Expression of Concern
The following concerns were raised about Figs 3 and 5 of this article [1]:
- In Fig 5Ac, lanes 2 and 3 appear similar.
- When levels are adjusted to visualize background, there is no visible evidence that Figs 3B, 3H and 5Bd FITC panels show the same fields of view as the corresponding white light microscopy (Fig 3) and Hoechst/Cy3/Merge (Fig 5Bd) panels.
Corresponding author YH stated that the original data underlying the results reported in this article are no longer available, and so the above issues cannot be resolved.
In addition, the study reports the use of “human normal hepatocyte L-02” cells in flow cytometry experiments shown in Fig 6B. Following the publication of this article [1], the L-02 cell line was identified as contaminated and shown to be a HeLa derivative instead [2]. Therefore, the results statements in [1] about effects of rCsseverin on human normal hepatocyte cells are not supported, although this may not critically impact the PLC cell results reported in Fig 6A.
The PLOS Neglected Tropical Diseases Editors issue this Expression of Concern to inform readers of these unresolved issues. Readers should interpret the results of the affected figures with caution.
19 Mar 2024: The PLOS Neglected Tropical Diseases Editors (2024) Expression of Concern: Molecular Characterization of Severin from Clonorchis sinensis Excretory/Secretory Products and Its Potential Anti-apoptotic Role in Hepatocarcinoma PLC Cells. PLOS Neglected Tropical Diseases 18(3): e0012043. https://doi.org/10.1371/journal.pntd.0012043 View expression of concern
Figures
Abstract
Background
Clonorchiasis, caused by the infection of Clonorchis sinensis (C. sinensis), is a kind of neglected tropical disease, but it is highly related to cholangiocarcinoma and hepatocellular carcinoma (HCC). It has been well known that the excretory/secretory products of C. sinensis (CsESPs) play key roles in clonorchiasis associated carcinoma. From genome and transcriptome of C. sinensis, we identified one component of CsESPs, severin (Csseverin), which had three putative gelsolin domains. Its homologues are supposed to play a vital role in apoptosis resistance of tumour cell.
Methodology/Principal Findings
There was significant similarity in tertiary structures between human gelsolin and Csseverin by bioinformatics analysis. We identified that Csseverin expressed at life stage of adult worm, metacercaria and egg by the method of quantitative real-time PCR and western blotting. Csseverin distributed in vitellarium and intrauterine eggs of adult worm and tegument of metacercaria by immunofluorence assay. We obtained recombinant Csseverin (rCsseverin) and confirmed that rCsseverin could bind with calciumion in circular dichroism spectrum analysis. It was demonstrated that rCsseverin was of the capability of actin binding by gel overlay assay and immunocytochemistry. Both Annexin V/PI assay and mitochondrial membrane potential assay of human hepatocarcinoma cell line PLC showed apoptosis resistance after incubation with different concentrations of rCsseverin. Morphological analysis, apoptosis-associated changes of mitochondrial membrane potential and Annexin V/PI apoptosis assay showed that co-incubation of PLC cells with rCsseverin in vitro led to an inhibition of apoptosis induced by serum-starved for 24 h.
Conclusions/Significance
Collectively, the molecular properties of Csseverin, a molecule of CsESPs, were characterized in our study. rCsseverin could cause obvious apoptotic inhibition in human HCC cell line. Csseverin might exacerbate the process of HCC patients combined with C. sinensis infection.
Author Summary
Clonorchis sinensis (C. sinensis) has afflicted more than 35 million people in world and approximately 15 million in China, creating a socio-economic burden in epidemic regions. The infection of C. sinensis is highly related to cholangiocarcinoma and hepatocellular carcinoma (HCC). It has been documented that excretory/secretory products of C. sinensis (CsESPs) involved in the pathogenesis of HCC. Csseverin, expressed at life stage of egg, metacercaria and adult worm, was a component of CsESPs. In the current study, we characterized the properties of Csseverin such as sequence signature, actin and calciumion binding activity. In addition, we demonstrated that Csseverin could cause apoptotic inhibition in spontaneously apoptotic human HCC cell line PLC cells by using morphological analysis, detection of the apoptosis-associated change of mitochondrial membrane potential (MMP) as well as Annexin V/PI apoptosis assay. Our study provided an exploratory sight view of mechanism involved in progress of carcinoma associated with the infection of C. sinensis and Csseverin might exacerbate the process of C. sinensis infected HCC patients.
Citation: Chen X, Li S, He L, Wang X, Liang P, Chen W, et al. (2013) Molecular Characterization of Severin from Clonorchis sinensis Excretory/Secretory Products and Its Potential Anti-apoptotic Role in Hepatocarcinoma PLC Cells. PLoS Negl Trop Dis 7(12): e2606. https://doi.org/10.1371/journal.pntd.0002606
Editor: John Pius Dalton, McGill University, Canada
Received: September 13, 2013; Accepted: October 28, 2013; Published: December 19, 2013
Copyright: © 2013 Chen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the National Key Basic Research and Development Project (973 project; No. 2010CB530000), the National Natural Science Foundation of China (No. 81101270 and No. 81171602), the National S & T Major Program (2012ZX10004-220), the Fundamental Research Funds for the Central Universities (NO. 3164015). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Clonorchis sinensis (C. sinensis) has been proven to be the causative agent of clonorchiasis, which is endemic in China, Korea and Vietnam [1], [2], [3]. As an important food-borne parasite, C. sinensis has afflicted more than 35 million people in world and approximately 15 million in China, creating a socio-economic burden in epidemic regions [4]. Most clonorchiasis cases are due to the consumption of raw freshwater fish containing infective C. sinensis metacercariae, which excyst in the duodenum until they grow into juvenile C. sinensis and then migrate into the bile ducts of their host [5], [6]. Both experimental and epidemiological evidence have implied that long-term infections with liver flukes lead to chronic pathological changes, including hepatomegaly, hepatic fibrosis, cholangitis, cholecystitis, adenomatous hyperplasia, and cholangiocarcinoma (CCA) [7], [8], [9]. Furthermore, C. sinensis was recently classified along as a Group I biological carcinogen by the World Health Organization [10], [11]. In endemic area of China, 16.44% of HCC patients were infected with C. sinensis, while 2.40% were infected in non-tumor patients. The OR value and 95% CI in HCC group were 8.00 and 4.34–14.92 [12], [13], [14], so that we should pay high attention to the relationship between primary hepatocellular carcinoma and the infection of C. sinensis. It has been well known that the excretory/secretory products of C. sinensis (CsESPs) can cause histopathological changes such as bile duct dilatation, inflammation and fibrosis, and adenomatous proliferation of the biliary epithelium [15]. In the present studies, from the published genome [16] and transcriptome [17], [18] of C. sinensis, we identified one component of CsESPs, Csseverin, which has three putative gelsolin domains.
The gelsolin superfamily is conserved in mammalian as well as in non-mammalian organisms and takes the leading role in controlling actin organization or actin filament remodeling. The family has some specific and apparently non-overlapping particular roles in several cellular processes, including cell motility, control of apoptosis and regulation of phagocytosis [19]. Initial evidence of anti-apoptotic effect of gelsolin was provided by the observation that a point mutation in mouse gelsolin confers on this protein tumor-suppressor activity against H-ras oncogene transformed NIH-3t3 cells [20], [21]. Direct evidence of the inhibitory role of gelsolin was provided by Ohtsu et al., who generated Jurkat transfectants expressing up to threefold gelsolin than wild-type cells. These transfectants exhibited a phenotype more resistant to apoptosis induced by several stimuli [22]. Moreover, it has been reported that human cytoplasmic gelsolin can prevent apoptotic mitochondrial changes such as mitochondrial membrane potential loss by binding to mitochondrial voltage-dependent anion channel (VDAC) [23].
