Brat suppresses regenerative growth and is required for wing margin cell-fate specification during regeneration

To identify genes important for regenerative growth and re-patterning, we performed a candidate screen, using our wing imaginal disc ablation system [23]. The primordial wing was targeted for ablation at the early third-instar larval stage by using rotund-GAL4 to drive the expression of the proapoptotic gene reaper for 24 hours (Fig 1A). Our ability to restrict damage to 24 hours was provided by tubulin-GAL80^ts, which can inhibit GAL4 activity at 18°C, but allows GAL4-driven cell death at 30°C in the 24-hour window. The extent of wing imaginal disc regeneration in the larvae was reflected in the adult wing size. Hence, the resulting adult wings were scored based on size and patterning features to identify mutants that affect genes that are involved in regulating regenerative growth and establishment of cell fates. There is inherent variability in this system because of environmental conditions such as temperature, humidity, and food quality that affect the pace of development, leading to minor differences in developmental age at the onset of ablation, causing the results of different experiments to vary slightly [14,48–51]. In addition, the average amount of regeneration across all animals can be modified by slightly shifting the timing of ablation, enabling us to choose experimental conditions that result in most control animals regenerating about half the wing primordium, to enable screening for enhanced or reduced regeneration in mutants. Animals with the same genotype within an experiment also showed some variation, due to stochastic differences in the time each animal takes to eclose, with animals that take longer to eclose having larger wings [23,50]. However, differences between control and mutant animals using this system are reproducible, consistent, and have identified key regeneration genes [32,49–51].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Enhanced regenerative growth and wing margin cell-fate specification defects in brat¹/+ during regeneration.

(A) The protocol used to study regeneration. Animals were raised at 18°C and shifted to 30°C for 24 hours during early third-instar larval development on day 7 after egg lay (AEL). Larvae were returned to 18°C and were dissected at the time points noted during recovery (R) or allowed to pupariate and eclose. Representative wings depicting the range of adult wing sizes observed after regeneration compared to the size of a normal wing are shown. (B) Adult wing sizes observed after disc regeneration for control (w¹¹¹⁸) (n = 317) and brat¹/+ (n = 208) wings, from three independent experiments. (C) Adult wing area after normal development or disc regeneration, measured using ImageJ after mounting and imaging wings, for control (w¹¹¹⁸) (undamaged n = 133, regenerated n = 309) and brat¹/+ (undamaged n = 86, regenerated n = 195) wings. undamaged p = 0.45 regenerated p = 2.5158E-119. Wings in (C) are from the same experiments as (B). Note that number of wings in (C) is less for both control and brat¹/+ due to some wings being damaged during the mounting process. (D) Undamaged control (w¹¹¹⁸) wing. (E) Undamaged brat¹/+ wing. (F) Adult control (w¹¹¹⁸) wing after disc regeneration. (G) Adult brat¹/+ wing after disc regeneration. (H) Frequency of margin defects seen in adult wings after disc regeneration for control (w¹¹¹⁸) (n = 93) and brat¹/+ (n = 218) wings, from three independent experiments. The wing margin was divided into five segments based on where the veins intersect the margin as shown in the diagram. Each wing was scored for the number of segments that had some margin tissue missing, with wings with a perfectly intact margin scoring at zero. Wing shown in (G) had tissue missing in four segments. (I) Margin tissue lost as a percentage of total wing perimeter for control (w¹¹¹⁸) (n = 76) and brat¹/+ (n = 221) wings. p = 9.947E-08. The margin perimeter and the length of margin tissue lost were measured using ImageJ after mounting and imaging wings. Wings in (I) are from the same experiments as (H). Note that number of wings in the two quantifications is different because we did not quantify wings with length <1.1 mm for males and <1.7 mm for females, to ensure analysis was being carried out on nearly fully regenerated wings. (I). Percentage of wings with no defects fell from 79.0% to 77.6% for control and from 56.3% to 53.8% for brat¹/+ wings due to the increased ability to detect lost margin tissue at the higher magnification and resolution achieved by imaging the wings. Wing shown in (G) had 33.9% of margin tissue missing. Error bars mark standard error of the mean (SEM). Student’s T-test used for statistical analyses. Scale bars are 0.5 mm.

https://doi.org/10.1371/journal.pgen.1011103.g001

Using this genetic ablation system, we identified the gene brain tumor (brat) as an important regulator of regenerative growth. brat¹/+ [52,53] mutants that did not experience damage during development had adult wings that were not significantly different in size from controls across the whole population, although control female wings were slightly larger than brat¹/+ female wings (by an average of 0.03 mm²), and brat¹/+ male wings were slightly larger than control male wings (by an average of 0.09 mm²) (Figs 1C and S1A). However, after ablation and regeneration were induced, the combined population of brat¹/+ mutants showed enhanced regeneration and had adult wings that were, on average, much larger than controls that had also undergone regeneration (an average of difference of 1.04 mm²) (Fig 1B and 1C). We confirmed this enhanced regeneration phenotype in heterozygotes for three other brat mutant alleles: brat¹⁹², brat¹⁵⁰ [54] and brat¹¹ [55](S1B Fig). Each of these ethylmethonylsulfate-induced mutations is considered amorphic, and the molecular lesions in brat¹¹, brat¹⁹², and brat¹⁵⁰ are premature stop codons [40, 42].

Interestingly, we also discovered a role for brat in cell-fate specification during regeneration. After normal development, brat¹/+ mutants had adult wings that were patterned normally (Figs 1D, 1E and S1C). To confirm that reduction in brat expression does not cause patterning errors during normal development, we knocked down Brat levels in the entire wing pouch using brat RNAi, which resulted in adult wings that were patterned normally (S1D and S1E Fig). A previous study in which Brat levels were reduced in the anterior and posterior compartments of the wing also did not report any patterning defects [56]. However, when discs were ablated and allowed to regenerate, brat heterozygous mutant wings that had regenerated to 75% or 100% size showed aberrant patterning such that the wing margin lost sensory bristles and vein material (Fig 1F and 1G). By contrast, control regenerated wings that had regenerated to 75% or 100% size lost margin tissue at a lower frequency (Fig 1H and 1I). Furthermore, the extent of margin tissue lost was not as severe in control regenerated wings as compared to brat¹/+ regenerated wings (Fig 1H and 1I). Similar to the enhanced regeneration seen in brat mutants, we confirmed the loss-of-margin defect in heterozygotes for the additional three mutant alleles (S1F Fig). We attempted to reduce Brat levels solely in the regenerating wing pouch, and found that Brat RNAi failed to reduce Brat expression during regeneration (S1G Fig) despite its ability to reduce Brat levels during normal development (S1D Fig). Therefore, we were unable to rule out a non-autonomous requirement for Brat outside of the regenerating tissue.

