Antibodies and dyes

All reagents in this study were of analytical grade and are commercially available. The primary antibodies used in this study were purchased from the following companies: the MTA1 antibody was from Santa Cruz Biotech, USA; the E-cadherin antibody was from Epitomics Inc, USA; the α-tubulin and β-actin antibodies were from Sigma, Germany, and the p-AKT (ser473) antibody was from Cell Signaling Technology, USA. The alkaline phosphatase-conjugated anti-rabbit, anti-mouse or anti-goat IgGs were also purchased from Sigma. The FITC- and Cy3-conjugated IgGs were purchased from the PTG lab, USA. DAPI (4, 6-diamidino-2-phenylindole dihydrochloride, (2 μg/ml methanol)) was purchased from Taufkirchen, Germany. Wortmannin was also purchased from Sigma.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. MTA1 regulates E-cadherin expression.

(A) Western blotting results demonstrated that treatment with MTA1 siRNA increased E-cadherin expression after 48 hours. An asterisk (*) or diamond (◊) indicates a statistically significant difference (p<0.05) in the MTA1 or E-cadherin levels, respectively, compared with the negative-control siRNA-transfected cells. (B) A Western blotting analysis also demonstrated that transient transfection with a plasmid that encoded full-length MTA1 decreased E-cadherin expression after 48 hours. An asterisk (*) or diamond (◊) indicates a statistically significant difference (p<0.05) in the MTA1 or E-cadherin levels, respectively, compared with the cells transfected with an empty vector. The changes were quantified (top). All of the experiments were repeated three times.

https://doi.org/10.1371/journal.pone.0046888.g003

Tissue samples and cell lines

The tissues samples of normal prostate, localized prostate cancer and metastatic prostate cancer were obtained from the Department of Pathology of Tongji Hospital, which is affiliated with the Huazhong University of Science and Technology. All of the metastatic prostate cancer tissues were taken from patients who had documented metastatic disease and underwent a transurethral resection of the prostate (TURP) to relieve a urinary obstruction (distant metastasis and positive bone scan, M1 in tumor-node-metastasis TNM staging). This study was approved by local research ethics committee (REC) at the Tongji Hospital of Huazhong University of Science and Technology in accordance with the principle of the Helsinki Declaration II. All written informed consent documents from each participant were obtained during the enrollment phase. The poorly metastatic human prostate adenocarcinoma PC-3M-2B4 cell line (2B4) and the highly metastatic human prostate adenocarcinoma PC-3M-1E8 cell line (1E8) were purchased from Professor Zhengjie (Beijing University, China). The cells were cultured in RPMI 1640 medium (Gibco-BRL, US) with 10% (v/v) fetal bovine serum (Si Jiqing, Hangzhou, China).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. MTA1 regulates E-cadherin through the phosphorylation and activation of AKT (p-AKT).

(A) A Western blotting analysis showed that treatment with MTA1 siRNA could inhibit AKT phosphorylation after a 48 hours siRNA treatment. An asterisk (*) and diamond (◊) indicates a statistically significant difference (p<0.05) in the MTA1 and E-cadherin levels, respectively, compared with the negative-control siRNA-transfected cells. (B) The cells were incubated with either the p-AKT inhibitor wortmannin (100 nM) or DMSO for various times from 24 hours to 48 hours, and the cellular proteins were extracted. A Western blotting analysis showed that wortmannin treatment promoted the expression of E-cadherin and inhibited the expression of MTA1 after 24 hours. An asterisk (*), diamond (◊), or triangle (Δ) indicates a statistically significant difference (p<0.05) in the MTA1, E-cadherin or p-AKT levels, respectively, compared with the DMSO-treated cells. (C) The forced over expression of p-AKT by transient transfection of the myr-AKT plasmid decreased the expression of E-cadherin and increased the expression of MTA1 after 24 hours. The quantification of the bands is shown (top). (D) The cells were transfected with MTA1 siRNA in the presence or absence of the myr-AKT plasmid or wortmannin for 48 hours. A Western blotting analysis was used to evaluate the changes in E-cadherin expression. An asterisk (*), diamond (◊), or triangle (Δ) indicates a statistically significant difference (p<0.05) in the MTA1, E-cadherin or p-AKT levels, respectively, compared with the negative-control siRNA-transfected cells. The quantification of the bands intensities is shown (top). All experiments were repeated three times.