Large-scale gene sequencing efforts have revealed gelsolin homologues in the majority of parasitic phyla [24], [25], [26], [27], [28]. In the current study, we presented for the first time the molecular characteristics of Csseverin. We described the detection of recombinant Csseverin (rCsseverin) binding to cytoskeletal actin filaments of human hepatocarcinoma PLC cells and investigated its potential anti-apoptotic role on PLC cells as an ingredient of CsESPs in vitro. The present study is a cornerstone for researches on biological characterization of Csseverin in the future. In addition, our work will provide an exploratory sight view of mechanism involved in progress of carcinoma associated with the infection of C. sinensis.
Materials and Methods
Ethics statement
C. sinensis flukes were isolated from naturally infected cats (Guangdong Province, China) for sample preparation. Animals in experiments were all purchased from animal center of Sun Yat-sen University and raised carefully in accordance with National Institutes of Health on animal care and the ethical guidelines. All experimental procedures were approved by the animal care and use committee of Sun Yat-sen University (Permit Numbers: SCXK(Guangdong) 2009-0011).
Cell culture
PLC and human normal hepatocyte L-02 cells were a gift from Dr. Wang Shutong and Dr. Xie wenxuan (the first affiliated hospital of Sun Yat-Sen University) and routinely cultured in high glucose DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and penicillin–streptomycin (100 units/ml) in 5% CO2 at 37°C. Serum-starved PLC were prepared by incubating the cells in high glucose DMEM medium at 37°C and 5% CO2 with fetal bovine serum deprivation for at least 24 h.
Sequence analysis of Csseverin
The gene (GenBank accession No. GAA30384.2) predicted encoding homologue of severin was screened from C. sinensis genome by blastx and Open Reading Frame (ORF) Finder program at NCBI (http://www.ncbi.nlm.nih.gov). The alignment of its deduced amino acid sequences with homologues from other species were analyzed and shown with Vector NTI. Proteomics bioinformatics tools such as Motif-Scan, InterPro-Scan and Swiss-Model were used to analyze the protein characteristics including physicochemical parameters, conserved domains and spatial structure. The phylogenetic tree was constructed online (http://www.ebi.ac.uk/Tools/clustalw/index.html).
Preparation of anti-Csseverin IgG
The ORF of severin was amplified using the following primers: sense: 5′- ATAGGATCCATGCCGGAGTACT -3′(underlined, BamHI) and antisense: 5′- CGCAAGCTTTCATTCGAGAACC-3′ (underlined, Hind III). The PCR was carried out for 32 cycles at 94°C for 45 s, 51°C for 45 s, and 72°C for 45 s, and extension for 10 min at 72°C after the last cycle in a DNA-Thermal Cycler (Biometra, Germany). PCR products were purified and digested with BamHI and Hind III, and then subcloned into prokaryotic expression vector 6×His tag pET28a(+) (Novagen, Germany). After digestion with BamHI and Hind III, the recombinant plasmid was confirmed by DNA sequencing and then transformed into E. coli, BL21 (Promega, USA). The expression of rCsseverin was induced by 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 5 h at 37°C. After induction, the bacteria were harvested by centrifuging at 4°C for 15 min at 8,000×g and suspended in lysis buffer (0.5 M NaCl, 20 mM Tris–HCl, 5 mM imidazole, pH 8.0), sonicated on ice, and centrifuged at 10,000×g for 15 min at 4°C. The fusion protein was batch-purified using His Bind Purification kit (Novagen, USA) and the eluted fractions containing rCsseverin were pooled and dialyzed with phosphate-buffered saline (10 mM phosphate buffer, 27 mM KCl, 137 mM NaCl, pH 7.4). Protein samples were subjected to 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by Coomassie brilliant blue G-250, the concentration was measured by a Bicinchoninic acid assay (BCA, Novagen, USA) according to manufacturer's instructions. Then, 100/50 µg of rCsseverin were mixed with an equal volume of incomplete Freund's adjuvant and injected subcutaneously to six-week-old male Sprague-Dawley (SD) rats (purchased for experiments under the Guide for the Care and Use of Laboratory Animals). Boost injections were given at 2 and 5 weeks after first injection. Anti-serum was collected at 1 week after the second booster, then aliquoted and stored in −80°C. Sera from naïve rats were also collected for using as control.
Western blotting
CsESPs and sera from CsESPs immunized rat were obtained by referring to previous study [29]. 10 µg of rCsseverin or CsESPs were subjected to 12% SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. Successively, the membranes were blocked with 1% bovine serum albumin in phosphate-buffered saline (PBS) overnight at 4°C, washed five times with PBS-0.05% Tween 20 (PBS-T, pH 7.4), and incubated with His-tag monoclonal antibody, sera from naïve rats, rCsseverin immunized rats, C. sinensis-infected rats or CsESPs immunized rats (1∶100 dilutions) followed by HRP-conjugated goat anti-mouse/rat IgG (Proteintech; dilution of 1∶2,000) at 37°C for 2 h. After adequately washing with PBS-T, the membrane was incubated with horseradish peroxidase (HRP)-conjugated goat anti-rat IgG in 1∶2000 dilutions (Proteintech, USA) at 37°C for 1 h. Detection was then carried out by enhanced chemiluminescence (ECL) method.
Expression level of Csseverin at life-stages of C. sinensis
Intact living adult worms were collected from biliary tracts of infected cats and washed extensively and gently in physiological saline to remove any contamination from hosts. Eggs and metacercariae were also collected as described previously [30], [31]. They were stored in sample protector (Takara) at −80°C for RNA/DNA extraction or 4% formaldehyde for immunofluorescence assay. Total RNA was extracted from each sample using TRIZOL reagent (Invitrogen, USA) according to manufacturer's instructions, and total RNA was treated with DNase (Promega, USA) to remove any contaminated DNA. Their total cDNA were obtained by the method of reverse transcription PCR by using Reverse Transcriptase XL (TaKaRa) and Oligo18 primer referred to the manuals. Severin RNA was detected with SYBR Premix Ex Taq Kit (TaKaRa, Japan) according to the manufacturer's protocol. Real-time PCR was conducted in the BIO-RADiQ5 instrument (BioRad, USA) using specific primers (sense: 5′-TACAGCACCGTGAAGTAGATGG-3′; antisense: 5′- CAGACCGTGACAGAGTAGCAGA-3′). β-actin from C. sinensis (GenBank accession No. EU109284) was used as an internal control [32], which was amplified with the primers (forward primer: 5′-ACCGTGAGAAGATGACGCAGA-3′, reverse primer: 5′-GCCAAGTCCAAACGAAGAATT-3′) designed by primer premier 5.0. The transcripts of Csseverin were detected using SYBR Premix Ex Taq Kit (TaKaRa, Japan) according to the manufacturer's protocol. PCR was carried out in a total volume of 20 µl, consisting of 2 µl cDNA, 10 µl SYBR Premix Ex Taq (2×), 0.4 µl Severin forward and reverse primer (10 µM), and 7.2 µl RNase-free distilled H2O. The real-time PCR program consisted of an initial denaturation step at 95°C for 30 s, 45 cycles of 95°C for 5 s, and 60°C for 20 s. The real-time PCR amplification was conducted in the BIO-RADiQ5 instrument (BioRad, USA). To complete the protocol, a melting curve was constructed using the following program: 95°C for 30 s, 65°C for 15 s, followed by increase to 95°C while continuously collecting fluorescence signal. Semiquantitative analysis as performed by the comparative 2−ΔΔCt method [33].