brat regulates entry into metamorphosis

Tissue damage in imaginal discs can induce a systemic response in the larvae, which extends the larval phase of development and delays pupariation [23,57]. This delay in pupariation is due to expression of the relaxin-like peptide ilp8 in damaged discs [58,59]. To determine whether brat mutants regenerated better due to an enhanced delay in pupariation, we measured rates of pupariation in control and mutant animals. We found that during normal development, control and brat¹/+ animals pupariated at the same time, indicating that the two genotypes develop at similar rates (S2A Fig). After disc damage, brat mutants delayed pupariation an additional day compared to controls in which discs were also damaged (Figs 2A and S2B). Note that direct comparisons cannot be made between regenerating larvae that spent 24 hours at 30°C (Figs 2A and S2B) and normally developing larvae that remain at 18°C (S2A Fig), due to the effects of temperature on development. Our data show that brat/+ mutants are able to stay in the larval stage even longer than controls, giving them more time to regenerate. Interestingly, when we measured ilp8 transcript levels through qPCR, we saw an 80-fold increase in ilp8 levels after tissue damage in controls, and a 140-fold increase in brat¹/+ animals (Fig 2B), suggesting that Brat’s effects on pupariation timing could be through Ilp8 expression.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. brat¹/+ animals have a regenerative growth advantage.

(A) Pupariation rates after disc regeneration for control (w¹¹¹⁸) (n = 384) and brat¹/+ (n = 107) animals, from three independent experiments. (B) Relative expression levels of ilp8 for undamaged control, R24 control (w¹¹¹⁸) and R24 brat¹/+ discs. (C) Anti-Nubbin immunostaining in an undamaged control disc. (D-E) Anti-Nubbin immunostaining in an R48 control (w¹¹¹⁸) disc (D), and an R48 brat¹/+ disc (E). (F) Quantification of area of Nubbin-expressing cells for control (w¹¹¹⁸) and brat¹/+ discs at R0 (n = 10 and 10), R24 (n = 12 and 12) and R48 (n = 10 and 10). * p < 0.03. (G-H) Anti-PH3 immunostaining (white) and anti-Nubbin (green) in an R0 control (w¹¹¹⁸) disc (G), and an R0 brat¹/+ disc (H). The yellow dashed lines outline the Nubbin-expressing wing pouch. (I) PH3-positive nuclei were counted within the regenerating tissue as marked by Anti-Nubbin co-immunostaining. Quantification of PH3-positive nuclei in Nubbin area for control (w¹¹¹⁸) and brat¹/+ discs at R0 (n = 16 and 18) and R24 (n = 15 and 16). ** p < 0.002. Error bars represent SEM. Student’s T-test used for statistical analyses. Scale bars are 100 μm.

https://doi.org/10.1371/journal.pgen.1011103.g002

brat restricts growth and proliferation during regeneration

Regenerative growth occurs through localized cell proliferation at the wound site [23,60].The proliferating cells, known as the blastema, give rise to the regenerated tissue. The blastema and the subsequent regenerated wing pouch can be labeled with the wing primordium marker Nubbin (Nub) [61]. To determine whether brat¹/+ discs regenerated better due to increased growth rates in the wing pouch, we measured the area of the Nub-expressing cells in control and brat¹/+ regenerating discs. In the initial stages of regeneration, the control and mutant had similar Nub-expressing areas and numbers of Nub-expressing cells, indicating equal ablation and equal early regrowth. However, by 48 hours after tissue damage (recovery time 48, or R48), brat¹/+ wing discs had a significantly bigger Nub-expressing pouch than the control (Figs 2D–2F, S2C), indicating that brat/+ mutants were regenerating faster than controls. To assess whether this difference in growth rates was due to differences in proliferation, we counted cells going through mitosis by quantifying Phospho-histone H3 (PH3)-positive nuclei in the regenerating blastema. Reduction of brat resulted in a significantly higher number of PH3-positive nuclei per area at R0, but this increased proliferation had subsided to normal levels by R24 (Fig 2G–2I). To confirm that the increased number of PH3-positive nuclei were not simply due to an increased number of total cells in the blastema, we also counted total Nubbin-positive nuclei in the regenerating blastema to calculate a ratio of proliferating cells to blastema cells (S2D Fig). In addition, EdU incorporation was increased in the brat¹/+ regenerating wing pouch relative to the notum at R0 (S2E Fig). These data confirm increased proliferation in brat¹/+ regenerating discs at R0. We have observed previously that it can take time for a slight difference in proliferation in the regenerating tissue to result in a measurable difference in the wing pouch area. For example, animals heterozygous for cap-n-collar had reduced numbers of PH3-immunostaining nuclei at R0 but did not show a statistically significant difference in pouch size until R48 [51]. Therefore, reduction of brat gives the regenerating tissue a growth advantage early in regeneration, resulting in a measurable difference in tissue area by R48.

Wingless (Wg) and Myc are regulators of regenerative growth and are upregulated at the wound site after damage [20,21,23]. Interestingly, Brat regulates stem cell differentiation in the brain by suppressing self-renewal signaling pathways such as Wnt signaling, and acting as a post-transcriptional inhibitor of Myc, to enable specification of progenitor cell fate [42,62]. Additionally, Brat overexpression can suppress Myc at the post-transcriptional level in wing disc epithelial cells, although loss of brat does not lead to elevated Myc protein in wing discs during normal development [56]. To determine whether these regulators of regenerative growth are upregulated in brat¹/+ regenerating discs, we examined the expression of Wg and Myc. Wg is normally expressed along the Dorso-ventral (DV) boundary and in two concentric circles at the inner and outer edge of the wing pouch [63] (Fig 3A), and Myc is expressed in the wing pouch, but is repressed in the cells at the DV boundary as they undergo cell cycle and growth arrest [64] (Fig 3B). Both Wg and Myc expression were comparable to controls in undamaged brat¹/+ discs (S3A–S3E Fig). When damage is induced, Wg is upregulated throughout the blastema by R0 [23] (Fig 3C). Reduction of brat expression resulted in significantly higher levels of Wg expression at R0 (Fig 3D and 3E) but not at R24 (Fig 3F). After ablation, Myc expression is elevated in the regenerating tissue [23] (Fig 3G and 3H). brat¹/+ discs showed significantly higher levels of Myc at R0, which were sustained through R24 (Fig 3I–3K). Thus, being heterozygous mutant for brat caused an increase in the levels of both Wg and Myc early in regeneration. The elevated expression of these growth regulators likely explains the high proliferation seen in brat¹/+ discs at R0, and the larger wing pouch at R48.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. brat¹/+ animals experience elevated regeneration signaling.

