entire 5.2 kb region. We found potential binding sites for 263 different transcription factors including factors that are known to regulate eye development (p.e. Pph13, Optix, Otd, Hth, Ey, Dr, Kr, Ato) (S2B Fig, S1 Table). There are also several potential binding sites for Glass within the photoreceptor enhancer regions suggesting an auto-regulatory function. Our identification of the different enhancer regions will allow more specific testing of the role of these transcription factors in the cell-specific regulation of glass.

The overlapping upstream smORF is conserved and attenuates Glass misexpression

The upstream start codons in the 5’UTR of glass strongly reduced the expression of our original GFP reporter construct, presumably due to interference with GFP translation and production of a 316 amino acid long protein encoded in the 3^rd frame of the eGFP sequence used here. In the glass transcript, translation from the upstream start codon might also interfere with Glass translation producing a 34 amino acid long peptide encoded by the smORF that overlapps with the Glass coding sequence (Fig 3A(b)). Interestingly, the 4 nucleotide sequence preceding the upstream start codon (CAAG) is more similar to the Drosophila consensus Kozak sequence (MAAM, whereby M stands for either A or C) [13] than the sequence upstream of the actual Glass start codon (TGTC) (Fig 3A). Sequence comparison with glass genes from other Diptera revealed that upstream start codons are present in all glass 5’UTRs of Drosophilidae as well as in Lucilia, Musca, and Glossina, possibly producing peptides that overlap with the Glass coding sequence (S3A Fig). Although the length of these peptides differs slightly due to insertion and deletion of nucleotide triplets, the frameshift relative to Glass and the amino acid sequence are conserved within the Drosophilidae, suggesting that the encoded peptide itself might have a conserved function (S3B Fig). Interestingly, the N-terminal half of the peptide contains mainly basic residues that can provide a nuclear localization signal, as revealed in the GFP reporter construct that was cloned in frame with the upstream start codon (Fig 1D). The central part of the peptide sequence is more variable and truncated in D. grimshawi, D. virilis, and D. mojavensis, while it is extended in D. wilistoni, L. cuprina, M. domestica, and G. morsitans (S3B Fig). Not surprisingly, conservation is also high in the C-terminal part overlapping the Glass coding sequence. The N-termini of the Glass orthologs of other insects, including mosquitoes, are not conserved, and there are no upstream overlapping open reading frames in these transcripts.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. The upstream overlapping open reading frame is not required for eye development or function.

A: sequence of glass exon 2. The positions of the upstream start codon (+889) and the Glass start codon (+960) are indicated by arrows. CRISPR sites are underlined in red, and the actual positions of the cuts are indicated by a vertical red line. The amino acid sequence of the Glass N-terminus is written in the blue box under the coding sequence. The brs nucleotide and amino acid sequence is shown in the orange box (b). A single nucleotide deletion was introduced in the brs^-1nt allele (followed by an A to T mutation to generate a HindIII restriction site (c)). This will result in a frameshift completely changing the amino acid sequence of the Brs peptide (shown in the green box) with only a minimal change in the nucleotide sequence of exon 2. The resulting peptide still overlaps with the Glass open reading frame. Cas9 also produced small deletions at the CRISPR site (d-f) resulting in a loss of the upstream start codon. Translation could still start from a second AUG just upstream of the Glass AUG interfering with Glass translation. A 5 nucleotide deletion was introduced in the brs^-5nt::Glass allele between the second Brs AUG and the second codon of Glass, putting both sequences into the same frame as indicated by the orange and blue highlighted sequences (g) (a T to C mutation was introduced to generate an NcoI site, changing the valine at position 22 of this fusion protein into alanine). B-G: adult eye, expression of the retinal markers Rh1, NorpA, Trp, and Trpl and light preference of control w¹¹¹⁸ flies (B), brs^-1nt deletion flies (C), random deletion lines (D-F), and brs^-5nt::Glass deletion flies (G). All antibody stainings are shown in green, DNA was stained with Hoechst (purple). Scale bars represent 40 μm. Flies of all tested genotypes are attracted by light. Two-tailed one sample t test followed by the Benjamini Hochberg procedure: For all data sets n = 7 experiments. CTRL: p = 3.6*10⁻⁸, t₍₆₎ = 31.09; brs^-1nt: p = 1 *10⁻⁵, t₍₆₎ = 13.88; brs-2nt: p = 3.6*10⁻⁸, t₍₆₎ = 47.23; brs-4nt: p = 8.9*10⁻⁶, t₍₆₎ = 14.81; brs-5nt: p = 2*10⁻⁶, t₍₆₎ = 19.97; brs^-5nt::Glass: p = 1.1*10⁻⁵, t₍₆₎ = 13.38. The light preference index of all experimental groups is not different from the light preference index of the control group. One-way ANOVA of preference indices: p = 0.495, F-Value_(5,36) = 0.895. Data show mean and error bars show standard deviation. Red dots indicate means of individual experiments. H-K: overexpression of UAS constructs with a strong ey-Gal4 driver. H: Overexpression of the Glass PA protein leads to severe eye and head defects resulting in pharate lethality. I: the only ey-Gal4>UAS-Glass-PA fly that eclosed had very small eyes. J: Overexpression of the Brs peptide did not affect eye or head development. K: When expressed together on the same UAS-construct, Brs translation interferes with Glass translation resulting in a higher number of escapers that have small or even normal eyes.

https://doi.org/10.1371/journal.pgen.1008269.g003

Since the 34 amino acid long peptide is encoded by the glass mRNA, it might have a function in eye development. We used the CRISPR/Cas9 technique to introduce small deletions in the peptide coding sequence that will result in a frameshift of the peptide without affecting the Glass coding sequence. We named the resulting smORF alleles “brainy smurf” (brs) after the smurf with the glasses. We introduced a double strand break 6 nucleotides downstream of the start codon of the peptide and provided a template for repair that contained a single nucleotide change as well as a single nucleotide deletion (brs^-1nt) (Fig 3A(c)). Glass transcript levels were not significantly altered in these brs^-1nt mutants in comparison to the original nos-Cas9 line (S4B Fig). In addition to the single nucleotide deletion provided by the template, we also found several lines that had small indels in the region of the CRISPR site used (Fig 3A(d-f)). Although after injection of the gRNA and crossing the G0 flies with a deficiency line that uncovers the glass locus we had selected F1 flies that showed a subtle rough eye phenotype, after establishing stable lines the eyes did not show any morphological defects (Fig 3B–3F). We therefore stained for the expression of different photoreceptor markers. We used w¹¹¹⁸ flies as controls, since our brs^- lines were in a w^- background due to crossing the G0 flies with w;; Df(3R)Exel6178 and the F1 flies with w;; Dr e/TM3. w¹¹¹⁸ control flies have big round compound eyes expressing the phototransduction proteins Rhodopsin1 (Rh1), No receptor potential A (NorpA), Transient receptor potential (Trp), and Transient receptor potential-like (Trpl) (Fig 3B). Adult flies are attracted to light in phototaxis experiments [6]. This is also the case for white eyed mutants (Fig 3B). brs^-1nt homozygous flies have normal eyes, expressing all tested markers and show light preference comparable to wildtype flies (Fig 3C). We observed the same phototaxis behaviour and marker gene expression in the randomly generated brs mutations (Fig 3D–3F).