The total proteins of adult worms, metacercariae, and eggs were respectively homogenized in RIPA lysis buffer (containing 1 mM proteinase inhibitor PMSF, Biotech, USA) followed by centrifugation at 10,000×g for 15 min. 20 µg of total proteins from each life cycle stage were separated on SDS-PAGE (12% gel) and electro-transferred onto PVDF membrane. The membrane was blocked with 1% bovine serum albumin in PBS overnight at 4°C, washed with PBS-T, and incubated with anti-Csseverin rat serum (1∶100 dilutions) or pre-immune rat serum (1∶100 dilutions) at 37°C for 2 h. After extensively washing with PBS-T, the membrane was incubated with HRP-conjugated goat anti-rat IgG in 1∶2000 dilutions (Proteintech, USA) at 37°C for 1 h. Detection was then carried out by ECL.
Immunohistochemical localization of Csseverin in C. sinensis adults and metacercariae
Fresh adult worms and metacercariae of C. sinensis were fixed with 4% formaldehyde, embedded with paraffin wax, and sliced into 4-µm-thick sections. After dewaxing and dehydration, slides were blocked with goat serum overnight at 4°C, and incubated with anti-rCsseverin sera (1∶100 in 0.1% PBS-T) at room temperature for 2 h. Sera from naïve rats were used as a negative control. The slides were washed twice and incubated with goat anti-rat IgG labeled with red fluorescent Cyanine dye 3 (Cy3, Proteintech; 1∶400 in 0.1% PBS-T). Fluorescence microscopy was used in visualization of antibody staining.
Circular Dichroism (CD) measurements
As the protein contains a potential Ca2+-binding domain, Ca2+-binding will change its conformation of secondary structure which can be detected by CD [34], [35], [36]. CD measurements were carried out on a J-810 Circular Dichroism Spectrometer (Jasco, Japan) with the Jasco Spectra Manager software at room temperature. Three samples were assayed: purified rCsseverin in PBS, purified rCsseverin in PBS containing 1 µM CaCl2, and purified rCsseverin in PBS containing 1 µM EDTA to remove combined Ca2+ during expression of rCsseverin in bacteria and purification in solutions. Secondary structure was analyzed using Jasco Spectra Manager Secondary Structure Analysis program. Far-UV CD spectrum was acquired using a 0.2 mm path length cell at 0.2 nm intervals over the wavelength range from 190 to 250 nm. Three scaning values were averaged for each sample and were corrected by subtracting buffer contribution from parallel spectra in the absence of Csseverin. The concentration of Csseverin was kept at 1 µM in 10 mM sodium phosphate buffer pH 7.4 and then the CD data were converted to molar units.
Actin binding activity of rCsseverin
Gel overlay assay and immunocytochemistry were employed to investigate the actin binding activity of rCsseverin. F-actin (from rabbit muscle, 99% similar to human F-actin, Sigma-Aldrich) and its fragments digested with 0.25% trypsin (Sigma-Aldrich, USA) at 37°C for 1 h, were separated on 12% SDS-PAGE and electrophoretically transferred onto PVDF membranes. Membranes then were blocked with TBS-T (25 mM Tris-HCl, pH 7.2, 50 mM NaCl, 0.5% Tween-20) containing 5% BSA overnight at 4°C and washed (3 times, for 15 min each) in TBS-T. Then, membranes were incubated with 0.1 mg/ml rCsseverin in TBS-T for 1 h at room temperature. After washing extensively, membranes were incubated with anti-Csseverin rat serum (1∶100 dilutions) in TBS-T for 1 h at room temperature. The membranes were incubated with 1∶2000 HRP-conjugated secondary antibodies against rat IgG in TBS-T for 1 h at room temperature after washing. Following extensive washing in TBS-T, the membranes were at last incubated with diaminobenzidine substrate solution to develop color after washing again [37].
In immunocytochemistry assay, the PLC cells were seeded into sterile Petri dish (Nest, diameter of 15 mm) which is special for the detection of laser scan confocal microscopy, at a density of 2×104 cells per well and then cultured for 24 h. The PLC cells were washed four times with PBS and then fixed with 2 ml of 4% paraformaldehyde solution in PBS at room temperature for 30 min, then treated with 50 mM NH4Cl for 10 min, to reduce aldehyde groups. The cells were permeabilized for 4 min at 4°C with 0.3% Triton X-100 in PBS. At the next step, cells were incubated in PBS buffer containing 3% of BSA for 1 h, followed by coated with rCsseverin overnight at 4°C. To visualize cytoskeleton, cells were incubated overnight at 4°C with mouse anti human F-Actin monoclonal antibody (AbD Serotec, UK) diluted 1∶1000, then subsequently incubated overnight at 4°C with rat anti-rCsseverin serum (1∶100) for 12 h at 4°C. The incubation with secondary antibodies was carried out at RT for 2 h, using fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Proteintech, USA) diluted 1∶200 and Cyanine dye 3 (Cy3)-conjugated goat anti-rat IgG (Proteintech, USA) diluted 1∶400 at the same time. All antibodies were diluted with 1% BSA in PBS buffer and all steps described above were preceded by intensive washes in PBS. After finally washing with water, cover dishes were mounted on slides with Hoechst 33258 (Sigma, USA). By contrast, to visualize whether rCsseverin could bind with cytoskeletal actin filaments in vitro, PLC cells were serum-starved overnight after incubating 24 h in standard conditions, and coated with rCsseverin in DMEM with 2% FBS for 48 h before fixed with 4% paraformaldehyde solution. The following steps were similar with that mentioned above previously. Images were finally obtained with the LSM 710 laser scanning confocal microscope (Zeiss).
Apoptosis assays
After being induced spontaneous apoptosis by serum-starved for 24 h and treated with rCsseverin at different concentrations of 10, 20, 40, 80 µg/ml and PBS for 48 h, 1–5×105 PLC cells were collected by centrifugation, and then incubated with Annexin V/propidium iodide (PI), provided by the Apoptosis Detection Kit (Lankebio, China). The cells were washed twice in PBS and resuspended in 500 µl of 1×Binding Buffer before being incubated with 5 µl of Annexin V and 10 µl of PI. The cells were then analyzed by using flow cytometry after incubation for 5–10 min in dark. Early apoptotic cells were stained with AnnexinV alone whereas necrotic and late apoptotic cells were stained with both Annexin V and PI.
PLC cells (5×104 cells per well) were seeded into a 6-well culture plate and cultured as described above. After treatment with Apoptosis Inducers (Beyotime, Chain), the cells were washed twice with PBS, permeabilized with 0.3% Triton in PBS, and stained with Hoechst 33258 for 5 min in dark. Morphologic changes in apoptotic nuclei were observed and photographed under the inverted fluorescence microscope (Leica DMI4000B, Germany) with emission wavelength at 460 nm and excitation wavelength at 350 nm.