https://doi.org/10.1371/journal.pone.0046888.g004

Immunohistochemistry

An immunohistochemical analysis of MTA1 was performed using the avidin-biotin-peroxidase complex method. Dewaxed and rehydrated tissue sections were incubated overnight at 4°C with a mouse monoclonal anti-human MTA1 antibody at a 1∶100 dilution and then washed with PBS. Biotinylated goat anti-rabbit immunoglobulin (DAKO, Kyoto, Japan) was then added to the sections for 30 minutes at room temperature. After the sections were washed with PBS, peroxidase-conjugated avidin (DAKO) was then applied. The peroxidase activity was detected by exposing the sections to a solution of 0.05% 3, 3-diaminobenzidine and 0.01% H₂O₂ in Tris-HCl buffer (3, 3-diaminobenzidine solution) for 3 to 6 minutes at room temperature. The sections were counterstained with hematoxylin.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. The forced over-expression or silencing of E-cadherin changes the p-AKT mediated malignant phenotypes.

(A) The cells were treated with the myr-AKT plasmid or empty vector for 48 hours in the presence or absence of E-cadherin siRNA. The adhesive ability was tested using the MTT assay, and a typical experimental result is shown. An asterisk (*) indicates a statistically significant difference (p<0.05) compared to the cells transfected with an empty vector. A triangle (Δ) indicates a statistically significant difference (p<0.05) compared to the cells transfected with the myr-AKT-encoding plasmid in the absence of E-cadherin siRNA. (B) The cells were incubated with wortmannin (100 nM) or DMSO for 24 hours and then treated with or without E-cadherin siRNA for 48 hours. Using the MTT assay, the adhesive ability of the cells was tested. An asterisk (*) indicates a statistically significant difference (p<0.05) compared with DMSO-treated cells. A triangle (Δ) indicates a statistically significant difference (p<0.05) compared with the wortmannin-treated cells in the absence of E-cadherin siRNA. (C, D, and E) The cells were treated with the myr-AKT plasmid or an empty vector for 48 hours in the presence or absence of the E-cadherin plasmid. A Matrigel^TM-coated transwell system was used to analyze the invasive capabilities of the cells. The quantification of the number of invasive cells from the bottom of the transwell inserts is shown (right panel). An asterisk (*) indicates a statistically significant difference (p<0.05) compared to the cells transfected with an empty vector. A triangle (Δ) indicates a statistically significant difference (p<0.05) compared with the cells transfected with a myr-AKT-encoding plasmid in the absence of E-cadherin siRNA. (F, G, and H) The cells were treated with the myr-AKT plasmid or an empty vector for 48 hours in the presence or absence of the E-cadherin plasmid. The changes in the cellular cytoskeleton were monitored by confocal microscopy. Red staining represents α-tubulin, and blue staining represents the nuclei (400 fold). (I, J, and K) The cells were treated with wortmannin (100 nM) or DMSO for 24 hours and then treated with or without E-cadherin siRNA for 48 hours. A Matrigel^TM-coated transwell system was used to measure changes in the cellular invasive ability. The quantification of the number of invasive cells from the bottom of the transwell insert is shown (right panel). An asterisk (*) indicates a statistically significant difference (p<0.05) compared to the DMSO-treated cells. A triangle (Δ) indicates a statistically significant difference (p<0.05) compared with the wortmannin-treated cells in the absence of E-cadherin siRNA. (L, M, and N) The cells were treated with wortmannin (100 nM) or DMSO for 24 hours and then treated with or without E-cadherin siRNA for 48 hours. The changes in the cellular cytoskeleton were monitored by confocal microscopy. Red staining represents α-tubulin, and blue staining represents the nuclei (400 fold). A representative result from three experiments is shown for all data.