(A) Anti-Wg immunostaining in an undamaged control (w¹¹¹⁸) disc. (B) Anti-Myc immunostaining in an undamaged control (w¹¹¹⁸) disc. (C-D) Anti-Wg immunostaining in an R0 control (w¹¹¹⁸) disc (C) and an R0 brat¹/+ disc (D). (E) Quantification of Wg fluorescence intensity in R0 control (w¹¹¹⁸) (n = 13) and R0 brat¹/+ (n = 17) discs. *** p < 0.0006. (F) Quantification of Wg fluorescence intensity in R24 control (w¹¹¹⁸) (n = 12) and R24 brat¹/+ (n = 11) discs. Area for fluorescence intensity measurement was defined by the Wg expression domain in the wing pouch. (G-J) Anti-Myc immunostaining in an R0 control (w¹¹¹⁸) disc (G), an R24 control (w¹¹¹⁸) disc (H), an R0 brat¹/+ disc (I) and an R24 brat¹/+ disc (J). (K) Quantification of Myc fluorescence intensity in R0 control (w¹¹¹⁸) (n = 13), R0 brat¹/+ (n = 12), R24 control (w¹¹¹⁸) (n = 13), and R24 brat¹/+ (n = 12) discs. Area for fluorescence intensity measurement was defined by the elevated Myc expression domain in the wing pouch. R0 *** p < 0.0003, R24 *** p < 0.0001. Error bars represent SEM. Student’s T-test used for statistical analyses. Scale bars are 100 μm.

https://doi.org/10.1371/journal.pgen.1011103.g003

brat is required for margin cell-fate specification during regeneration

Reduction of brat during regeneration caused patterning defects specifically at the wing margin, resulting in the loss of vein at the margin and loss of sensory bristles (Fig 1G). Thus, brat is required for correct cell-fate specification at the DV boundary during regeneration. The wing imaginal disc is divided into the dorsal and the ventral compartments, with expression of the LIM-homeodomain protein Apterous (Ap) in dorsal cells. The juxtaposition of the dorsal and ventral cells forms the DV boundary, which develops into the adult wing margin [65] (Fig 4A). Notch (N) and Wg signaling at the DV boundary are crucial for the correct organization and cell-fate specification at the boundary [66]. cut (ct) and achaete (ac) are margin-specific genes that are expressed downstream of N and Wg signaling. ct is required for the specification of the wing margin, and ac specifies the pro-neural sensory organ precursors [66,67] (Fig 4A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Brat regulates margin cell-fate specification.

(A) Drawings of a wing imaginal disc and an adult wing. D = dorsal and V = ventral compartments of the wing disc, with the dorsoventral boundary marked in purple. Notch signaling and Cut expression are present at the dorsoventral boundary, which forms the adult wing margin, also marked in purple. Achaete-expressing cells, marked in green, give rise to the sensory bristles at the anterior half of the margin in the adult wing, also marked in green. (B) ap-lacZ expression in an undamaged control disc from a third-instar ap-lacZ/CyO animal. (C-D) ap-lacZ expression in an R24 control (w¹¹¹⁸) disc (C) and an R24 brat¹/+ disc (D). (E-F) NRE-GFP expression in an undamaged control (w¹¹¹⁸) disc (E) and an undamaged brat¹/+ disc (F). (G-J) NRE-GFP expression in an R0 control (w¹¹¹⁸) disc (G), an R24 control (w¹¹¹⁸) disc (H), an R0 brat¹/+ disc (I) and an R24 brat¹/+ disc (J). (K-L) Anti-Ct immunostaining in an undamaged control (w¹¹¹⁸) disc (K) and an undamaged brat¹/+ disc (L). (M-O) Anti-Ct immunostaining in an R72 control (w¹¹¹⁸) disc (M) and an R72 brat¹/+ discs (N-O). Arrowheads point to loss of Ct expression in (O). (P-Q) Anti-Ac immunostaining in an undamaged control (w¹¹¹⁸) disc (P) and an undamaged brat¹/+ disc (Q). (R-S) Anti-Ac immunostaining in an R72 control (w¹¹¹⁸) disc (R) and an R72 brat¹/+ disc (S). Scale bars are 100 μm.

https://doi.org/10.1371/journal.pgen.1011103.g004

To investigate whether the errors in fate specification seen in brat¹/+ discs were due to a compromised compartment boundary, we examined the expression of Ap using the ap-lacZ reporter. ap-lacZ expression showed a clear DV boundary in the undamaged control discs (Fig 4B). The DV boundary remained intact after ablation in control and brat¹/+ discs (Figs 4C, 4D, S4A and S4B). ap-lacZ expression was also seen in the debris found in the damaged wing imaginal disc, due to the perdurance of β-gal. Wg expression was restored to its normal DV expression by R48 in both control and brat¹/+ discs (S4C and S4D Fig), and overexpression of Wg did not cause margin defects (S3F Fig). Therefore, the patterning defects were not caused by disruptions in the DV boundary or changes in Wg expression.