Assessment of mitochondrial membrane potential (MMP) by flow cytometry and immunofluorescence
MMP assay kit (Beyotime, China) with JC-1 probe was used to measure MMP in PLC cells. Briefly, cells were seeded in six-well plates overnight and serum-starved for 24 h, then treated with various concentration of rCsseverin for 48 h. The cells were then washed with ice-cold PBS and incubated in a 5% CO2 humidified incubator at 37°C for 20 min after adding 1 ml of JC-1 working solution. The supernatant was then discarded and the cells were washed twice with JC-1 staining buffer. Next, 2 ml medium was added to each well and MMP was monitored using an inverted fluorescence microscope (Leica DMI4000B, Germany) and laser scanning confocal microscope (Zeiss LSM 710, Germany). The red JC-1 fluorescence was observed at 525 nm excitation (Ex)/590 nm emission (Em) and the green cytoplasmic JC-1 fluorescence was observed at 485 nm Ex/530 nm Em.
Quantitative changes of MMP at the early stage of cell apoptosis were measured by flow cytometry with JC-1 probe. After being incubated with 10, 20, 40 and 80 µg/ml of rCsseverin for 48 h, 1–5×105 cells were harvested and resuspended with ice-cold PBS (1,500 rpm×5 min). Then, the cell suspensions were incubated with 0.5 ml JC-1 working solution in 0.5 ml DMEM for 20 min at 37°C. The staining solution was removed by centrifugation. The cells were washed with JC-1 (1×) washing buffer twice, then resuspended in 500 µl JC-1 (1×) staining buffer and detected by flow cytometer (Bechman Coulter Gallios, USA).
Statistical analysis
All of the experiments were repeated at least three times. Experimental values were obtained from three independent experiments with a similar pattern and expressed as means ± standard deviation (SD). Statistical analyses were performed using SPSS software package 17.0. Data were analyzed by one-way analysis of variance (ANOVA) followed by least significant difference (LSD) for comparison between control and treatment groups. Significance was set at p value<0.05.
Results
Sequence analysis of Csseverin
The ORF of Csseverin contained 1077 base pairs (bp) encoding a protein of 358amino acids (predicted MW 40.88 kDa, pI 5.24). Blastx analysis showed that the deduced amino acid sequence was homologous to gelsolin of Schistosoma mansoni, Schistosoma japonicum, Suberites domuncula, Echinococcus granulosus, Strongylocentrotus purpuratus and Hydra magnipapillata with 54%, 65%, 50%, 65%, 48%, 47% identities respectively. The amino acid sequence had no N-terminal signal peptide or transmembrane domain. According to MotifScan and InterproScan prediction, there were three gelsolin domains (aa51–133, aa171–247, aa278–354) indicating that Csseverin might have similar role with gelsolin superfamily. Furthermore, we inferred that the location of putative actin binding surface of Csseverin was from 50 to 150 amino acids by Gene Ontology analysis (http://www.geneontology.org/). The nuclear magnetic resonance (NMR) derived structure of human (Homo sapiens) gelsolin (PRF: 225304) was used as the template to build a molecular model of Csseverin. The two proteins shared 36% identity among their gelsolin core domains and there was significant similarity between their tertiary structures (Figure S1).
Phylogenetic relationships
Csseverin grouped very closely with Schistosoma japonicum (Figure S2), a parasite that increases the risk of HCC incident when associated with positive hepatitis B surface antigen [38]. The Csseverin was also closely relative to severin/gelsolin from Echinococcus granulosus, followed by Dictyostelium discoideum, but far from those of H. sapiens and M. musculus.
Prokaryotic expression and purification of rCsseverin
The soluble rCsseverin was expressed with 6×His-tag in E. coli BL21 after induced by 1 mM IPTG at 37°C for 5 h. The purified recombinant protein showed a single band around 45 kDa (including His-tag sequence) in 12% SDS-PAGE, consistent with the predicted molecular mass (Figure S3, lane 7). The final protein concentration was 0.8 mg/L. The anti-rCsseverin serum was collected from immunized rat.
Western blot analysis
Purified rCsseverin could be recognized by rat anti-rCsseverin serum, anti-His tag monoclonal antibody, serum from C. sinensis-infected rat and serum from CsESPs-immunized rat at 45 kDa, while not blotted with serum from naïve rat. The CsESPs was probed by rat anti-rCsseverin serum at about 45 kDa. However, no band was detected by serum from naïve rat (Figure 1 lanes 1–6).
rCsseverin reacted with sera from naive rats (lane 1), anti-His tag monoclonal antibody (lane 2), sera from C. sinensis-infected rats (lane 3), sera from rats immunized with the CsESP (lane 4), sera from rats immunized with rCsseverin (lane 5). CsESPs reacted with sera from rats immunized with rCsseverin (lane 6).
Expression level of Csseverin at the stage of egg, metacercaria and adult worm of C. sinensis
Csseverin were detected to express at life stage of metacercaria, egg and adult worm of C. sinensis, but at different levels. Statistically significant differences of transcripts were detected among metacercaria, egg and adult worm when normalized by β-actin. The transcription level of Csseverin in egg was about 60 times higher than that in adult worm (Figure 2A). The expression level of Csseverin was consistant with the transcriptional level. Egg has the highest expression level of Csseverin protein, followed by adult worm and metacercaria (Figure 2B).
(A) Quantitative real-time PCR analysis. The transcription levels of Csseverin at life stages of adult worm, metacercaria and egg were analyzed by means of the 2−ΔΔCt ratio, with Cs β-actin serving as the internal standard. *: p<0.05, the transcription level of Csseverin in egg was statistically higher than that in adult worm and metacercaria. (B) Western blotting analysis. Thirty microgram of total proteins from each life cycle stage were subjected to SDS-PAGE and analyzed. Rat anti-rCsseverin serum was used as primary antibody at a dilution of 1∶100. The same dilution of pre-immune rat serum was used as a negative control, and no corresponding band was observed (not shown).
Immunolocalization of Csseverin in the adult worm and metacercaria of C. sinensis
The analysis of immunofluorescence localization by using rat anti-rCsseverin serum showed that in C. sinensis adult intensive fluorescences were observed in vitellarium while scattered fluorescences were detected in tegument. In metacercaria, specific fluorescences were only deposited in tegument. In addition, intensive fluorescences were presented in intrauterine eggs of adult worm (Figure 3D, F and J). By comparison, no specific fluorescence was detected either in adult worm or in metacercaria when treated with serum from naïve rat (Figure 3B, H).
Rat anti-rCsseverin serum was used as primary antibody and red fluorescent Cy3-labeled goat anti-rat IgG as secondary antibody. Slides were observed under white light (pane A, C, E, G, I) or fluorescence microscope (pane B, D, F, H, J). No specific fluorescence was observed in pane B or H which was probed with serum from rat immunized with PBS as negative control. Intensive reddish-orange fluorescences were observed in vitellarium and intrauterine eggs of adult worm (pane D, F, ×50) and oral suck of metacercaria (pane J, ×200). Scattered fluorescences were detected in tegument of adult worm and metacercaria. V, vitellarium. O, oral sucker. T, tegument. E, eggs. W, cyst wall. P, pharynx.