The GFP reporter constructs demonstrated that the presence of the upstream start codon can interfere with translation from the actual start codon. To test if this is also the case for the translation of Glass, we introduced a 5 nucleotide deletion at the Glass start codon, putting it into frame with the upstream start codon (brs^-5nt::Glass) (Fig 3A(g)). Again, no changes in glass transcript levels were observed in this line in comparison to nos-Cas9 flies (S4B Fig). From these transcripts, Glass translation starts at the upstream start codon that has the “better” Kozak sequence and fuses the nuclear localization signal encoded by the N-terminus of Brs to the Glass protein. We considered that this could result in higher levels of Glass activity that might interfere with eye development. However, we did not observe any changes in eye morphology, marker gene expression, photoreceptor shape, or light preference (Fig 3G). Thus, the potential increase of Glass protein either does not interfere with its function or is compensated by other mechanisms.

To test our hypothesis that the upstream start codon might interfere with Glass translation, we used an over-expression assay. Driving UAS-glass-PA expression with a strong eyeless-Gal4 enhancer results in lethality of the pharate flies (Fig 3H, Table 1). The flies have severe head defects that prevent them from eclosing with only a small number of escapers (0.4%) (Fig 3I). Overexpression of a UAS-brs construct did not affect viability of the flies or their eye shape (Fig 3J, Table 1), indicating that the small peptide produced does not interfere with eye development. Co-expression of UAS-glass-PA and UAS-brs inserted on different chromosomes showed a similar level of lethality as UAS-glass-PA alone (0,3% survival rate), indicating that the peptide itself does not interfere with Glass function. However, in a construct that contains the peptide coding sequence upstream and overlapping with the Glass PA coding sequence as in the endogenous transcript, the lethality caused by the over-expression of Glass protein was reduced, resulting in a 20.3% survival rate, where the adult escapers had normal or smaller eyes (Fig 3K). Therefore, the presence of the Brs peptide itself does not reduce Glass levels. brs only interferes with Glass translation, when directly placed as an upstream overlapping open reading frame in the glass mRNA.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Brs interferes with Glass translation.

A strong ey-Gal4/CyO driver line was crossed with different UAS-constructs and the number of eclosed Cy⁺ and CyO flies was determined. The CyO siblings do not contain the ey-Gal4 driver and therefore were taken as reference for the amount of Cy⁺ flies expected in each experiment. The ratio of Cy⁺ over CyO flies determines the survival rate of flies expressing the UAS-construct.

https://doi.org/10.1371/journal.pgen.1008269.t001

The Glass PA protein isoform by itself is sufficient for photoreceptor differentiation and function

glass encodes a 604 amino acid protein containing a transcriptional activation domain and a DNA-binding domain that consists of five zinc-fingers of which the three C-terminal zinc-fingers were shown to be necessary and sufficient for DNA binding [7, 14]. However, according to FlyBase (flybase.org), the glass gene encodes three different protein isoforms (Fig 1A). The PA isoform contains a complete set of 5 zinc-fingers providing sequence specific DNA binding to the target genes of Glass [3, 15]. In addition to the Glass PA isoform, two other isoforms are predicted to exist based on expressed sequence tags and sequence conservation [16, 17]. Failure to splice out the last intron of the mRNA transcript, results in the production of a truncated 557 amino acid Glass PB isoform lacking the second half of the fifth zinc-finger. This version of Glass cannot bind specifically to its target sequence in vitro [14]. Of the 19 cDNA clones whose sequences are available on FlyBase (flybase.org), seven are covering the last and/or the second-last exon, and all seven still contain the last intron, suggesting that this intron is frequently retained in the transcript. The position of the last intron (intron 4 in Drosophila) including the stop codon immediately following the exon-intron junction is only present in the glass orthologs of Diptera and Lepidoptera (S5A Fig). In the postman butterfly (Heliconius melipone) the stop codon is not located immediately after the exon intron junction but 17 basepairs into the intron. Other arthropods do not have an intron at this position.

An extended 679 amino acid long Glass PC isoform, containing all 5 zinc-fingers followed by additional 75 amino acids, is produced by a readthrough of the Glass PA stop codon. The prediction of this longer isoform is based on sequence conservation 3’ of the regular stop codon [18] and was confirmed using the Coding Potential Assessment Tool (CPAT) that calculates the coding probability of a DNA sequence using Drosophila statistics [19]. A comparison of the sequence following the Glass stop codon within the higher Diptera shows conservation on the amino acid level suggesting that the extended protein is produced by a direct misinterpretation of the stop codon without shifting the reading frame (S5B and S5C Fig) [20, 21]. The amino acid sequences of the extended Glass proteins from different higher Diptera are highly conserved at their N- and C-termini, but have a central region that is rich in histidine residues of very variable length. Particularly, the Musca and Lucilia Glass PC versions contain a high number of additional amino acids in this central part. The PC sequence is not conserved in other insects including mosquitoes.

To test the requirement and function of the three different Glass isoforms in vivo, we introduced specific changes in the endogenous glass locus by CRISPR/Cas9- mediated genome editing, eliminating either one or two of the Glass isoforms (Fig 4A). We used w¹¹¹⁸ flies as controls, since our glass deletion lines were in a w^- background due to crossing the G0 flies with w;; Df(3R)Exel6178 and the F1 flies with w;; Dr e/TM3 (Fig 4B). Flies expressing only the Glass PA+PC isoforms due to a deletion of the last intron had normal, functional eyes expressing phototransduction proteins like control flies (Fig 4C). In contrast, a deletion that allowed only the production of the truncated PB isoform phenocopied glass amorphic mutations, in which photoreceptors failed to differentiate as revealed by the loss of phototransduction proteins (Fig 4D) [1]. We also prevented the production of the PC isoform by adding two additional stop codons at the end of the Glass PA sequence (PA+PB). This had no effect on eye shape or on photoreceptor marker gene expression (Fig 4E). By deleting the last intron and adding stop codons at the end of the Glass PA sequence we generated flies that can only express the PA isoform. These flies also have normal functional eyes expressing all tested markers (Fig 4F). In addition to marker gene expression, we also measured photoreceptor activity by recording electroretinograms (ERGs). We found that all isoform mutants that had normal eye shape and were expressing phototransduction proteins, showed normal ERG responses [22], while the flies expressing only the Glass PB isoform did not produce any ERG signal in response to light (Fig 4G). When we tested the light preference of our different Glass isoform mutants, we found that all variations expressing the Glass PA isoform showed light preference comparable to wildtype flies (Fig 4H). In contrast, the flies expressing only the Glass PB isoform were photoneutral, with a light preference index that is not significantly different from chance, but significantly different from that of control flies and similar to that of glass mutants, which fail to detect light [6].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Isoform specific glass alleles.