Next, we examined N signaling in brat¹/+ discs due to its critical role in specifying fates at the DV boundary. We used a N signaling reporter, which uses Notch Response Elements (NREs) that bind to the Notch co-receptor Suppressor of Hairless, to drive the expression of GFP [68]. No difference was detected in the expression of the N reporter in undamaged control and brat¹/+ discs (Fig 4E and 4F). N signaling at the DV boundary was restored by R24 in controls and continued at R48 (Fig 4G and 4H). Note that the reporter signal can also be seen in cellular debris in the regenerating discs due to the perdurance of GFP. Interestingly, brat¹/+ discs showed elevated levels of the N signaling reporter at both these time points (Fig 4I and 4J). This result is consistent with recent evidence demonstrating Brat’s ability to attenuate N nuclear transport in the brain [69]. We wondered whether this elevated N signaling could also disrupt margin fates. However, overexpressing the N-intracellular domain in the wing pouch during the 24-hour ablation period (S4E and S4F Fig) resulted in adult wings that were patterned remarkably well, with significantly fewer wings showing any margin defects when compared to the control (S4G Fig). Thus, increased N activity during regeneration suppresses margin defects. Additionally, decreasing N signaling activity in brat¹/+ regenerating discs by using a mutation in the anterior pharynx defective 1 (aph-1) gene was unable to rescue the brat heterozygous phenotype. aph-1^D35/+ discs showed significantly reduced N signaling during normal development (S4H–S4J Fig) and at R24 during regeneration (S4K–S4M Fig), but could not rescue the loss of margin phenotype in the brat mutant (S4N Fig). Thus, while Brat constrains N signaling during regeneration, the elevated N signaling in brat¹/+ mutants does not cause the margin cell-fate specification defects.

To determine whether the loss of margin cell fates was due to apoptosis of those cells later in regeneration, we immunostained regenerating discs for the cleaved caspase Dcp-1 as a marker of cell death, and Wg to mark the margin. We did not observe dying cells in the margin in either control or brat¹/+ regenerating discs (S4C and S4D Fig).

brat specifies margin fate by controlling the expression of Cut and Achaete

To understand how patterning was disrupted in brat¹/+ regenerating discs, we examined expression of margin cell-fate genes. Cut (Ct) expression was present along the DV boundary in both undamaged control and brat¹/+ discs (Fig 4K and 4L), consistent with our results showing that adult undamaged brat¹/+ wings do not have margin defects (S1D Fig). In control regenerating discs, Ct expression was detected at the DV boundary at R72, which is when regeneration and repatterning are largely complete (Fig 4M). By contrast, Ct expression was either not observed in brat¹/+ discs or was still missing in segments of the DV boundary at R72 (Fig 4N and 4O). These results indicate a specific error in cell-fate specification, as the DV boundary was intact at R72 (S4A and S4B Fig). Undamaged control and brat¹/+ discs also showed appropriate Ac expression in two stripes of cells directly flanking the DV boundary in the anterior half of the disc (Fig 4P and 4Q). Ac expression was also detected in control regenerating discs at R72 (Fig 4R). While Ac-expressing cells appeared in brat¹/+ discs, they were not clearly separated across the DV boundary (S4 Fig). This finding is consistent with previous reports showing that Ct suppresses Ac at the margin, and mutations in ct lead to aberrant expression of Ac at the DV boundary, followed by degeneration of the wing margin and loss of the developing sensory bristles between 24 and 36 hours after puparium formation [70,71].

High Myc expression perturbs margin cell-fate specification during regeneration

Our results show that Brat both restricts regenerative growth and ensures correct cell-fate specification at the wing margin, but it was unclear whether these phenomena were linked. Interestingly, we have previously shown that a pro-regeneration signal can have deleterious effects on cell fate, and that the regenerating tissue deploys a protective factor to minimize regeneration-induced cell-fate disruption. JNK signaling in regenerating tissue can cause aberrant posterior-to-anterior cell-fate changes, which can be suppressed by a regeneration-specific protective factor, Taranis, to ensure correct patterning of the regenerating tissue [32]. Therefore, we wondered whether unconstrained regenerative growth, or unconstrained expression of growth drivers, could also have deleterious side effects such as loss of margin cell fates. We have ruled out elevated N signaling as the causative factor for the cell-fate errors that occurred in brat¹/+ regenerating discs (S4 Fig). Furthermore, overexpression of wg or ilp8 did not cause margin defects (S3F and S3G Fig). Therefore, we wondered whether high Myc levels caused by reduced Brat could cause the margin defects.

Brat overexpression can suppress Myc in wing imaginal disc cells [56], and in undamaged wing discs Brat protein levels were elevated at the DV boundary where Myc was reduced (Fig 5A and 5A’), suggesting that Brat may regulate Myc at the DV boundary. Furthermore, our results showed that regenerating brat/+ mutant discs experienced elevated Myc levels compared to controls (Fig 3G–3K). Previous studies demonstrated that Brat regulates Myc at the post-transcriptional level [56]. To confirm that Brat is also regulating myc post-transcriptionally during regeneration, we measured myc transcript levels through qPCR. Regenerating discs showed significantly increased transcription of myc compared to undamaged controls. However, there was no significant difference in myc transcript levels between regenerating control and brat¹/+ discs at R0 and R24 (Fig 5B and 5C), indicating that Brat’s regulation of Myc must be post-transcriptional.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. High Myc expression causes margin defects.

(A-A’) Anti-Myc and Anti-Brat co-immunostaining in an undamaged control disc. rnGAL4, GAL80^ts/attP2 animals were shifted to 30°C on day 7 AEL and dissected 24 hours later. (B-C) Relative expression levels of myc for undamaged control, regenerating control (w¹¹¹⁸), and regenerating brat¹/+ discs at R0 (B) and R24 (C). P values for comparison between regenerating control and brat¹/+ discs: p > 0.1 at R0, and p > 0.3 at R24. (D-E) Anti-Myc immunostaining in an R0 control (w¹¹¹⁸) disc (D) and an R0 UAS-Myc/+ disc (E). (F) Quantification of Myc fluorescence intensity in R0 control (w¹¹¹⁸) (n = 13), R0 UAS-Myc/+ (n = 12), R24 control (w¹¹¹⁸) (n = 13), and R24 UAS-Myc/+ (n = 12) discs. Area for fluorescence intensity measurement was defined by the elevated Myc expression domain in the wing pouch. *** p = 1.2E-11. (G-H) Anti-PH3 immunostaining in an R0 control (w¹¹¹⁸) disc (G), and an R0 UAS-Myc/+ disc (H). The yellow dashed lines outline the Nubbin-expressing wing pouch. (I) PH3-positive nuclei were counted within the regenerating wing pouch as marked by Anti-Nubbin co-immunostaining. Quantification of PH3-positive nuclei in the Nubbin area for R0 control (w¹¹¹⁸) (n = 15) and UAS-Myc/+ (n = 15) discs. *** p < 0.00002. (J) Adult control (w¹¹¹⁸) wing after disc regeneration. (K) Adult UAS-Myc/+ wing after disc regeneration. (L) Frequency of margin defects, as quantified in Fig 1H, seen in adult wings after disc regeneration for control (w¹¹¹⁸) (n = 134), brat¹/+ (n = 193) and UAS-Myc/+ (n = 200) wings, from three independent experiments. (M-N) ap-lacZ expression in an R24 control (w¹¹¹⁸) disc (M) and an R24 UAS-Myc/+ disc (N). (O-P) Anti-Ct immunostaining in an R72 control (w¹¹¹⁸) disc (O) and an R72 UAS-Myc/+ disc (P). (Q) Adult undamaged control (+; rnGAL4,GAL80ts/+) wing from animals shifted to 30°C on day 7 AEL and maintained at 30°C until eclosion. (R) Adult wing from discs continuously overexpressing Myc from day 7 AEL onwards (UAS-Myc/+; rnGAL4, GAL80ts/+). (S) Quantification of Myc fluorescence intensity in undamaged discs dissected 31 hours after animals were shifted to 30°C on day 7 AEL. Control (+; rnGAL4,GAL80ts/+) (n = 14) and UAS-Myc (UAS-Myc/+; rnGAL4, GAL80ts/+) (n = 14). Area for fluorescence intensity measurement was defined by the Myc expression domain in the wing pouch. *** p = 1.2E-11. (T-U) Anti-Myc immunostaining in an undamaged control disc (T) and an undamaged UAS-Myc/+ disc (U). (V-W) Anti-Ct immunostaining in an undamaged control disc (V) and an undamaged UAS-Myc/+ disc (W). Error bars represent SEM. Student’s T-test used for statistical analyses. Scale bars are 100 μm. Scale bars for adult wings are 0.5 mm.