Analysis of circular dichroism (CD) spectrum
According to the profile of CD spectrum, the secondary structure of rCsseverin changed from the presence of Ca2+ shifted to the absence of Ca2+ (presence of EDTA) (Figure 4). With Ca2+, the secondary structure of rCsseverin contained 23.6% α-helix, 56.6% β-sheet, and 19.8% random loop. While with equivalent EDTA, it changed to 21.5% α-helix, 41.2% β-sheet, and 37.3% random loop. The conformation of the purified rCsseverin was between the two conditions with 24.6% α-helix, 49.9% β-sheet, 25.5% random loop. Ca2+-binding altered the conformation of EF-hand domain from α-helix to β-sheet. The purified rCsseverin partially combined Ca2+ during the processes of expression and purification. We showed that rCsseverin was easily to precipitate when calciumion was added into the solution, and can be resolved by adding EDTA.
Spectral changes of CD for PBS–rCsseverin solutions (1 µM in 10 mM) on the addition of the 1 µM calciumion (upper row) and 1 µM EDTA (lower row) conditions demonstrated rCsseverin could bind to Ca2+.
Interaction of rCsseverin with actin
The binding of rCsseverin to F-actin and its fragments were examined using gel overlay assay as described above. After incubation with rCsseverin, F-actin and its fragments were blotted by anti-rCsseverin serum (Figure 5A, pane b, lane 1–2 and pane c, lane 1). While incubation with BSA or without rCsseverin (Figure 5A, pane b, lane 2–3), F-actin couldn't be probed by anti-rCsseverin serum. Whether PLC cells were incubated with rCsseverin before or after fixation and permeabilization, both the green fluorescence (FITC–conjugated affinipure goat anti-mouse IgG reacted with anti-F-actin monoclonal antibody) and the red fluorescence (Cy3–conjugated affinipure goat anti-rat IgG reacted with anti-rCsseverin serum) were observed. The locations of green fluorescence were mostly coincident with those of the red fluorescence (Figure 5B, pane a and b). There was no red fluorescence or green fluorescence in negative control group (Figure 5B, pane c and d). Thus, we suspected that rCsseverin might enter into PLC cells and bind to actin.
(A) The bindings of rCsseverin to F-actin and its fragments were examined using gel overlay assay as described in materials and methods. In pane a, actin and its fragments were separated on 12.5% SDS-PAGE. Protein molecular weight markers (M), F-actin at 37°C for 1 h (lane 1), F-actin digested with 0.25% trypsin at 37°C for 1 h (lane 2), purified rCsseverin (lane 3), 0.25% trypsin at 37°C for 1 h (lane 4). In pane b, rCsseverin binding to F-actin and its fragments were examined using gel overlay assay. The membrane was incubated with rCsseverin then rat anti-rCsseverin serum. Protein molecular weight markers (M), F-actin fragments after digesting with 0.25% trypsin at 37°C for 1 h (lane 1), F-actin at 37°C for 1 h (lane 2), purified rCsseverin (lane 3). In pane c, the membrane was incubated with rCsseverin then rat anti-rCsseverin serum (lane 1), the membrane was incubated with BSA then rat anti-rCsseverin serum (lane 2), the membrane was incubated with rCsseverin then pre-immune rat serum (lane 3). (B) The bindings of rCsseverin to cytoskeletal actin filaments of PLC cells by immunocytochemistry. Pane a, cells were coated with rCsseverin before fixed with 4% paraformaldehyde and successively with rat anti-rCsseverin serum and mouse anti-F-actin monoclonal antibody, and then a mixture of FITC (green fluorescence) and Cy3 (red fluorescence)-labeled goat anti mouse/rat IgG. Pane b, cells were coated with rCsseverin after permeabilized with 0.3% Triton X-100 and successively with rat anti-rCsseverin serum and mouse anti-F-actin monoclonal antibody, and then a mixture of FITC (green fluorescence) and Cy3 (red fluorescence)-labeled goat anti mouse/rat IgG. Pane c, cells incubated with monoclonal anti-F-actin antibody without coated with rCsseverin as negative control. Pane d, cells were coated with rCsseverin before fixed with 4% paraformaldehyde, then incubated only with anti-rCsseverin serum after permeabilized with 0.3% Triton X-100 as another negative control. The images were taken under a LSM 710 Zeiss confocal microscope, with an oil immersion objetive (63×, 1.40 numerical aperture).
Apoptosis assay
To identify the effect of rCsseverin on PLC cells, we tested the total percentage of Annexin V+/PI− and Annexin V+/PI+ cells by flow cytometry. As shown in Figure 6A, incubation of PLC cells with different dosages of rCsseverin (10, 20, 40, and 80 µg/ml) for 48 h after induced spontaneous apoptosis by serum-starved for 24 h decreased the percentage of Annexin V+/PI− and Annexin V+/PI+ cells in a dose-dependent manner (30.63, 26.98, 14.36, and 9.68%, respectively), as compared to the PBS-treated controls, which showed 40.74% Annexin V+/PI− and Annexin V+/PI+ cells. The results showed that rCsseverin exhibited potent anti-apoptosis activity on PLC cells in concentration-dependent manner. We also tested the effect of rCsseverin on human normal hepatocyte L-02 cells. No significant decrease of Annexin V+/PI− and Annexin V+/PI+ cells was observed (Figure 6B).
(A) Flow cytometry analysis of PLC cells treated with PBS, apoptosis inducer (positive control) and 10, 20, 40, and 80 µg/ml rCsseverin for 48 h after induction of spontaneous apoptosis. Representative dot plots of cell apoptosis were showed after AnnexinV/PI dual staining. Apoptotic rate was represented as a percentage of total cell populations. The proportion of dead cells (Annexin V−/PI+), live cells (Annexin V−/PI−), early apoptotic cells (Annexin V+/PI−) and late apoptotic/necrotic cells (Annexin V+/PI+) was respectively measured for comparison. (B) Flow cytometry analysis of L-02 cells with the same treatment. (C) Morphologic changes in apoptotic PLC cells. Following treatment with PBS (negative control) or 80 µg/ml rCsseverin for 48 h, apoptotic nuclei were condensed and brightly stained with Hoechst 33258 then nuclear morphology was photographed and visualized with a Leica DMI4000B (Magnification×400). Each experiment was performed in triplicate.
We also compared the morphology of PLC cells in the presence of 80 µg/ml rCsseverin to that of PBS-treated cells under the inverted phase-contrast microscopy. Hoechst staining of PBS-treated cells after induced spontaneous apoptosis by serum-starved for 24 h revealed marked morphological changes, such as cell shrinkage, vesicular degeneration, threadlike morphology, nuclear condensation, and nuclear fragmentation, which are typical features of apoptotic cell death. While morphological changes of the PLC cells in presence of 80 µg/ml rCsseverin after treatment with serum-starved for 24 h were not significant (Figure 6C).
Recovery of the mitochondrial membrane potential (MMP) in rCsseverin treated PLC cells
To further investigate the molecule events triggered by rCsseverin inhibition, we measured MMP in the PLC cells by using flow cytometry and JC-1 staining in situ. The decline of MMP is considered as a symbolic event of early cellular apoptosis. Changes in MMP can be assessed by monitoring JC-1, which accumulates in mitochondria forming red fluorescent aggregates at high membrane potential and exits mainly in cytosol forming a green fluorescent monomer, presenting a collapse of the membrane [39]. In our study, rCsseverin-treated cells showed reduction of green fluorescence and production of an obvious red fluorescence. The treatment of rCsseverin recovered the MMP in a concentration-dependent manner (Figure 7, A and B), as indicated by an increase of red (JC-1 aggregates)/green (JC-1 monomers) ratio. At 48 h, the percentage of 80 µg/ml rCsseverin and PBS treated PLC cells which emitted green fluorescence was 15.42 and 9.63%, respectively, indicating the recovery of mitochondrial membrane depolarization. The PLC cells that treated with apoptosis introducers exhibited mitochondrial green fluorescence with little red fluorescence, suggesting the cells in depolarization state. The red fluorescence in PLC cells increased, as monitored by in situ JC-1 staining, after the treatment of 10, 20, 40, 80 µg/ml rCsseverin as compared with the PBS group (Figure 7C).