https://doi.org/10.1371/journal.pone.0046888.g005

RT-PCR and immunoblotting

For the RT-PCR analysis, total RNA was isolated from the cell lines using the Trizol reagent (Invitrogen, Cergy Pontoise, France), and the cDNA was synthesized with M-MLV reverse transcriptase (Promega, USA) according to the manufacturer's instructions. The PCR was performed using a PCR amplifying system (Biometra, USA). The primers were designed using Oligo 6 software, identified by the Basic Local Alignment Search Tool (BLAST; http://www.ncbi.nlm.nih.gov/BLAST) and purchased from Invitrogen. The MTA1 primer sequences were as follows: Forward: 5′- CTCTGCGCATCTTGTTGGACATA -3′ and Reverse: 5′-TCAGCTTCGTCGTGTGCAGATAG -3′. For an internal standard, the β-actin primer sequences were as follows: Forward: 5′- GCACCACACCTTCTACAATG -3′ and Reverse: 5′- TGCTTGCTGATCCACATC TG -3′.

For the Western blot analyses, the cells were lysed in RIPA buffer (50 mM Tris/HCl, pH 7.2, 150 mM NaCl, 1% NP-40, 0.1% SDS, and 0.5% (w/v) sodium deoxycholate). Equivalent amounts of the cell extracts (150 μg) were separated on a 10% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) and transferred onto a polyvinylidene difluoride membrane (PVDF). The membranes were blocked in 25 mM Tris (pH 8.0) containing 125 mM NaCl, 0.1% Tween 20, and 5% skim milk for 1 hour and then incubated with the diluted primary antibodies (MTA1: 1∶200, E-cadherin and p-AKT: 1∶2000 and β-actin: 1∶1000) at 4°C overnight. After incubation with the primary antibodies, the secondary antibodies were added at a 1∶1000 dilution. The immunoreactive bands were visualized with alkaline phosphatase and BCIP/NBT staining.

Quantitative Real-time PCR

For quantitative real-time PCR, total RNA was isolated from cell lines in Trizol reagent (Invitrogen, Cergy Pontoise, France). First-strand cDNA synthesis was performed using a cDNA synthesis kit (Amersham Bioscience, NJ). Quantitative real-time PCR was performed on an ABI PRISM 7700 Sequence Detection System (Applied Biosystems, CA) by using a QuantiTect SYBR Green kit (Qiagen, CA). The primers were designed using Primer Express 3.0 software, identified by Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST) and purchased from Invitrogen. Each sample was run in triplicate. Conditions for quantitative PCR reaction were as follows, one cycle of 50°C for 15 min, one cycle of 94°C for 2 min, 40 cycles of 94°C for 15 s, 56°C for 20 s, and 70°C for 20 s. At the end of the PCR reaction, samples were subjected to a melting analysis to confirm specificity of the amplicon. The MTA1 primer sequences were: Forward: 5′- GCAGCTGAAGCTGAGAGCAAGTTA-3′; Reverse: 5′-CCTTGACGTTGTTGACGCTGA -3′. The E-cadherin primer sequences were: Forward: 5′- TACACTGCCCAGGAGCCAGA -3′; Reverse: 5′ TGGCACCAGTGTCCGGATTA-3′; For internal standard, the GAPDH primer sequences were: Forward: 5′- CCACTCCTCCACCTTTGAC-3′; Reverse: 5′- ACCCTGTTGCTGTAGCCA -3′.

Cell transfection

The cell lines were cultured in 6-well tissue culture plates or flasks at 37°C with 5% CO2 in a humidified incubator (Heraeus, Germany). For the siRNA transfection, the cells were transfected with 200 pmol/ml of siRNA duplex using 5 μl of Lipofectamine^TM 2000 (Invitrogen) when the cells were 20% confluent according the manufacturer's protocol. The controls included untransfected cells and cells that had been transfected with a scrambled negative control siRNA (Ruibo, China). For the plasmid transfection, 4×10⁵ cells were plated in a 6-well plate and transfected using 4 μg of plasmid and 10 μl of Lipofectamine^TM 2000 per well. The full-length MTA1 plasmid (PEGFP-C1/MTA1) was kindly provided by Professor My Mahoney (Thomas Jefferson University), and the empty vector (PEGFP-C1) was preserved by our lab. The PCMV-SPORT6 E-cadherin plasmid was purchased from YRBIO (China), and the E-cadherin gene was subcloned into the pcDNA vector by our lab. The pcDNA myr-HA-AKT2 (myr-AKT) plasmid was purchased from Addgene (http://www.addgene.org/; Addgene plasmid 9016), and the empty vector pcDNA was also preserved in our lab. The cells were harvested 48 h after transfection, and the protein levels were measured by Western blot. The MTA1 siRNA sequences were as follows: Forward: 5′ CCCUGUCAGUCUGCUAUAA dTdT 3′ and Reverse: 3′ DTDTGGGACAGUCAGACGAUAUU 5′. The E-cadherin siRNA sequences were as follows: Forward: 5′CAGACAAAGACCAGGACUA dTdT 3′ and Reverse: 3′ dTdT GUCUGUUUCUGGUCCUGAU 5′.