A: wildtype and mutated versions of glass from the end of exon 4 to the end of the transcript. Stop codons of isoforms PA, PB, and PC are indicated by asterisks. The C2H2-zinc-finger region is shown in purple and magenta. Intron 4 is shown in white. The C-terminus of the PA isoform is shown in blue, that of the PC isoform in yellow. The 3’UTR is grey. The positions of the CRISPR sites used for mutagenesis are shown as green boxes. Deletions are indicated as black lines. The triple stop codon introduced in the PA+PB and the PA alleles are indicated by red boxes and asterisks. B-F: adult eye and expression of the retinal markers Rh1, NorpA, Trp, and Trpl as indicated above in control w¹¹¹⁸ flies (B), in flies expressing the Glass PA+PC isoforms (C), in flies expressing the Glass PB isoform (D), in flies expressing the Glass PA+PB isoforms (E), in flies expressing the Glass PA isoform (F). All tested markers are expressed in the different alleles, except in the mutant only expressing the PB isoform, which has a glass mutant eye phenotype. All antibody stainings are shown in green, DNA was stained with Hoechst (magenta). Scale bars represent 40 μm G: ERGs of the different glass isoform alleles indicated at the left, scale bars represent 5 mV (vertical) and 5 seconds (horizontal). H: Light preference index of wildtype and flies that are mutant for specific Glass isoforms. Flies expressing only the PB isoform are photoneutral. Two-tailed one sample t test followed by the Benjamini Hochberg procedure: For all data sets n = 10 experiments. CTRL: p = 5.8*10⁻⁰⁹, t₍₉₎ = 23.82; PA+PC: p = 2.1*10⁻⁰⁹, t₍₉₎ = 30.20; PB: p = 0.46, t₍₉₎ = 0.97; PA+PB: p = 6.6*10⁻⁰⁷, t₍₉₎ = 13.43; PA: p = 3.8*10⁻⁰⁹, t₍₉₎ = 26.19. Only flies expressing just the Glass PB isoform show a light preference which is different from the one of control flies. One-way ANOVA of preference indices: For all data sets n = 10 experiments, p<2*10⁻¹⁶, F-Value_(8,81) = 44.04. CTRL vs PA+PC: p = 1, t = -0.15; CTRL vs PB: p<0.001, t = 8.11; CTRL vs PA+PB: p = 0.23, t = 2.03; CTRL vs PA: p = 1, t = -0.10. Data show mean and error bars show standard deviation. Red dots indicate means of individual experiments. *** = p<0.001.

https://doi.org/10.1371/journal.pgen.1008269.g004

Glass is also required for the development of other light sensing organs in Drosophila. In addition to their compound eyes, adult fruitflies have three ocelli on top of their heads expressing Rhodopsin 2 (S6A Fig) [23, 24], and four photoreceptor cells on each side of the head forming the eyelet, that is located underneath the retina and required for regulation of the circadian rhythm (S6B Fig) [24, 25]. During larval stages 12 photoreceptor cells on each side of the head form the larval eyes (Bolwig organs), with four photoreceptor cells expressing Rhodopsin 5 and the other eight expressing Rhodopsin 6 (S6C Fig) [26]. All these visual organs are present in the flies expressing the Glass PA+PC isoforms (S6D–S6F Fig). These photoreceptors are also fully developed in flies expressing the Glass PA+PB isoforms (S6G–S6I Fig) and in flies expressing only the Glass PA isoform (S6J–S6L Fig). In contrast, flies expressing only the truncated Glass PB isoform not only show a glass mutant phenotype in their compound eyes, but also don’t have ocelli. We were not able to identify fully differentiated photoreceptors of the Bolwig organ, the eyelet, or the ocelli based on their expression of Rhodopsins or Chaoptin. Therefore, we stained for Krüppel and Spalt, two transcription factors that are already expressed in the Bolwig organ precursors at embryonic stage 12 (S6M Fig), whose expression is maintained at larval stages in wildtype flies (S6N Fig). Krüppel is expressed in all twelve cells, while Spalt is only expressed in the four primary precursors that will later express Rhodopsin 5 (S6O Fig). In stage 12 embryos containing only the Glass PB isoform the Bolwig organ precursors are specified and two cells even express Spalt and Krüppel (S6P Fig). However, at larval stage neither these cell type specific transcription factors nor the rhodopsins are detectable suggesting that the cells lost their identity and probably never reached their final position (S6Q and S6R Fig).

To see if the expression of only one or two of the Glass isoforms would affect glass transcript levels, we performed qPCR on the different isoform mutant lines. We used nos-Cas9 flies for comparison since the genomic changes had been introduced in this line using CRISPR. We used a forward primer located in exon 4 in combination with a reverse primer located in exon 5 to quantify the amount of spliced transcript and the same forward primer in combination with a reverse primer located in intron 4 to quantify the amount of unspliced transcript. Since the gl^PB line has a deletion of the part of exon5 that is bound by the reverse primer, we only tested unspliced transcript levels in this line. Similarly, since intron 4 was deleted in the gl ^PA+PC and the gl^PA lines, we only tested spliced transcript levels in these lines. The glass transcript levels in the gl^PA+PC and in the gl^PA lines did not differ significantly from control flies (S4A and S4B Fig). We found a slight but significant increase of transcript levels in the gl^PA+PB line for the spliced as well as the unspliced version. This might be due to higher mRNA stability as result of the loss of translation of the PC isoform or due to higher transcription levels as response to the failure to produce the extended version of the protein. Finally, we found that in the gl^PB line the amount of unspliced transcript is significantly increased in comparison to the rather small amount found in wildtype flies and reaches a level in the same range as the spliced transcript found in wildtype flies, although due to the different reverse primers used, the expression levels cannot be directly compared. Thus, in the line that shows a glass mutant phenotype due to the loss of production of a functional protein, glass expression is not heavily upregulated.