(A) Following treatment with PBS (negative control) or 80 µg/ml rCsseverin for 48 h, representative dot plot showed the changed MMP by flow cytometry after the labeling of fluorescent probe with JC-1. Reduction of mitochondrial membrane potential was demonstrated by the change in JC-1-derived fluorescence from red (JC-1 aggregates, representing high potential) to green (JC-1 monomer, representing low potential). (B) The quantitative MMP from each group was marked by the intensity ratio of red fluorescence over green fluorescence by flow cytometry. The data are expressed as mean ± SD from three independent experiments. * means p<0.05, there is statistic difference (ANOVA/Dunnett's T3 test) between 80 µg/ml rCsseverin group and PBS group (negative control). (C) Typical fluorescence photomicrograph of in situ JC-1 staining output by laser scan confocal microscopy (Magnification×100).
Discussion
In the present study, we identified that Csseverin, which expressed at life stage of egg, metacercaria and adult worm was a component of CsESPs. We also demonstrated its ability of binding with calciumion and actin filaments. Furthermore, co-incubation of PLC cells with rCsseverin in vitro led to an inhibition of apoptosis induced by serum-starved for 24 h, by using morphological analysis of PLC, detection of the apoptosis-associated change of mitochondrial membrane potential as well as Annexin V/PI apoptosis assay. We inferred that rCsseverin may play an intracellular protective role via preventing apoptotic mitochondrial changes (the loss of mitochondrial membrane potential), just like endogenous human gelsolin did [40].
Gelsolin family is found in a diverse range of organisms including bacteria, invertebrates, plants, primates, rodents and vertebrates. The superfamily in mammals consists of seven different proteins: gelsolin, adseverin, villin, capG, advillin, supervillin and flightless I. All of them contain three or six homologous repeats of a domain named gelsolin-like (G) domain [41]. Bioinformatics analysis showed that Csseverin comprised three gelsolin homology domains, calciumion and actin binding motifs. The amino acid sequence of Csseverin shared 36% identity with that of human gelsolin, but there was significant similarity between their tertiary structures. Our phylogenetic analysis suggested that a majority of gelsolin proteins do not form clades based on taxonomic groupings but rather group according to protein functions. The individual gelsolin domains from human gelsolin form distinct clades with homologues from other species, supporting the notion that these proteins have evolved to perform distinct functions in different organisms.
Increased Ca2+ influx through voltage-dependent Ca2+ channels is the major determinant of cell injury following excitotoxicity [42], [43]. The activity of these channels is modulated by dynamic changes in the actin cytoskeleton [44], [45], which may occur, in part, through the actions of gelsolin [46]. We obtained soluble and stable rCsseverin. CD measurements actually showed that rCsseverin could bind to calciumion. It has been documented that gelsolin family is of actin-regulatory function [47]. Cytoskeletal actin filaments are dynamic structures that form membranous networks interacting with cell surface receptors and intracellular effectors [48], [49]. Gel overlay and immunocytochemistry assay indicated the binding activity of rCsseverin.
Gelsolin expression in certain tumors correlates with poor prognosis and therapy-resistance. In vitro, human gelsolin has anti-apoptotic and pro-migratory functions and is critical for invasion of some types of tumor cells [50], [51], [52], [53]. We found that gelsolin was highly expressed at tumor borders infiltrating into adjacent liver tissues [54]. In Jurkat lymphoblastoid T-cell line, gelsolin has been shown to inhibit apoptosis, and the overexpression of gelsolin inhibits the loss of mitochondrial membrane potential and cytochrome c release from mitochondria [55]. Additionally, in several models of neuronal cell death, endogenous gelsolin has been demonstrated that has an anti-apoptotic property which correlates to its dynamic actions on the cytoskeleton mediated by inhibition of mitochondrial permeability transition [56].
Here we also showed that rCsseverin could cause obvious apoptotic inhibition in the human HCC cell line. Flow cytometry was used to evaluate rCsseverin-inhibited apoptosis after dual staining of cells with AnnexinV and PI. Due to that Annexin V binding is based on the transposition of phosphatidyl serine from the inner to the outer face of the cell membrane during the early stages of apoptosis [57]. This method has been widely used to discriminate between normal cells (AnnexinV−/PI−), early apoptotic cells AnnexinV+/PI−), late apoptotic cells (AnnexinV+/PI+), and necrotic cells (AnnexinV−/PI+). Compared with PBS-treated group (negative control), there were less typical apoptotic changes in rCsseverin-treated PLC cells after induced spontaneous apoptosis by serum-starved for 24 h in morphology analysis. We also measured the changes in mitochondrial membrane potential (MMP) using a JC-1 probe that gives a red fluorescence when MMP is high and green fluorescence when MMP is low that occurs in early apoptosis cells. We found that interact directly with rCsseverin led to the recovery of mitochondrial membrane potential in PLC cells.
Moreover, rCsseverin could be probed by sera from rat infected with C. sinensis besides anti-CsESPs serum that confirmed Csseverin was a molecular of CsESPs. Although it is still unclear about the mechanism of uptake or internalization of CsESPs by host cells, internalized CsESPs could play roles in the interaction between the host and parasite. These data demonstrated that Csseverin, as an anti-apoptotic molecule to carcinoma cell, might be a pathogenic factor in CsESPs, contributing to the development of a pro-tumorigenic environment that was conductive to HCC.
Tissue-specific distribution of Csseverin in muscular locations such as teguments of adult worm and metacercaria, as well as its actin binding activity, we inferred that Csseverin might involve in regulating the contraction of smooth muscle and movement of worm body [58], [59], [60]. What was more, relative high transcript/protein level of Csseverin at egg stage was consist with its intensive immunolocalization in the intrauterine eggs of adult worm. As a food-borne parasite, C. Sinensis adult lives in the bile ducts of the host and the worm releases a mass of eggs and ESPs, so that Csseverin exists in parasitism circumstance sustainedly and takes a part in the interaction between the host and parasite.
Overall, we presented the molecular characteristics of Csseverin, a molecule of CsESPs. Recombinant Csseverin (rCsseverin) could bind to Ca2+ and cytoskeletal actin filaments and cause obvious apoptotic inhibition in human HCC cell line. By promoting apoptosis inhibition, Csseverin might exacerbate the process of HCC patients combined with C. sinensis infection. More experiments should be further conducted. The current study may provide a novel insight in understanding the pathogenesis of carcinoma associated with the infection of C. sinensis, which was an inducing factor that cannot be ignored in the process of the development of primary hepatic carcinoma. Since gelsolin has actin-regulatory functions, modulation of the actin network might be responsible for the inhibition of apoptosis, the actin cytoskeleton may be a target to protect from apoptosis [61]. The anti-apoptotic mechanism of Csseverin are worthy of studying in the future.