https://doi.org/10.1371/journal.pgen.1011103.g005

To test whether the elevated Myc protein levels could cause margin defects during regeneration and phenocopy the brat mutation, we overexpressed Myc in the wing pouch during the 24-hour ablation period. Myc was highly upregulated at R0 (Fig 5D–5F), but Myc levels had returned to normal by R24 (Fig 5F). Overexpression of Myc also resulted in a significantly higher number of proliferating nuclei in the regenerating tissue at R0, similar to brat¹/+ discs (Fig 5G–5I). Remarkably, we observed that adult wings resulting from Myc-overexpressing regenerating discs also showed margin defects similar to the brat¹/+ wings (Fig 5J and 5K). Moreover, the frequency of margin defects in the adult wings resulting from Myc-overexpressing regenerating discs was even higher than in adult wings resulting from brat¹/+ regenerating discs (Fig 5L). This difference in severity of phenotype correlates with levels of Myc at R0; in brat¹/+ regenerating discs Myc levels are higher than the control by 1.4 and 1.5-fold at R0 and R24 respectively (Fig 3K), and in Myc-overexpressing regenerating discs, Myc levels are higher than control by 2.75 fold at R0 but become similar to controls by R24 (Fig 5F). Thus, elevated levels of Myc alone can cause errors in margin cell-fate specification during regeneration. Similar to brat¹/+ discs, ap-lacZ expression showed that the compartment boundary was not compromised in Myc-overexpressing regenerating discs (Fig 5M and 5N). However, Ct expression was missing in segments at the DV boundary as in the brat¹/+ discs (Fig 5O and 5P).

Overexpressing Myc for a 24-hour window during normal development resulted in 3 adult wings out of 730 that showed any margin defects (S5A Fig). Even in these wings, only one segment of the margin was affected. To rule out the possibility that transient overexpression of Myc during development may not be sufficient to perturb patterning, we overexpressed Myc continuously after the animals entered the third instar larval stage. Continuous Myc overexpression proved to be lethal for many animals. While the flies that survived had significantly smaller wings, the margins showed no defect (Fig 5Q and 5R). 31 hours of Myc overexpression during normal development showed significantly higher Myc protein levels (Fig 5S–5U) but did not interfere with Ct expression (Fig 5V and 5W). These data indicate that high Myc levels do not cause cell-fate specification errors during normal development, and the extensive loss of wing margin induced by high Myc expression is a regeneration-specific phenotype.

Loss of Myc expression also perturbs margin cell-fate specification during regeneration

We hypothesized that if the brat phenotype was due to elevated Myc levels, we would be able to rescue the phenotype by reducing Myc levels in the brat mutant. For this purpose, we used dm⁴, which is a null allele of Myc [72]. Surprisingly, we observed that the dm⁴/+ mutants alone showed margin defects in the regenerated wings at a frequency similar to brat¹/+, even though the dm⁴/+; brat¹/+ double mutant showed slightly reduced frequency of margin defects (S5B Fig). To confirm that Myc levels were reduced in the dm⁴/+ mutants, we quantified Myc protein through immunostaining. We observed that there was no significant difference in Myc expression levels between the dm⁴/+ mutant and control, both during development and regeneration (S5C and S5D Fig). Indeed, Myc levels were trending higher in the dm⁴/+ discs during regeneration, perhaps accounting for the margin defects. The failure of the dm⁴ mutation to reduce Myc levels could be due to compensatory expression of the functional copy of the Myc locus. We next tried reducing Myc levels though RNAi. Despite the RNAi expression being transient in our system, and only occurring in cells that survive ablation, RNAi-mediated persistent knockdown has worked for multiple genes, likely due to the shadow RNAi effect [73]. Two RNAi lines could significantly reduce Myc levels during normal development when expressed during early third instar (S5E Fig). However, when Myc RNAi was expressed during the 24-hour ablation period, Myc levels were not reduced at either R0 or R24, with one Myc RNAi line showing significantly higher levels of Myc compared to the control (S5F Fig).