A glass mutant phenotype was also observed in flies in which, after CRISPR-induced DNA double strand break, the DNA repair occurred in form of non-homologous end joining, either deleting the exon-intron junction and the stop codon located in the last intron, or introducing a frameshift at the beginning of the last exon (S7A Fig). Like flies expressing the truncated Glass PB isoform, these flies also have small eyes with a glassy surface. They do not express any of the tested photoreceptor makers, have no ERG response and do not show phototaxis behaviour (S7B–S7G Fig).

Thus, although conserved, the extended version of Glass is dispensable in photoreceptors. In contrast, the truncated PB version alone cannot fulfil Glass function, while its absence does not interfere with Glass function in the eye.

General and cell-specific enhancer elements regulate glass expression

The 5.2 kb region upstream of the glass start codon had previously been identified as the minimal sequence required for normal Glass expression [8]. The lacZ-reporter construct used in this paper also contained the upstream start codon located in intron 2. Due to the enzymatic activity of the β-galactosidase, sufficient signal was produced to detect reporter gene activity posterior of the morphogenetic furrow. However, further truncations of the upstream sequence only yielded transgenic lines with weak or variable expression or lines that did not show expression at all. Similarly, our original GFP-reporter construct showed only very weak expression levels even with the same 5.2 kb enhancer fragment. After removal of the upstream start codon, expression of our GFP-reporter construct was strongly enhanced allowing us to perform a classical enhancer bashing approach to further dissect the upstream region of glass. We were able to identify different enhancer regions that conferred reporter gene expression in cells posterior to the morphogenetic furrow. The retinal determination network consisting of several transcription factors, specifies the position of the eye field in many different organisms [27]. Sine oculis, a member of the retinal determination network, regulates glass expression by directly binding to sites in the enhancer sequence [1]. Given that all enhancer fragments we tested, showed GFP expression posterior to the morphogenetic furrow, we propose that Sine oculis binds to multiple sites in the 5.2 kb enhancer to activate glass expression. In addition to this general reporter gene activation we identified specific enhancer regions driving expression in distinct cell types. For example, the 5’-end of the enhancer that leads to expression in the ocelli anlage and in a subset of the photoreceptors, or the BamHI-EcoRI region that activates expression in non-photoreceptor cells. Thus, other transcription factors binding more specifically to these enhancer elements, might regulate glass expression in a cell-type dependent manner.

The extended Glass PC isoform is dispensable for eye development and function

Stop codon readthrough is relatively abundant in Drosophila [28]. Especially genes expressed in the nervous system are putative candidates for this process [29]. Glass has also been listed as a candidate for this protein extension mechanism based on several criteria [18]: Sequence comparison of the amino acids following the regular stop codon shows a higher conservation within higher Diptera than what is found in the 3’UTR of non-readthrough transcripts. The pattern of nucleotide substitutions also suggests that there is no alteration of the reading frame as it might occur in the case of alternative splicing or ribosome hopping. The most frequent stop codon readthrough context (UGAC) [18], is also found at the Glass PA stop codon. Upon readthrough of a UGA stop codon either arginine, cysteine, serine, or tryptophan can be inserted by a near-cognate tRNA at this position [30]. In our isoform deletion experiments we did not test the conditions at which the stop codon is deleted or replaced by another codon (Glass PC and Glass PB+PC) because the function of the resulting protein might be affected by the type of alteration we introduce. Our results from the mutants expressing only the Glass PA isoform suggest, that under laboratory conditions, stop codon readthrough and production of the extended Glass PC version is not required for eye development and photoreceptor function.

Splicing of intron 4 is required to produce functional Glass protein

The Glass PB isoform alone is not functional. Our deletion mutants that can only express this truncated version as well as our other deletions that affect splicing and result in proteins terminating in intron 4, have a glass mutant eye phenotype, that is: they lack the expression of photoreceptor markers, show no photoreceptor activity and are photoneutral [1, 6, 31]. This corroborates previous results that showed that the last three zinc-fingers are essential for sequence specific DNA-binding and that a Glass protein lacking the C-terminal end shows no transcriptional activity [14]. The intron that is retained in the Glass RB transcript, is only found in Diptera and Lepidoptera, suggesting that it originated in the last common ancestor of flies and butterflies. Intron retention can be a means of regulating protein levels since they are usually degraded by nonsense-mediated decay [32]. One of the first examples for cell-type specific intron retention was the Drosophila P-element [33]. In germ cells intron 3 is spliced out resulting in functional transposase production. In contrast, in somatic cells intron 3 is retained resulting in a truncated protein that antagonizes the full-length protein. Intron retention can also generate new protein isoforms like the Drosophila Noble protein [34]. In addition, intron-retaining mRNA transcripts can remain in the nucleus and be spliced upon requirement providing a source of transcript that could be faster activated than by de novo transcription [35]. Recent RNAseq data suggests that intron 4 is not retained in the glass mRNA [4]. The authors found that expression of either the glass RA+RC or the glass RB transcript from transgenic constructs resulted in production of functional Glass protein, suggesting that in their ectopic expression experiments, intron 4 of the RB transcript was spliced out to produce full-length Glass PA (and PC) protein. Thus, we would consider the glass RB transcript as an intermediate stage that has been accumulated during cDNA preparation but that can be further processed to encode functional Glass protein. As we show here, the absence of intron 4 in the glass gene allowing only the production of the Glass PA (and PC) protein does not affect eye development and function.