Supporting Information
Figure S1.
Sequence analysis of severin of Clonorchis sinensis (Csseverin).
https://doi.org/10.1371/journal.pntd.0002606.s001
(DOC)
Figure S2.
Neighbor joining phylogenetic tree for the gelsolin core domains from a range of phyla.
https://doi.org/10.1371/journal.pntd.0002606.s002
(DOC)
Figure S3.
Prokaryotic expression and purification of rCsseverin by 12% SDS-PAGE.
https://doi.org/10.1371/journal.pntd.0002606.s003
(DOC)
Acknowledgments
We would like to thank Dr. Wang Shutong and Dr. Xie wenxuan at the first affiliated hospital of Sun Yat-Sen University for the gift of cells in this work.
Author Contributions
Conceived and designed the experiments: YH XY. Performed the experiments: XC SL. Analyzed the data: XC YH CL ZW JX MR. Contributed reagents/materials/analysis tools: XW PL WC LH SL XL JL MB. Wrote the paper: XC YH.
References
- 1. Lun ZR, Gasser RB, Lai DH, Li AX, Zhu XQ, et al. (2005) Clonorchiasis: a key foodborne zoonosis in China. Lancet Infect Dis 5: 31–41.
- 2. Yoo WG, Kim DW, Ju JW, Cho PY, Kim TI, et al. (2011) Developmental transcriptomic features of the carcinogenic liver fluke, Clonorchis sinensis. PLoS Negl Trop Dis 5: e1208.
- 3. Young ND, Campbell BE, Hall RS, Jex AR, Cantacessi C, et al. (2010) Unlocking the transcriptomes of two carcinogenic parasites, Clonorchis sinensis and Opisthorchis viverrini. PLoS Negl Trop Dis 4: e719.
- 4. Young ND, Jex AR, Cantacessi C, Campbell BE, Laha T, et al. (2010) Progress on the transcriptomics of carcinogenic liver flukes of humans–unique biological and biotechnological prospects. Biotechnol Adv 28: 859–870.
- 5. Kim HG, Han J, Kim MH, Cho KH, Shin IH, et al. (2009) Prevalence of clonorchiasis in patients with gastrointestinal disease: a Korean nationwide multicenter survey. World J Gastroenterol 15: 86–94.
- 6. Hong ST, Fang Y (2012) Clonorchis sinensis and clonorchiasis, an update. Parasitol Int 61: 17–24.
- 7. Fried B, Reddy A, Mayer D (2011) Helminths in human carcinogenesis. Cancer Lett 305: 239–249.
- 8. Sripa B, Kaewkes S, Sithithaworn P, Mairiang E, Laha T, et al. (2007) Liver fluke induces cholangiocarcinoma. PLoS Med 4: e201.
- 9. Choi D, Lim JH, Lee KT, Lee JK, Choi SH, et al. (2006) Cholangiocarcinoma and Clonorchis sinensis infection: a case-control study in Korea. J Hepatol 44: 1066–1073.
- 10. Shin HR, Oh JK, Masuyer E, Curado MP, Bouvard V, et al. (2010) Epidemiology of cholangiocarcinoma: an update focusing on risk factors. Cancer Sci 101: 579–585.
- 11. Lim MK, Ju YH, Franceschi S, Oh JK, Kong HJ, et al. (2006) Clonorchis sinensis infection and increasing risk of cholangiocarcinoma in the Republic of Korea. Am J Trop Med Hyg 75: 93–96.
- 12. Tan SK, Qiu XQ, Yu HP, Zeng XY, Zhao YN, et al. (2008) [Evaluation of the risk of clonorchiasis inducing primary hepatocellular carcinoma]. Zhonghua Gan Zang Bing Za Zhi 16: 114–116.
- 13. HOU PC (1956) The relationship between primary carcinoma of the liver and infestation with Clonorchis sinensis. J Pathol Bacteriol 72: 239–246.
- 14. Huang J, Fang X (2010) The Relationship between Clonorchis sinensis Infection and the Hepatobiliary Diseases. Journal Tropical Medicine 10 (2) 226–228.
- 15. Chung YB, Yang HJ, Hong SJ, Kang SY, Lee M, et al. (2003) Molecular cloning and immunolocalization of the 17 kDa myoglobin of Clonorchis sinensis. Parasitol Res 90: 365–368.
- 16. Wang HJ, Lin HD, Zhang LY, Ding SX (2011) Development and characterization of 20 microsatellite mrkers for Chinese back sleeper, Bostrychus sinensis. Int J Mol Sci 12: 9570–9575.
- 17. Young ND, Campbell BE, Hall RS, Jex AR, Cantacessi C, et al. (2010) Unlocking the transcriptomes of two carcinogenic parasites, Clonorchis sinensis and Opisthorchis viverrini. PLoS Negl Trop Dis 4: e719.
- 18. Huang Y, Chen W, Wang X, Liu H, Chen Y, et al. (2013) The carcinogenic liver fluke, Clonorchis sinensis: new assembly, reannotation and analysis of the genome and characterization of tissue transcriptomes. PLoS One 8: e54732.
- 19. Silacci P, Mazzolai L, Gauci C, Stergiopulos N, Yin HL, et al. (2004) Gelsolin superfamily proteins: key regulators of cellular functions. Cell Mol Life Sci 61: 2614–2623.
- 20. Mullauer L, Fujita H, Ishizaki A, Kuzumaki N (1993) Tumor-suppressive function of mutated gelsolin in ras-transformed cells. Oncogene 8: 2531–2536.
- 21. Fujita H, Laham LE, Janmey PA, Kwiatkowski DJ, Stossel TP, et al. (1995) Functions of [His321]gelsolin isolated from a flat revertant of ras-transformed cells. Eur J Biochem 229: 615–620.
- 22. Ohtsu M, Sakai N, Fujita H, Kashiwagi M, Gasa S, et al. (1997) Inhibition of apoptosis by the actin-regulatory protein gelsolin. EMBO J 16: 4650–4656.
- 23. Granville DJ, Gottlieb RA (2003) The mitochondrial voltage-dependent anion channel (VDAC) as a therapeutic target for initiating cell death. Curr Med Chem 10: 1527–1533.
- 24. Liu F, Lu J, Hu W, Wang SY, Cui SJ, et al. (2006) New perspectives on host-parasite interplay by comparative transcriptomic and proteomic analyses of Schistosoma japonicum. PLoS Pathog 2: e29.
- 25. Zhou Y, Zheng H, Chen Y, Zhang L, Wang K, et al. (2009) The Schistosoma japonicum genome reveals features of host-parasite interplay. Nature 460: 345–351.
- 26. Berriman M, Haas BJ, LoVerde PT, Wilson RA, Dillon GP, et al. (2009) The genome of the blood fluke Schistosoma mansoni. Nature 460: 352–358.
- 27. Wang X, Chen W, Huang Y, Sun J, Men J, et al. (2011) The draft genome of the carcinogenic human liver fluke Clonorchis sinensis. Genome Biol 12: R107.
- 28. Cortez-Herrera E, Yamamoto RR, Rodrigues JJ, Farias SE, Ferreira HB, et al. (2001) Echinococcus granulosus: Cloning and Functional in Vitro Characterization of an Actin Filament Fragmenting Protein. Exp Parasitol 97: 215–225.