To reduce Myc levels without the possibility of compensatory expression from an endogenous allele, we turned to the viable hypomorphic allele Myc^P0, which is reported to eliminate Myc mRNA in the wing pouch [74]. Indeed, we found that male larvae hemizygous for Myc^P0 did not show the typical Myc expression in third-instar wing discs, and lacked upregulation of Myc during regeneration (S5G and S5H Fig). The Myc^P0 males developed more slowly than control larvae, so we adjusted the timing of induction of ablation later by 4 hours to coincide with the early third instar larval phase. Surprisingly, we found that Myc^P0 males that had undergone ablation and regeneration in the wing discs also had adult wings that were missing substantial sections of their margins, as did Myc^P0; brat¹/+ double mutants (S5I Fig). Indeed, immunostaining Myc^P0 regenerating discs showed gaps in cut expression, indicating disruption of margin fate (S5J and S5K Fig). Therefore, reduction of Myc as well as elevation of Myc disrupts margin cell fate during regeneration, underscoring the importance of tightly regulating expression of this pro-regeneration, pro-growth factor. However, this phenotype means that rescuing the brat¹/+ phenotype by reducing Myc is not possible, given that reducing Myc alone disrupts the wing margin, and we cannot rule out the possibility that other Brat targets in addition to Myc contribute to the patterning defects in brat¹/+ regenerated wings. Importantly, animals that overexpressed Myc in the wing pouch during ablation did not undergo a regeneration-induced pupariation delay (S5L Fig), confirming that Brat regulates the entry into metamorphosis independently of its regulation of Myc. Therefore, not all effects of reduced Brat are mediated through Myc.

Enhanced proliferation does not disrupt margin cell-fate specification during regeneration

Myc is an important driver of regenerative growth, and yet, we found that cell-fate specification during regeneration can be negatively affected if Myc is overexpressed. To test whether the aberrant patterning was a specific result of high Myc levels or whether increases in growth and proliferation could, in general, cause margin defects, we also increased proliferation during regeneration by overexpressing both cyclinE (cycE) and string (stg).

Overexpressing the cell cycle genes in the wing imaginal disc during the 24-hour ablation period caused the resulting adult wings to be much larger than controls that had also undergone damage and regeneration (Fig 6A), though not larger than a normal wing. Increased proliferation was confirmed through quantification of mitotic cells (Fig 6B). The accompanying increase in pupariation delay appeared less than that induced by reduction of Brat, making the enhanced regeneration even more remarkable (Fig 6C). Intriguingly, we did not observe many margin defects for wings that had experienced cycE and stg overexpression during regeneration (Fig 6D–6F). Furthermore, we have not observed this loss of margin phenotype with overexpression of other pro-regeneration genes such as wg or ilp8 (S3F and S3G Fig). Thus, pattern disruption during regeneration appears to be specifically associated with Myc overexpression and does not appear to be caused by increased proliferation alone.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Overexpression of cell cycle genes does not cause patterning defects.

(A) Adult wing sizes observed after disc regeneration for control (w¹¹¹⁸) (n = 280) and UAS-cycE, UAS-stg/+ (n = 194) wings, from three independent experiments. (B) Pupariation rates after disc regeneration for control (w¹¹¹⁸) (n = 174) and UAS-cycE, UAS-stg/+ (n = 115) wings, from three independent experiments. (C) Quantification of mitotic cells positive for anti-PH3 immunostaining in the Nubbin-expressing area of regenerating wings discs at R0. Control n = 15, UAS-cycE, UAS-stg n = 15. ***p = .0001. (D) Adult control (w¹¹¹⁸) wing after disc regeneration. (E) Adult UAS-cycE, UAS-stg/+ wing after disc regeneration. (F) Frequency of margin defects seen in adult wings after disc regeneration for control (w¹¹¹⁸) (n = 118), UAS-Myc/+ (n = 146), and UAS-cycE, UAS-stg/+ (n = 188) wings, from three independent experiments. Error bars represent SEM. Scale bars for adult wings are 0.5 mm.

https://doi.org/10.1371/journal.pgen.1011103.g006

Loss of cell-fate specification may be due to misregulation of Myc target genes

Given that driving growth by overexpressing Cyclin E and String does not cause loss of wing margin cell fates in regenerating tissue, this phenotype might be caused by misregulation of one or more targets of the Myc transcription factor. To identify genes that may regulate margin cell fate downstream of Myc, we screened through genes reported in the literature as regulating ct expression, and identified one that was misregulated in brat¹/+ and UAS-Myc regenerating discs. We have previously identified the gene Chronologically inappropriate morphogenesis (chinmo) as a novel regulator of regeneration [50]. Chinmo is a transcription factor that regulates the balance between a proliferative self-renewal state and a differentiated state in stem cells [75,76]. Recent work has shown that chinmo also maintains wing epithelial cells in an unspecified state during development by inhibiting ct expression, and enhances regenerative potential [77]. Therefore, we included chinmo in our targeted screen for genes that are misregulated in the brat¹/+ or UAS-Myc regenerating discs and that contribute to the disruption of cell fate.

Several lines of evidence suggest that chinmo can be a transcriptional target of Myc. First, the model organism Encyclopedia of Regulatory Networks (modERN) data show Myc binding near the chinmo promoter [78]. Second, ChIP-seq experiments in Drosophila embryonic Kc cells have shown that Myc does indeed bind to the chinmo locus [79]. Finally, chinmo levels are upregulated in response to elevated Myc expression in wing imaginal discs [80]. To determine whether chinmo expression was altered in brat¹/+ wing discs, we immunostained for Chinmo protein. Chinmo levels were not significantly different in undamaged control and brat¹/+ discs (Fig 7A, 7B and 7E). However, Chinmo levels were significantly higher in brat¹/+ regenerating discs compared to control regenerating discs at R24 (Fig 7C, 7D and 7F). To confirm regulation of chinmo downstream of Myc, we examined Chinmo levels in regenerating discs over-expressing Myc. Chinmo levels were elevated in Myc-overexpressing discs at R0, when Myc overexpression was the highest (Figs 5F and 7G–7I). However, Chinmo levels were restored to control levels by R24 in Myc-overexpressing discs, consistent with the return of Myc levels to normal at this time point (Figs 5F and S6A–S6C). Interestingly, Myc and Chinmo expression almost perfectly co-localized, consistent with the hypothesis that Myc regulates Chinmo expression (S6A–S6B”’ Fig). Additionally, we observed a high correlation between Myc and Chinmo expression levels in individual discs (S6D and S6E Fig). Undamaged discs overexpressing Myc did not show elevated Chinmo levels (S6F–S6H Fig), possibly explaining why Myc overexpression during normal development did not cause margin defects.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Chinmo levels are elevated in brat¹/+ and Myc-overexpressing regenerating discs.