Brs interferes with Glass translation

According to the scanning model of translation initiation [36], the 40S ribosomal subunit scans the mRNA from the 5’end until it encounters the first AUG codon. Translation will start at this codon, which in the case of glass mRNA would mean that only the Brs protein should be produced. However, under certain conditions, translation can also start at a later AUG codon [37]. One of these mechanisms, called leaky scanning, applies for an upstream AUG with a weak context, were the codon with the weak context is skipped by some ribosomes starting translation further downstream. However, this cannot be the case for Glass translation, since there are two AUG codons upstream of the Glass start codon within exon 2 and both have a better Kozak sequence than the actual Glass AUG. Another mechanism would be reinitiation, where after translation of a small upstream open reading frame, the ribosome can move on and re-acquire a Met-tRNA allowing it to reinitiate translation at the next AUG codon. However, since ribosomes cannot backup, the overlapping open reading frame should profoundly inhibit Glass translation [38, 39]. It was shown that overlapping upstream open reading frames; and particularly those that have an optimal AUG context, are efficiently removed from the Drosophila genome [40], suggesting that those that can be found and that are even conserved outside of the most closely related species, have been selected due to a specific function. In the case of Glass, we found evidence that translation from the upstream start codon strongly reduces GFP translation and also interferes with Glass translation when overexpressed. However, this suggests that the endogenous Glass protein would be expressed at very low levels. One possible way to overcome this problem, would be by splicing out exon 2 so that the two upstream AUGs and the Glass AUG would be removed from the transcript. In this case translation would start from an AUG codon in exon 3 (amino acid 26 of the predicted full-length protein). However, there is no evidence, that exon 2 is spliced out of the transcript to produce a truncated Glass version. Another hypothesis would be that Glass translation starts by reinitiation at the AUG codon in exon 3 after translation of Brs. In fact, the Glass proteins of Anopheles darlingi and of Culex quinquefasciatus are predicted to start at this position (with a conserved motif: MYISC), while Anopheles gambiae Glass is predicted to start in an exon located further upstream of the start codons of the other two mosquito species, but with an N-terminal sequence that is not related to that found in Drosophila and other higher Diptera. Also, other insects’ Glass proteins start further downstream than in the Diptera. It could be possible that for most insects the actual Glass translation start has not yet been identified due to higher sequence divergence at the N-termini. This would suggest, that the first 25 amino acids mostly encoded by exon 2 of the Drosophila transcripts are dispensable for Glass function, or that they are only required in higher Diptera. In addition to regulating Glass protein levels by directly interfering with translation efficiency, the Brs peptide could have other functions in the developing eye, where it is expressed along with Glass. Small peptides can have important roles such as hormones, pheromones, transcriptional regulators, antibacterial peptides, etc. [41]. However, we could neither identify such a role for Brs by mutating it, nor by overexpressing it, suggesting that its main role is the regulation of Glass translation.

In summary, our results suggest that the removal of intron 4, which was added in the common ancestor of flies and butterflies, is essential for the production of a functional Glass protein. Stop codon readthrough resulting in an extension of the Glass protein that is conserved in higher Diptera seems to be dispensable for Glass function in photoreceptor development. The addition of an exon containing several AUGs upstream of the Glass start codon found in mosquitoes, can interfere with Glass translation. Nevertheless, conservation of the upstream start codon and sequence conservation of the Brs peptide suggest that higher Diptera have found a way to overcome this interference and that Brs might even have adopted a beneficial function.

Fly strains

Flies were reared at 25°C on a cornmeal medium containing agar, fructose, molasses, and yeast. Strains for site directed integration (25709, 25710), w¹¹¹⁸ mutants (3605), deficiency lines (4431, 7657) [42], balancer lines (36305, 8379), and nos-Cas9 expressing flies (54591) [43] were obtained from the Bloomington Drosophila Stock Center. ey-Gal4 expressing flies were a kind gift from R. Stocker.

Transgenic constructs

All oligos used for cloning and all sequencing reactions were purchased from microsynth. The following primer sequences show the annealing sequence part in capitals and any additional sequence in small letters. Restriction sites are underlined.

A 5257 basepair long PCR fragment was amplified from genomic DNA of CantonS flies using primers “glass -4301 Asc fw” (5´-ggcgcgccTAACCCGATACAAATGGAGAGG-3´) and glass 5’UTR Not re”(5´-gcggccgcGACATGACTCCACTTCTGGAAC-3´). The fragment was inserted into pCR-Blunt II-TOPO vector (Invitrogen). From there it was excised using the restriction enzymes AscI and NotI and cloned into a GFP reporter vector (pDVattBR, kind gift from Jens Rister) to generate the basic glass-GFP reporter construct (Fig 1A and 1B’). The plasmid was injected into y, w; attP2 embryos to produce transgenic flies (Genetic services Inc.).

To delete the two upstream start codons, a 1483 bp PCR product was amplified from the original glass-GFP reporter plasmid using primers “glass -597 fw” (5’-TAAAAACTACTGAAAACTGCTGCCGATG-3’) and “glass exon2 noAUG Pme re” (5’-gcgtttaaacGATGCGTTAATTTCCAACTGCAAGGC-3’), TOPO cloned into pCRII, sequenced, digested XhoI-PmeI, and transferred into the original plasmid also cut with XhoI-PmeI, thereby removing the 104 basepairs encoding the N-terminus of Brs, and part of the multiple cloning site of the vector (Fig 1C’).

To put the GFP coding sequence in frame with the upstream start codon, the GFP coding sequence was amplified by PCR using the primers “GFP noStart Not fw” (5’-tcgcggccgcgGGTGAGCAAGGGCGAGG-3’) putting a NotI site in front of GFP (starting with the 3^rd nucleotide of GFP) and “GFP down Fse re” (5’-GATTATGATCTAGAGTCGCGGCCG-3’) covering an FseI and an XbaI site in the plasmid. The PCR product was cloned NotI-XbaI into pBluescript, sequenced, and transferred NotI-FseI into the original glass-GFP reporter plasmid deleting most of the multiple cloning site and the GFP start codon (Fig 1D’).

For the enhancer analysis, the construct lacking the upstream start codons was digested with different combinations of restriction enzymes and religated. For construct B the plasmid was digested with BglII cutting in the multiple cloning site at the 5’-end of the enhancer and with BamHI cutting at position -3123. A second BamHI site at position -1885 was not in the database sequence but is present in the fragment amplified from the CantonS flies. Therefore, religation of the plasmid after BglII-BamHI digestion (the two enzymes producing compatible sticky ends) resulted in an enhancer fragment ranging from position -1885 to +886. For construct C the plasmid was digested with EcoRI cutting at the multiple cloning site at the 5’-end of the enhancer and at positions -1598 and -2040 in the enhancer. Religation resulted in an enhancer fragment ranging from position -1598 to +886. For construct D the plasmid was digested with XbaI cutting in the multiple cloning site at the 5’-end of the enhancer and at position -703. Religation resulted in an enhancer fragment ranging from -703 to +886. For construct E, construct C was digested with XbaI cutting in the multiple cloning site at the 5’-end and at position -703 in the enhancer as well as with XhoI cutting at position -239 in the enhancer. The two ends were filled using Klenow polymerase and religated resulting in an enhancer fragment ranging from position -239 to +886. For construct F, construct B was digested with EcoRI cutting at position -1598 and XhoI cutting at position -239. The two ends were filled using Klenow polymerase and religated resulting in an enhancer fragment ranging from position -1885 to -1598 fused to the minimal promoter fragment from position -239 to +886. For construct G, the original -4301 to +886 plasmid was digested with NheI cutting at positions -1910, -1903, and -682, the site at position -2179 is missing in our enhancer fragment amplified from CantonS flies. In another reaction the original plasmid was digested with EcoRI cutting at positions -1598 and -2040. Both reactions were filled using Klenow polymerase, digested with BglII, and then the BglII-NheI_filled fragment was ligated into the BglII-EcoRI_filled fragment fusing the enhancer region from -4301 to -1910 to the region from -1598 to +886. For construct H, the original plasmid was digested BamHI-XhoI. The two ends were filled using Klenow polymerase and religated to fuse the fragment from -4301 to -3123 to the fragment from -239 to +886. For construct I, the original plasmid was digested with NheI and in an independent reaction with XhoI. Both digestion reactions were filled with Klenow polymerase. The NheI_filled reaction was further digested with BamHI and the XhoI_filled reaction was further digested with BglII. Then the BamHI-NheI_filled fragment was ligated into the BglII-XhoI_filled plasmid resulting in a fusion of an enhancer fragment ranging from -3123 to -1910 to the minimal promoter ranging from -239 to +886.