The invasion assay

For the invasion assay, 5×10³ cells were seeded in 100 μl RPMI 1640 media on the top of polyethylene terephthalate (PET) membranes coated with Matrigel^TM (1.5 mg/ml, BD Biosciences) within transwell cell culture inserts (24-well inserts, 8 μm pore size; Corning Life Sciences, Corning, NY). The bottom chamber was filled with 600 μl RPMI 1640 media containing 20% FBS and the supernatant from NIH3T3 cells (mouse embryonic fibroblast cell line) to act as a chemotactic factor (CF). The cells were incubated for 48 hours at 37°C with 5% CO₂. Subsequently, the cells were fixed in 2.5% (v/v) glutaraldehyde and stained with crystal violet. The invasive cells on the gel bottom were visualized under a microscope (Leica, Germany) and quantified by counting the number of cells in three randomly chosen fields at a 100-fold magnification.

The solid-phase adhesion assay

The adhesion assay was performed using the tetrazolium-based colorimetric assay (MTT). Equal numbers of cells (4×10⁴ cells per well) were seeded into 96-well plates that had been precoated with 1 μg/ml of fibronectin (FN) (Sigma, Germany). As a comparison, an equal number of cells was also seeded in plates coated with bovine serum albumin (1% w/v). After 1 hour, the plates were immersed into PBS containing 1 mM MgCl₂ to remove non-adherent cells. Then, the number of adherent cells was measured with the MTT assay and read at 490 nm. The OD values reflected the proportion of cells that adhered to the FN-coated 96-well plate. The rate of adhesion was calculated by the following equation: the value of the OD of the experiment/the value of the OD of the control ×100%.

Confocal microscopy imaging

For immunofluorescence staining, 1×10⁴ cells were seeded onto glass coverslips (13 mm diameter). After the cells were fixed with 4% paraformaldehyde in PBS, the cell membranes were permeabilized with 0.2% (v/v) Triton X-100 in PBS, and nonspecific binding sites were blocked with 5% BSA (w/v) in PBS. The first antibody was applied to the slides at 4°C overnight (α-tubulin: 1∶50, MTA1: 1∶20, and E-cadherin: 1∶100). After the incubation with the first antibody, the cells were washed three times with cold PBS and incubated with FITC- or Cy3-conjugated IgG at a 1∶50 dilution in PBS for 30 min at room temperature. The nuclei were stained for 5 min at room temperature with DAPI. The cells were rinsed with PBS and observed using a confocal microscope (Olympus, Japan).

Co-immunoprecipitation(Co-IP)

1E8 cells grew in 10 cm dishes then were harvested in non-denaturing lysis buffer (20 mM Tris,, PH 8, 135 mM NaCl, 10% glycerol, 1%Nonidet P-40 (NP-40), 2 mM EDTA, Roche complete mini protease cocktail inhibitors. All of the following procedures were performed on the ice. Lysis buffer-soluble lysates, collected following extraction for 4 hours and centrifugation at 12,000 rpm 20 minutes at 4°C. In a tube 1mg cell lysate was added with 40 μl MTA1 antibody, and incubated overnight at 4°C. The next day, cell lysate containing antibody were applied to protein G-coupled sepharose beads (Abcam) for 4 hours at 4°C. Beads were washed 3 times in lysis buffer. Finally, the supernatant were added into 25μl 2× loading buffer. Western blotting was performed after separating protein and beads with boiling.

Statistical analysis

The data were analyzed by an ANOVA. The statistical analyse was performed using SPSS version 13.0 software.