(A-B) Anti-Chinmo immunostaining in an undamaged control (w¹¹¹⁸) disc (A) and an undamaged brat¹/+ disc (B). (C-D) Anti-Chinmo immunostaining in an R24 control (w¹¹¹⁸) disc (C) and an R24 brat¹/+ disc (D). (E) Quantification of Chinmo fluorescence intensity in undamaged control (w¹¹¹⁸) (n = 11) and undamaged brat¹/+ (n = 10) discs. p = 0.16 (F) Quantification of Chinmo fluorescence intensity in R24 control (w¹¹¹⁸) (n = 13) and R24 brat¹/+ (n = 14) discs. p < 0.006. Area for fluorescence intensity measurement was defined by the elevated Chinmo expression domain in the wing pouch. (G) Merge of anti-Nubbin, anti-Myc and anti-Chinmo immunostaining in an R0 control (w¹¹¹⁸) disc. (G’-G”) Same disc as (G) showing anti-Myc and anti-Chinmo immunostaining, respectively. (H) Merge of anti-Nubbin, anti-Myc and anti-Chinmo immunostaining in an R0 brat¹/+ disc. (H’-H”) Same disc as (H) showing anti-Myc and anti-Chinmo immunostaining, respectively. (I) Quantification of Chinmo fluorescence intensity in R0 control (w¹¹¹⁸) (n = 10) and R0 UAS-Myc/+ (n = 11) discs. p < 0.02. Area for fluorescence intensity measurement was defined by the elevated Myc expression domain in the wing pouch. (J-K) Anti-Cut immunostaining in control (J) and UAS-chinmo (K) R72 discs. Arrowhead shows missing Cut expression in K. (L) Margin tissue lost as a percentage of total wing perimeter for control (w¹¹¹⁸) (n = 69), chinmo¹/+ (n = 26), UAS-Myc/+ (n = 107), and UAS-Myc/+; chinmo¹/+ (n = 55) wings. ****p = 9.11E-05. Error bars represent SEM. Student’s T-test used for statistical analyses. Scale bars are 100 μm.

https://doi.org/10.1371/journal.pgen.1011103.g007

While chinmo mRNA can be a direct Brat target [39], chinmo is regulated at the level of transcription in the wing imaginal disc [77]. To confirm the absence of regulation of chinmo mRNA by Brat during regeneration, we assessed expression of mCherry from a transgene in which the chinmo UTRs were fused to the mCherry coding region to serve as a reporter for chinmo mRNA regulation (UAS-mCherry-chinmoUTR) [77]. We did not detect any change in mCherry levels in brat¹/+ regenerating discs compared to control regenerating discs, indicating that reduction of Brat does not impact the chinmo mRNA reporter and Brat does not likely regulate chinmo mRNA in regenerating discs (S6I Fig).

Thus, the loss of ct expression and loss of margin cell fates in brat/+ regenerating discs and UAS-Myc regenerating discs may be due, at least in part, to upregulation of Myc targets, including chinmo. Importantly, other unidentified Myc targets likely also contribute to ct misregulation in regenerating discs with reduced Brat or overexpressed Myc. To test whether expression of chinmo in the regeneration blastema is sufficient to disrupt the margin, we expressed UAS-chinmo alongside the ablation system. Doing so led to a moderate level of gaps in cut expression in R72 regenerating discs (4/14 compared to 0/12 for controls) (Fig 7J and 7K). To test whether the loss of margin in regenerating wing discs overexpressing Myc is due at least in part to expression of chinmo, we asked whether the phenotype could be ameliorated by a chinmo mutation. Indeed, regenerating wing discs overexpressing Myc but heterozygous for chinmo¹ had significantly less margin loss in the resulting adult wings compared to those just overexpressing Myc (Fig 7L). Thus, we have identified at least one Myc target that contributes to disruption of cell fate in regenerating tissue with Myc expression elevated beyond what is normally found in the regeneration blastema.

We also tested whether reduction of Chinmo expression could partially rescue the brat heterozygous phenotype in adult wings and the impaired return of Ct expression at R72. This experiment did not provide a conclusive answer, as it resulted in too few adult wings large enough to quantitate margin defects, likely because chinmo heterozygotes regenerate poorly. We were able to quantitate return of Ct expression at R72, and found that reduction of Chinmo led to an increase in the percentage of discs with strong Ct expression, which could suggest a partial rescue, but also an increase in discs with no Ct expression (S6J Fig). The average percentage of the margin that expressed Ct was not statistically different when comparing brat¹/+ to brat¹/+, chinmo¹/+ R72 discs (S6K Fig). Therefore, reduction of chinmo expression did not rescue the brat¹/+ margin defect phentotype as assessed by cut expression in the regenerating disc.

Based on our findings, we propose a model in which pro-growth factors are important for coordinating regenerative growth, but can lead to deleterious side effects by perturbing cell-fate gene expression and patterning. Brat prevents a prolonged proliferative and unspecified state in regenerating wing discs by constraining Wg, Ilp8, Myc, and Myc targets, to enable cessation of growth, induction of cell-fate specification, and entry into metamorphosis (Fig 8).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. Brat restricts pro-regeneration factors and ensures correct margin cell-fate specification.

Model describing the network of Brat targets in the regenerating wing imaginal disc. Importantly, Brat restricts Myc levels, limiting regenerative growth. Elevated Myc levels can result in expression of Myc targets, including Chinmo, which disrupt margin cell-fate specification.

https://doi.org/10.1371/journal.pgen.1011103.g008

Ablation and regeneration experiments

Ablation experiments were done as previously described [32]. Briefly, cell death was induced by driving UAS-reaper under rotund-GAL4, with GAL80^ts for temporal control. Eggs were collected over the course of four hours and animals were raised at 18°C for 7 days after egg lay (AEL) (early third instar as determined by mouth hooks) before they were shifted to a 30°C circulating water bath for 24 hours. Animals were brought back to 18°C to allow regeneration. Wing discs were dissected at different time points after the end of ablation, or the animals were allowed to grow to adulthood to observe the adult wing phenotype. Undamaged control wing discs were the same genotype as the experimental animals but kept at 18°C and dissected on day 9 after egg lay, which is mid-late third instar. For undamaged adult wings, the animals were kept at 18°C until after eclosion. Any other undamaged conditions used are mentioned specifically in the Fig legends.