All constructs were injected into nos-ΦC31;; attP2 flies for site directed integration. The G0 flies were crossed individually to w¹¹¹⁸ flies to screen for w⁺ offspring. w⁺ F1 flies were crossed individually to 3^rd chromosome balancer flies (w;; Dr e/TM3) and their balanced offspring was crossed inter se to produce stable lines.

For the UAS constructs we used the glass cDNA plasmid GH20219 as starting point. This cDNA still contains intron 4 due to incomplete splicing resulting in the RB transcript isoform. To remove the intron, two PCR reactions were set up. One with primers “glass 5’UTR BamHI fw” (5’-gaggatCCTCGCCAAAAGTCGCTTCTTG-3’) and “glass exon4 re” (5’-ccccgactgcgaaaatCTGAGCAGGCAGAGCTTGCAC-3’) resulting in a fragment ranging from the 5’-end of the 5’UTR to the end of exon 4, with the sequence given in small letters of the reverse primer overlapping with the beginning of exon 5. The other PCR reaction was done with primers “glass exon5 fw” (5’-gctctgcctgctCAGATTTTCGCAGTCGGGGAACTTG-3’) and “gl Stop Xho re” (5’-ggctcgaGTCATGTGAGCAGGCTGTTGCC-3’), resulting in a fragment ranging from the beginning of exon 5 to the PA stop codon, with the sequence given in small letters of the forward primer overlapping with the end of exon 4. Both PCR products were mixed together to provide the template for another PCR reaction with primers “gl 5’UTR BamHI fw” and “gl Stop Xho re”. The resulting PCR product ranging from the 5’UTR to the PA stop codon without intron 4 was digested with BamHI-XhoI and cloned into pBluescript. After sequencing, different fragments were PCR amplified. The Glass PA coding sequence was amplified with primers “gl Start+Kozak attB1 fw” (5’-ggggacaagtttgtacaaaaaagcaggcttcaaCATGGGATTGTTATATAAGGGTTCCAAACT-3’) and “gl Stop attB2 re” (5’-ggggaccactttgtacaagaaagctgggtcgTCATGTGAGCAGGCTGTTGCC-3’). The brs sequence was amplified with primers “glass+Smurf attB1 fw” (5’-ggggacaagtttgtacaaaaaagcaggcttcCGCATCAAGATGAAGCGTAGGAAAAGC-3’) and “glass Smurf Stop attB2 re” (5’-ggggaccactttgtacaagaaagctgggtcTCAGGAGTTTGGAACCCTTATATAACAATCCC-3’). The brs-glass-PA sequence was amplified with primers “glass+Smurf attB1 fw” and “gl Stop attB2 re”. The primer sequence in small letters are the attB parts used for gateway cloning. The PCR products were gateway cloned into pENTRY201, sequences, and transferred into the vector pUASg.attB for injection (Genetic Services Inc.). UAS-glass-PA and UAS-brs-Glass-PA were injected into nos-ΦC31; attP40 flies, while the UAS-brs plasmid was injected into nos-ΦC31;; attP2 flies. After balancing the transgenic flies, UAS-glass-RA^attP40 and UAS-brs^attP2 were combined in a single line: w; UAS-GlassRA^attP40; UAS-Brs^attP2. The different UAS-construct bearing flies were crossed to ey-Gal4/CyO flies, and the number of offspring with Cy⁺ versus the number of offspring with CyO wings was determined. For calculation of the survival rate the number of Cy⁺ flies was divided by the number of CyO flies (Table 1).

CRISPR

For the alterations of the endogenous glass locus by CRISPR/Cas9 genome editing, we assembled the different templates in pBluescript. For the Glass PA+PC variant, we needed to remove intron 4 from the genomic DNA without changing the sequence at the Glass PA stop codon. Since there were no useful restriction sites between the intron 4 / exon 5 junction and the Glass PA stop codon, we decided to introduce an NdeI site in this sequence by altering a single nucleotide in the third position of the codon for the first histidine residue of the last zinc-finger (histidine 567 of Glass PA: CAC to CAT). We PCR amplified a 932 bp fragment from the genomic DNA of nos-Cas9 flies using primers “glass ex5 R1 Nde fw” (5’-gagaattcatatgCGCGTCCACGGCAAC-3’) and “glass 3’UTR re” (5’-GATCAAAGCACCTGTCTTACATCTACGTCTAG-3’), and a 1529 bp fragment from the intronless glass version assembled in pBluescript for generation of the UAS-glass-PA construct using primers “glass ex4 R1 fw” (5’-cggaattcAAGAGTGCGCCGCTTCC-3’) and “glass ex5 Nde re” (5’-CGCATatgCCGATTCAAGTTCCCCGAC-3’). Both PCR products were combined in pBluescript vector by digesting the one covering the C-terminus from the NdeI site introduced in exon 5 to an endogenous HindIII site in the 5’UTR with NdeI-HindIII, and the one covering exon 4 and part of exon 5 with EcoRI-NdeI (due to an endogenous NdeI site in the middle of exon4 this part was cloned in two steps). The sequence of the resulting fragment ranging from the beginning of exon 4 to the 5’UTR and lacking intron 4 was confirmed.