- 29. Chen W, Wang X, Li X, Lv X, Zhou C, et al. (2011) Molecular characterization of cathepsin B from Clonorchis sinensis excretory/secretory products and assessment of its potential for serodiagnosis of clonorchiasis. Parasit Vectors 4: 149.
- 30. Na BK, Kang JM, Sohn WM (2008) CsCF-6, a novel cathepsin F-like cysteine protease for nutrient uptake of Clonorchis sinensis. Int J Parasitol 38: 493–502.
- 31. Yoo WG, Kim TI, Li S, Kwon OS, Cho PY, et al. (2009) Reference genes for quantitative analysis on Clonorchis sinensis gene expression by real-time PCR. Parasitol Res 104: 321–328.
- 32. Yoo WG, Kim TI, Li S, Kwon OS, Cho PY, et al. (2009) Reference genes for quantitative analysis on Clonorchis sinensis gene expression by real-time PCR. Parasitol Res 104: 321–328.
- 33. Kowalewski MP, Schuler G, Taubert A, Engel E, Hoffmann B (2006) Expression of cyclooxygenase 1 and 2 in the canine corpus luteum during diestrus. Theriogenology 66: 1423–1430.
- 34. Fano M, van de Weert M, Moeller EH, Kruse NA, Frokjaer S (2011) Ionic strength-dependent denaturation of Thermomyces lanuginosus lipase induced by SDS. Arch Biochem Biophys 506: 92–98.
- 35. Mao X, Liu Z, Ma J, Pang H, Zhang F (2011) Characterization of a novel beta-helix antifreeze protein from the desert beetle Anatolica polita. Cryobiology 62: 91–99.
- 36. Turnay J, Fort J, Olmo N, Santiago-Gomez A, Palacin M, et al. (2011) Structural characterization and unfolding mechanism of human 4F2hc ectodomain. Biochim Biophys Acta 1814: 536–544.
- 37. Fujii T, Yabe S, Nakamura K, Koizumi Y (2002) Functional analysis of rat acidic calponin. Biol Pharm Bull 25: 573–579.
- 38. Hamed MA, Ali SA (2013) Non-viral factors contributing to hepatocellular carcinoma. World J Hepatol 5: 311–322.
- 39. Salvioli S, Ardizzoni A, Franceschi C, Cossarizza A (1997) JC-1, but not DiOC6(3) or rhodamine 123, is a reliable fluorescent probe to assess delta psi changes in intact cells: implications for studies on mitochondrial functionality during apoptosis. FEBS Lett 411: 77–82.
- 40. Kusano H, Shimizu S, Koya RC, Fujita H, Kamada S, et al. (2000) Human gelsolin prevents apoptosis by inhibiting apoptotic mitochondrial changes via closing VDAC. Oncogene 19: 4807–4814.
- 41. Silacci P, Mazzolai L, Gauci C, Stergiopulos N, Yin HL, et al. (2004) Gelsolin superfamily proteins: key regulators of cellular functions. Cell Mol Life Sci 61: 2614–2623.
- 42. MacDermott AB, Mayer ML, Westbrook GL, Smith SJ, Barker JL (1986) NMDA-receptor activation increases cytoplasmic calcium concentration in cultured spinal cord neurones. Nature 321: 519–522.
- 43. Koh JY, Choi DW (1988) Zinc alters excitatory amino acid neurotoxicity on cortical neurons. J Neurosci 8: 2164–2171.
- 44. Hines JE, Johnson SJ, Burt AD (1993) In vivo responses of macrophages and perisinusoidal cells to cholestatic liver injury. Am J Pathol 142: 511–518.
- 45. Rosenmund C, Westbrook GL (1993) Calcium-induced actin depolymerization reduces NMDA channel activity. Neuron 10: 805–814.
- 46. Furukawa K, Fu W, Li Y, Witke W, Kwiatkowski DJ, et al. (1997) The actin-severing protein gelsolin modulates calcium channel and NMDA receptor activities and vulnerability to excitotoxicity in hippocampal neurons. J Neurosci 17: 8178–8186.
- 47. Khaitlina S, Fitz H, Hinssen H (2013) The interaction of gelsolin with tropomyosin modulates actin dynamics. FEBS J 280: 4600–4611.
- 48. Allison DW, Gelfand VI, Spector I, Craig AM (1998) Role of actin in anchoring postsynaptic receptors in cultured hippocampal neurons: differential attachment of NMDA versus AMPA receptors. J Neurosci 18: 2423–2436.
- 49. Furukawa K, Fu W, Li Y, Witke W, Kwiatkowski DJ, et al. (1997) The actin-severing protein gelsolin modulates calcium channel and NMDA receptor activities and vulnerability to excitotoxicity in hippocampal neurons. J Neurosci 17: 8178–8186.
- 50. An JH, Kim JW, Jang SM, Kim CH, Kang EJ, et al. (2011) Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells. Biochem Biophys Res Commun 412: 44–49.
- 51. Zhuo J, Tan EH, Yan B, Tochhawng L, Jayapal M, et al. (2012) Gelsolin induces colorectal tumor cell invasion via modulation of the urokinase-type plasminogen activator cascade. PLoS One 7: e43594.
- 52. Renz M, Betz B, Niederacher D, Bender HG, Langowski J (2008) Invasive breast cancer cells exhibit increased mobility of the actin-binding protein CapG. Int J Cancer 122: 1476–1482.
- 53. Tanaka M, Mullauer L, Ogiso Y, Fujita H, Moriya S, et al. (1995) Gelsolin: a candidate for suppressor of human bladder cancer. Cancer Res 55: 3228–3232.
- 54. Zhuo J, Tan EH, Yan B, Tochhawng L, Jayapal M, et al. (2012) Gelsolin induces colorectal tumor cell invasion via modulation of the urokinase-type plasminogen activator cascade. PLoS One 7: e43594.
- 55. Koya RC, Fujita H, Shimizu S, Ohtsu M, Takimoto M, et al. (2000) Gelsolin inhibits apoptosis by blocking mitochondrial membrane potential loss and cytochrome c release. J Biol Chem 275: 15343–15349.
- 56. Harms C, Bosel J, Lautenschlager M, Harms U, Braun JS, et al. (2004) Neuronal gelsolin prevents apoptosis by enhancing actin depolymerization. Mol Cell Neurosci 25: 69–82.
- 57. Ma PP, Zhu D, Liu BZ, Zhong L, Zhu XY, et al. (2013) [Neutrophil elastase inhibitor on proliferation and apoptosis of U937 cells]. Zhonghua Xue Ye Xue Za Zhi 34: 507–511.
- 58. Granzier HL, Wang K (1993) Passive tension and stiffness of vertebrate skeletal and insect flight muscles: the contribution of weak cross-bridges and elastic filaments. Biophys J 65: 2141–2159.
- 59. Janson LW, Kolega J, Taylor DL (1991) Modulation of contraction by gelation/solation in a reconstituted motile model. J Cell Biol 114: 1005–1015.
- 60. Gailly P, Lejeune T, Capony JP, Gillis JM (1990) The action of brevin, an F-actin severing protein, on the mechanical properties and ATPase activity of skinned smooth muscle. J Muscle Res Cell Motil 11: 293–301.
- 61. Ohtsu M, Sakai N, Fujita H, Kashiwagi M, Gasa S, et al. (1997) Inhibition of apoptosis by the actin-regulatory protein gelsolin. EMBO J 16: 4650–4656.