Fly stocks

The following Drosophila stocks were used: w¹¹¹⁸ (wild type) [93], w¹¹¹⁸; rnGAL4, UAS-rpr, tubGAL80ts/TM6B,tubGAL80 [23], brat¹ [52](RRID:BDSC_3988), brat¹⁹² and brat¹⁵⁰ [54](a gift from Juergen Knoblich, Austrain Academy of Science), brat¹¹ [55](a gift from Chen-Yu Lee, University of Michigan), Df(2L)Exel8040 [94](RRID:BDSC_7847), Df(2L)TE37C-7 [53](RRID:BDSC_6089), rnGAL4, tubGAL80ts/TM6B [23], P{Trip.HM05078}attP2 (called bratRNAi in the text)(RRID:BDSC_28590), P{CaryP}attP2 (called attP2 control in the text)(RRID:BDSC_36303), {PZ}ap^rK568 [95](RRID:BDSC_5374), NRE-GFP [68](RRID:BDSC_30727), UAS-Nintra (a gift from Gary Struhl, Columbia University), aph-1^D35 [96](RRID:BDSC_63242), UAS-Myc [74](RRID:BDSC_9674), UAS-cycE, UAS-stg (a gift from Laura Buttitta, University of Michigan), dm⁴ [72], P{GD1419}v2947 (called MycRNAi#1 in the text)(VDRC ID# 2947) and P{GD1419}v2948 (called MycRNAi#2 in the text)(VDRC ID# 2948), P{GD6000}v15293 (called control in the text) (VDRC ID# 15293), Myc^P0 [74] (RRID:BDSC_11298), UAS-mCherry^chinmoUTRs [75,76], chinmo¹ [97] (RRID:BDSC_59969), UAS-wg (RRID:BDSC_5918), UAD-dilp8 [59](a gift from Maria Dominguez). All fly stocks are available from the Bloomington Drosophila Stock Center unless stated otherwise.

Pupariation timing

Pupariation experiments were performed in a similar manner to the ablation experiments. Starting at day 9, newly formed pupal cases were counted in each vial. Pupal cases were counted every 24 hours, up until day 15. Pupariation rates from three independent experiments were used to calculate the average plotted in the graphs.

Immunohistochemistry

Immunostaining was carried out as previously described [23], with a single batch of antibody diluted in buffer generated for each experiment to ensure equal concentrations across samples for which immunostaining was quantified. Primary antibodies were rat anti-Brat (1:200) [37] (a gift from Robin Wharton, Ohio State University), mouse anti-Nubbin (1:500) [98] (a gift from Steve Cohen, University of Copenhagen) and 1:100 (The Developmental Studies Hybridoma Bank [DSHB]), rabbit anti-Phospho-Histone H3 (1:500) (Millipore), mouse anti-Wingless (1:100) (DSHB), rabbit anti-dMyc (1:500 or 1:250) (Santa Cruz Biotechnologies), mouse anti-βgal (1:100) (DSHB), mouse anti-Cut (1:100) (DSHB), mouse anti-Achaete (1:10)(DSHB), rat anti-Chinmo (1:500) (a gift from Nick Sokol, Indiana University), and anti-cleaved Dcp-1 (1:250)(Cell Signaling #9578). The Developmental Studies Hybridoma Bank (DSHB) was created by the NICHD of the NIH and is maintained at the University of Iowa, Department of Biology, Iowa City, IA 52242.

Secondary antibodies were AlexaFluor probes (1:1000) (Life Technologies). DNA was marked using TO-PRO3 (1:500) (Life Technologies) or DAPI (1:5000 of 0.5 mg/mL stock) (Sigma). Discs were mounted in Vectashield mounting medium (Vector Laboratories).

EdU incorporation was carried out as previously described [99] using a Click-iT EdU kit C10338 (Invitrogen), with the following changes. Larvae were dissected in PBS and incubated in Schnieder’s medium. EdU was used at a working concentarion of 100 μM.

Discs were imaged on a Zeiss LSM 510, Zeiss LSM 700, or a Zeiss LSM 880 confocal microscope. Parameters for imaging were identical for quantified images. Images were processed using ZEN lite (Zeiss), ImageJ (NIH) and Photoshop (Adobe). Maximum intensity projections were created for the confocal images. Fluorescence intensity was measured within the wing pouch as marked by anti-Nubbin or by using the morphology of the undamaged wing disc. Myc and Chinmo intensities were measured by outlining the region expressing elevated Myc or Chinmo levels. NRE-GFP intensity was measured by outlining the GFP-expressing region at the DV boundary. Any modifications to image bightness and contrast to assist visibility for publication were applied equally to all images from the same experiment.

Adult wing quantifications

Adult wings were mounted in Gary’s Magic Mount (Canada balsam [Sigma] dissolved in methyl salicylate [Sigma]). Images were taken with an Olympus SZX10 microscope with an Olympus DP21 camera using the CellSens Dimension software (Olympus) or with an Echo Revolve R4 microscope and camera.

All adult wings that were 75% or 100% the size of a normal wing were used to quantify the loss of the wing margin. The wing margin was divided into five segments defined by where the wing veins intersect the margin. Each wing was scored for the number of segments with missing margin to assess the extent of the patterning defect. Percentages from the three independent experiments were used to calculate averages plotted in the graphs. The area of undamaged and regenerated wings was measured using ImageJ (NIH). ImageJ was also used to measure the percentage of linear length of margin lost for the entire perimeter of the wing. Graphs were plotted using Excel and Graphpad Prism 7.

qPCR

For quantitative PCR (qPCR), 40–60 wing imaginal discs were collected in Schneider’s medium and stored at -80°C. RNA was extracted using the Qiagen RNeasy Mini Kit (#74104), and cDNA synthesis was performed using the Superscript III First Strand Synthesis kit (#11752–050). qPCR reactions using the Power SYBR Green MasterMix (ABI) were run on the ABI Step One Plus Real Time PCR System. The experiment consisted of 3 biological replicates. For each biological replicate there were three technical replicates. Gene expression was analyzed by the ΔΔC_t method and normalized to Gapdh2 expression. The following primers were used: Gapdh2 forward primer (GTGAAGCTGATCTCTTGGTACGAC), Gapdh2 reverse primer (CCGCGCCCTAATCTTTAACTTTTAC) [100], ilp8 primers used from Qiagen (QT00510552), dmyc forward primer (AACGATATGGTGGACGATGG), and dmyc reverse primer (CGGCAGATTGAAGTTATTGTAGC) [101]. For qPCR experiments undamaged controls were rnGAL4, tubGAL80ts/TM6B females crossed to w¹¹¹⁸ males and shifted to 30°C for 24 hours at 7 days AEL. Discs were dissected either immediately or 24 hours after shifting the animals back to 18°C for R0 and R24 time points, respectively.