For the Glass PB variant, we introduced a deletion ranging from the end of intron 4 to the middle of the sequence added in the extended Glass PC protein version (Fig 4A). We amplified two PCR products from the genomic DNA of nos-Cas9 flies. A 1866 bp fragment spanning exon 4 and most of intron 4 was amplified with primers “glass ex4 R1 fw” and “glass int4 Xho re” (5’-AActcgagGTATAACGTTCCAGGACTGCTC-3’), and a 1287 bp fragment ranging from the middle of the Glass PC encoding sequence to a place located around 500 bp downstream of the glass gene was amplified with primers “glass 3’UTR Xho fw” (5’-aactcgagCATCGGCGATTATACTCCACC-3’) and “glass down Kpn re” (5’-agggtaccTTTATGGTGGCCTCCCAGG-3’). Both fragments were subcloned, sequenced and combined in pBluescript by digesting the one covering exon 4 and intron 4 with EcoRI-XhoI, and the one covering part of the PC coding region, the 3’UTR and donwnstream genomic sequence with XhoI-Acc65I.

For the Glass PA+PB variant, we introduced two additional stop codons at the end of the Glass PA encoding part and deleted 29 of the nucleotides following the stop codon. We PCR amplified two PCR products from the genomic DNA of nos-Cas9 flies. A 2034 bp fragment spanning exon 4, intron 4, and the PA encoding part of exon 5 was amplified with primers “glass ex4 fw” and “glass RA 3xStop Xho re” (5’-ctctcgagctattatcaTGTGAGCAGGCTGTTGCCAC-3’). A 1365 bp fragment spanning most of the Glass RC specific sequence, the 3’UTR and around 500 nucleotides of downstream genomic sequence was amplified using primers “glass RC Xho fw” (5’- ttctcgAGCATTACCACCCCCCGC-3’) and “glass down Kpn re”. Both fragments were subcloned, sequenced, and combined in pBluescript by digesting the one covering exon 4, intron 4, and the Glass PA encoding part plus stop codons with EcoRI-XhoI, and the one covering the Glass PC region, 3’UTR, and downstream genomic sequence XhoI-Acc65I.

For the Glass PA variant, we performed a PCR amplification of exon 4 and the 5’-end of exon 5 with the same first primer pair as for the Glass PA+PB template, but using the intronless glass version assembled in pBluescript for generation of the UAS-glass-PA construct as a template. We subcloned this 1638 bp fragment EcoRI-XhoI, sequenced it, and combined it with the 1365 bp fragment spanning most of the Glass RC specific sequence, the 3’UTR and around 500 nucleotides of downstream genomic sequence.

For expression of the CRISPR guideRNAs, sense and antisense oligos with overhangs fitting the sticky ends of the BbsI digested vector were annealed and ligated into pU6-BbsI-chiRNA plasmid (a gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 45946 [44]). Site 1 (ctgctcaggtgagtccg/gga) is located at the junction between exon 4 and intron 4. Site 2 (gtccacagattttcgca/gtc) is located at the junction between intron 4 and exon 5. Site 3 (agg/agtgcaggaggtttcca) guides Cas9 to cut 12 bp downstream of the Glass PA stop codon. Site 4 (aca/tgggtaactacgactac) is located in the middle of the Glass PC encoding region (Fig 4A). CRISPR sites were selected based on their position in the glass genomic sequence using a CRISPR site prediction program (http://tools.flycrispr.molbio.wisc.edu/targetFinder/ [45]).

The templates for the different Glass isoform variants were co-injected with sgRNA expression plasmids into embryos of nos-Cas9 flies. The Glass PA+PC variant was co-injected with the sgRNA plasmids for sites 1 and 2. The template for the Glass PB variant was co-injected with sgRNA plasmids for sites 2 and 4. The template for the Glass PA+PB variant was co-injected with the sgRNA plasmid for site 3. The template for the Glass PA variant was co-injected with the sgRNA plasmids for sites 1 and 3. The resulting G0 flies were crossed individually with deficiency lines uncovering the glass locus. Some of the offspring resulting from Cas9 cutting at CRISPR site 1 (and 3) showed a glass mutant phenotype due to CRISPR induced non-homologous end joining (S7 Fig). Irrespective of the eye phenotype the offspring was crossed individually with third chromosome balancer flies (w;; Dr, e/TM3) and analyzed by PCR for the introduced deletions and sequence alterations. The glass genes of those lines that showed changes in the PCR analyses, were sequenced to confirm the introduced changes and identify other alterations that resulted in glass mutant phenotypes.

For the deletions in the brs sequence, template sequences were assembled in pBluescript. For the 1nt deletion two PCR products were amplified. A 2759 bp fragment ranging from position -1863 in the glass enhancer region to position +896 in the brs coding sequence was amplified using primers “glass -2700 Kpn fw” (5’-tgggtaccGGCAGCAGAGACAGGCTC-3’) and “smurf -1nt H3 re” (5’-ccaagcttCATCTTGATGCGTTAATTTCCAACTGC-3’). The resulting PCR product was cloned Acc65I-HindIII into pBluescript and sequenced. A 2493 bp fragment ranging from position +899 in the brs coding sequence to position +3392 at the end of exon 4 was amplified from nos-Cas9 genomic DNA using primers “smurf -1nt H3 fw” (5’-gaaagcttGGAAAAGCAGGAACAAATGCGCG-3’) and “glass exon4 Pst re” (5’-ctctgcagGCAGAGCTTGCACTGG-3’). The resulting PCR product was cloned HindIII-PstI into pBluescript, sequenced, and combined with the 5’-fragment. For the 5 nt deletion fusing Brs with Glass, A 2821 bp fragment ranging from position -1863 to +953 in the brs coding sequence just before the second AUG codon was amplified from nos-Cas9 genomic DNA using primers “glass -2700 Kpn fw” and “smurf -5nt BamH Nco re” (5’-ccggatcccatggCTCCACTTCTGGAACGTTTGGGC-3’). The resulting PCR product was cloned Acc65I-BamHI into pBluescript and sequenced. A 1632 bp fragment ranging from position +959 just before the Glass start codon to position +2591 in exon 4 was amplified from nos-Cas9 genomic DNA using primers “smurf -5nt Nco fw” (5’-ctccatggGATTGTTATATAAGGGTTCCAAACTCCTG-3’) and “glass ex4 Not re” (5’-aagcggccgcatggtgcatggtcatgttcatgc-3’), cloned NcoI_filled-NotI into pBluescript BamHI_filled-NotI, sequenced, and combined KpnI-NcoI with the 5’-fragment. For expression of the CRISPR guideRNAs, sense and antisense oligos with overhangs fitting the sticky ends of the BbsI digested vector were annealed and ligated into the BbsI digested pCDF4-U6:1_U6:3tandemgRNAs plasmid (gift from Simon Bullock, addgene plasmid # 49411). The site for the -1nt deletion (aacgcatcaagatgaag/cgt) is located at the upstream start codon, the site for the -5nt deletion (ccagaagtggagtcatg/tca) is located at the Glass start codon (Fig 3A). The templates for the brs mutations were co-injected with the corresponding sgRNA expression plasmid into embryos of nos-Cas9 flies. The resulting G0 flies were crossed individually with deficiency lines uncovering the glass locus. Some of the F1 flies had a very subtle rough eye phenotype over the glass deficiency–but also over the TM6b balancer. The F1 flies were crossed individually with 3^rd chromosome balancer flies to establish stocks, and tested by PCR and restriction digest with either HindIII or NcoI for presence of the introduced changes. Genomic DNA of the glass locus from homozygous candidates was PCR amplified and sent for sequencing. Additional sequence changes due to non-homologous end joining were also identified (Fig 3A(d-f)).