The expression of MTA1 in prostate carcinoma

To confirm the expression of MTA1 in human prostate cancer, an immunohistochemical staining analysis for MTA1 was performed on normal prostate, localized prostate cancer and metastatic prostate cancer tissue samples (the resources and criteria for tissue designations are described in the materials and methods section). The results revealed that in normal prostate samples, MTA1 expression was barely detectable (Figure 1A). However, in the localized prostate cancer samples, positive staining for MTA1 was observed in the nuclei of 6 of the 15 tissues examined (Figure 1B). Additionally, in 27 of the 30 tumor metastatic prostate cancer tissues, a high level of MTA1 staining was observed in both the cytoplasm and nuclei of the cancerous cells (Figure 1C). A quantitative analysis for the positive staining of MTA1 in Figure 1A–C was shown in Figure S1. An RT-PCR and Western blot analysis were performed to measure the expression of MTA1 RNA and protein levels, respectively, in PC-3M-1E8 (1E8) and PC-3M-2B4 (2B4) cells [29], [30]. The results from these analyses are shown in Figure 1D and E, which demonstrate that MTA1 RNA and protein levels were present in both cell lines but at different expression levels. The mRNA expression levels of MTA1 were 0.38±0.01 and 0.83±0.02 for the 2B4 and 1E8 cells, respectively, and the protein expression levels in the 2B4 and 1E8 cells were 0.58±0.04 and 0.83±0.02, respectively (p<0.05, n = 3 for each). We found that the 1E8 cells expressed approximately two-fold higher levels of MTA1 RNA and 1.5-fold higher MTA1 protein levels compared to the 2B4 cells. Therefore, the 1E8 cell line was chosen to investigate the biological properties of MTA1 in prostate carcinoma in vitro.

The influence of MTA1 silencing on the malignant phenotype of 1E8 cells

We used siRNA to down-regulate the expression of MTA1 in the 1E8 cells. Three pairs of siRNAs against MTA1 were designed. We verified the efficacy of the siRNA by Western blotting (Figure S2). At least a 60% knockdown of the MTA 1 protein level was obtained using the siRNA-3#, so we chose this pair for our further study (Figure 2A). We also over-expressed MTA1 in the background of MTA1 siRNA, which confirmed the effect brought by siRNA-3# in cells (Figure S3). The siRNA-transfected cells were also analyzed for the expression of the E-cadherin protein. A Western blot analysis showed the expression level of E-cadherin was higher in the MTA1 siRNA-treated cells (48 hours after transfection), which indicated that MTA1 may play a role in the negative regulation of E-cadherin. Next, we analyzed the adhesion ability of the MTA1 siRNA-treated 1E8 cells using a solid-phase assay combined with the MTT assay (see the materials and methods section). For the same surface-coated concentration of FN, the adhesion ability of the MTA1 siRNA-treated cells was significantly higher than the control cells. A representative image is shown. The adhesive rates for the nontreated, negative control siRNA-treated and MTA1 siRNA-treated cells were 40.07±6.23, 50.22±4.99 and 99.62±9.62, respectively (p<0.05, n = 3, Figure 2B). We also studied the effects of MTA1 on the invasiveness of the 1E8 cells using a Matrigel^TM-coated transwell model. The quantities of cells at the bottom of the membrane, which reflected the invasiveness of the cells were 597±6.24, 590±5.77 and 201±2.40 for the nontreated, negative control siRNA-treated and MTA1 siRNA-treated cells, respectively (p<0.05, n = 3 Figure 2C–E). Alterations of the cellular cytoskeleton organization and polarity are also involved in tumor cell metastasis [31] Therefore, we examined the cytoskeleton structures of the MTA1 siRNA-treated cells by confocal microscopy and found that the ‘feet’ of the MTA1 siRNA-treated cells were shortened and that the cellular polarity was weakened compared to the control cells (Figure 2F-H MTA1: red; nuclei: blue). These results further suggest that MTA1 may be involved in the malignant phenotypes of cancer cells, including adhesion, invasiveness, cytoskeletal structure and cell polarity.