Transcription factor binding site scanning

We used FIMO from the meme suite version 4.9.1 [46, 47] with the standard parameter. Drosophila only Position Weight Matrices (PWMs) were collected and carefully curated from flyfactorsurvey [48], Jaspar [49] and Transfac [50].

Quantitative PCR

Eye-antennal-discs were dissected from 25–30 larvae per genotype and experiment. Total RNA was extracted using Trizol (QIAzol, QIAGEN) and chloroform. After precipitation the RNA pellets were resuspeded in nuclease-free water and the RNA content determined using NanoDrop (Thermo Fisher Scientific). cDNA was generated using the GoScript reverse transcription system (Promega) with oligo(dT) primers. qPCR was performed on a Rotor Gene Q cycler (QIAGEN) using the KAPA SYBR FAST qPCR Kit (KAPA biosystems). The following primer combinations were used:

• “act42c qP fw” (GCAGCGGATAACTAGAAACTACTCC) located at the end of the first exon of the Drosophila actin42c gene, and “act42c qP re” (CGACCACTAAAGCTGCAACCTC) located at the beginning of the second exon of the Drosophila actin42c gene as housekeeping gene.
• “gl qP ex4 fw” (TCACCAAGCACCTGCGAATC) located at the end of exon 4 of the Drosophila glass gene, and “gl qP ex5 re” (CGCATGTGCCGATTCAAGTTCC) located at the beginning of exon 5, to detect spliced glass cDNA.
• “gl qP ex4 fw” and “gl qP int4 re” (AGGACGGTGTAAGTAAATCCCCC) located at the beginning of intron 4, to detect glass cDNA that still contains intron 4.

qPCR Primers were synthetized and HPLC purified at microsynth. All qPCR reactions were set up as duplicates and three biological replicates were performed for each genotype. The thresholds were set manually and the resulting Ct values were analysed using Microsoft Excel to calculate average, standard deviation and statistical significance (student’s t-test).

Light preference assay

The light preference assays were prepared and performed under red light conditions during the subjective day. Drosophila melanogaster adults of both sexes were used. Given that light perception in Drosophila is affected by age [6], for consistency, we used <1 day old flies in all our experiments. Without anaesthesia 20–40 flies were taken from food vials and loaded into the elevator chamber of a T-maze. The elevator chamber was descended, and flies were allowed to move freely between the elevator chamber and two plastic tubes for 2 min. A white LED was placed at one end of one testing tube. Thus, only one testing tube was illuminated. After 2 min the elevator chamber was ascended, and flies were not able to move between testing tubes and elevator chamber. We determined the number of flies in the illuminated testing tube (L) and the number of flies in the dark testing tube (D) as well as the number of flies in the elevator chamber (E). We calculated a preference index as follows:

Light intensity was measured from the distance of the elevator chamber to the LED. The light intensity was 1338 μW/cm² with a first maximum intensity peak of 16.6 μW/cm²/nm at 443 nm with half-widths of around 11 nm and a second maximum intensity peak of 6.8 μW/cm²/nm at 545 nm with half-widths of around 62 nm.

Electroretinogram

ERG recordings were obtained as previously described [51]. Briefly, we mounted living flies inside a pipette tip, leaving their heads outside, and immobilised them with a mixture of bee wax and colophony 3:1, which worked as a glue. We placed the flies inside a dark chamber and applied two electrodes: a ground electrode was positioned inside the head of the fly, and a recording electrode was introduced into the retina. In our stimulation protocol, we illuminated the compound eye with orange light for 5 seconds to transform all metarhodopsin to rhodopsin, switched off the light for 10 seconds, and illuminated again a second time with orange light for another 5 seconds. We recorded the response of photoreceptors to the second stimulus.

Immunohistochemistry

Eye imaginal discs were dissected from third instar larvae and fixed in 3.7% formaldehyde dissolved in phosphate buffer (PB) for 20 minutes. Bolwig organs from third instar larvae and ocelli and eyelets in the adult brain were dissected in PB and fixed in 3.7% formaldehyde prepared in PB for 25 minutes.

For cryosections, we dissected the heads of the flies and fixed them for 20 minutes with 3.7% formaldehyde dissolved PB, as previously described [1]. We washed these samples by using phosphate buffer with Triton 0.3% (PBT) and incubated them overnight in cryoprotected solution (25% sucrose in PB). Then, we embedded the heads in OCT, froze them, and took 14 μm sections by using a cryostat.

All tissue samples (eye imaginal discs, bolwig organs, adult brains with ocelli, eyelets and cryosections) were washed with PBT at least 3–4 times and incubated sequentially in primary and secondary antibodies (each antibody incubation step was performed overnight, washing with PBT (3–4 times) between and in the end of these steps). We used Vectashield as a mounting medium.

As primary antibodies, we used rabbit anti-GFP (1:1000, Molecular probes, A-6455), rabbit anti-Rh2 (1:100) [24], rabbit anti-Rh6 (1:10,000) [52], rabbit anti-Sal (1:500) [53], guinea pig anti-Kr (1:200, a gift from J. Jaeger), mouse anti-Rh5 (1:50) [54] and guinea pig anti-Sens (1:800, courtesy of H. Bellen [55]). To stain against phototransduction proteins we used antibodies generated in C. Zuker’s lab: anti-NorpA (1:100), rabbit anti-Trpl (1:100), both of which were kindly provided by N. Colley. The following antibodies were obtained from Developmental Studies Hybridoma Bank (DSHB) at The University of Iowa: mouse anti-Rh1 (1:20, 4C5), mouse anti-Trp (1:20, MAb83F6), mouse anti-FasII (1:20, No. 1D4), mouse anti-Chp (1:20, No. 24B10) and rat anti-Elav (1:30, No. 7E8A10).

Secondary antibodies were obtained from Molecular probes, and we used the conjugated with the following Alexa fluor proteins: 488, 568, and 647. In addition, we also used Hoechst 33258 (1:100, Sigma, No. 94403).