MTA1 regulates the expression of E-cadherin

To confirm the role of MTA1 in the regulation of E-cadherin expression, we treated 1E8 cells with MTA1 siRNA and a full-length MTA1 plasmid for various times from 24 to 48 hours (translational level). As shown in Figure 3A, after 48 hours of MTA1 siRNA treatment, the expression of MTA1 was down-regulated, and the expression of E-cadherin was significantly upregulated The protein expression level of E-cadherin was 1.16±0.10 compared to 0.35±0.04 in the control cells (p<0.05, n = 3). Then, we tested the expression level of E-cadherin in 1E8 cells that had been transfected with the pEGFP-C1/MTA1 plasmid that encoded the full-length MTA1 gene (Figure 3B). Compared with cells that had been transfected with the empty pEGFP-C1 vector, the expression of E-cadherin was significantly down-regulated in the cells over-expressing MTA1. The protein expression level of E-cadherin was 0.25±0.08 in the cells over-expressing MTA1 compared to 1.08±0.36 in the control cells (p<0.05, n = 3). The same tendency was also detected by realtime-PCR in RNA level (Figure S4).

MTA1 regulates E-cadherin expression through AKT activation

Based on the previously mentioned literature, we investigated the potential role of p-AKT in the interaction between MTA1 and E-cadherin. We found that MTA1 siRNA treatment significantly reduced the level of p-AKT after 48 hours (Figure 4A). We also treated cells with wortmannin (100 nM), a PI3K inhibitor, which also led to a decrease in the level of AKT phosphorylation. The selective inhibition of p-AKT resulted in a significant upregulation of E-cadherin expression and downregulation of MTA1 expression after 36 hours or 48 hours (Figure 4B). Similarly, transient transfection with the pcDNA3 myr-HA-AKT2 plasmid (myr-AKT) resulted in an activation of p-AKT, decreased the expression of E-cadherin and increased the expression of MTA1 after 36 hours or 48 hours (Figure 4C). Considering the different timing of the interactions between MTA1, p-AKT and E-cadherin, we chose 48 hours as the timepoint for subsequent experiments. We found that the increased E-cadherin protein expression caused by MTA1 siRNA treatment was further enhanced by wortmannin treatment (100 nM) and blocked upon transfection with the myr-AKT plasmid (Figure 4D). Cumulatively, these results demonstrate that the down-regulation of MTA1 induced E-cadherin expression through the activation of AKT, which indicates that p-AKT serves a mediator between the two genes and plays an important role in the malignant phenotypes regulated by MTA1 in 1E8 cells. All of the experiments were repeated three times.

Changes in the expression of E-cadherin alter the p-AKT-mediated cellular malignant phenotype

Based on the results shown in Figures 3 and 4, we hypothesized that MTA1 may regulate E-cadherin through p-AKT to induce the invasion of 1E8 cells. Therefore, increasing or decreasing the expression of E-cadherin may alter the cellular malignant phenotype mentioned in Figure 2. To explore this possibility, we examined whether changes in E-cadherin expression altered the p-AKT-induced cellular adhesion. As shown in Figure 5A, cells that had been transfected with myr-AKT had a lower adhesive ability compared to cells transfected with an empty vector. Additionally, the co-transfection of myr-AKT and E-cadherin increased the adhesive ability of the cells. In contrast, treatment with E-cadherin siRNA inhibited the enhanced adhesion ability caused by wortmannin treatment (100 nM) (Figure 5B). Next, we examined if expression levels changes in E-cadherin were able to alter the invasiveness of the cells or change the cellular cytoskeleton, which are mediated by p-AKT. As shown in Figure 5 C, D and E, using a Matrigel^TM-coated transwell system (see the actual number of cells on the right), we found that the forced over-expression of E-cadherin inhibited the ability of myr-AKT to enhance cell invasion. Additionally, using confocal microscopy, we found that the ‘feet’ of cells over-expressing myr-AKT were longer and that the polarity of the cells was increased, while E-cadherin over-expression shortened the ‘feet’ and reversed the polarity (Figure 5F, G, and H). In contrast, the invasion of wortmannin-treated (100 nM) cells was inhibited, and the down-regulation of E-cadherin expression by siRNA treatment enhanced the invasion (Figure 5I, J, and K) (see the number cells within each panel). As shown in Figure 5L, M, and N, the cells that had been treated with a combination of E-cadherin siRNA and wortmannin (100 nM) had longer ‘feet’ and sharper polarity compared to cells that had been treated with wortmannin (100 nM) or DMSO alone. All of the experiments were repeated three times.