http://orcid.org/0000-0002-4015-8553
Figures
Abstract
Giardia duodenalis is one of the main enteric pathogens associated with diarrheal disease. In developing countries, giardiasis is a major public health concern, particularly in children under five years of age. This study aimed to evaluate the occurrence and genetic diversity of G. duodenalis causing human infections in Shushtar County, Southwestern Iran. Individual faecal specimens were collected from 1,163 individuals (male/female ratio: 0.9; age range 2–75 years) with (n = 258) and without (n = 905) gastrointestinal symptoms living in rural and urban settings during the period 2017–2018. Conventional (sucrose flotation and microscopy) methods were used for the initial detection of G. duodenalis cysts in faecal specimens. Microscopy-positive samples were confirmed by PCR amplification and sequencing of the small subunit rRNA (ssu rRNA) gene of the parasite. A multilocus genotyping (MLG) scheme targeting the triose phosphate isomerase (tpi), the glutamate dehydrogenase (gdh), and the beta-giardin (bg) genes was used for genotyping purposes. Giardia duodenalis cysts were detected in 7.7% (90/1,163) of samples by microscopy, of which 82 were confirmed by ssu-PCR. Successful amplification and sequencing results were obtained for 23.2% (19/82), 9.8% (8/82), and 8.5% (7/82) of the confirmed samples at the tpi, gdh, and bg loci, respectively. MLG data for the three loci were available for two samples only. Out of the 24 samples genotyped at any loci, 50% (12/24) were identified as assemblage A and the remaining half as assemblage B. Overall, AII was the most prevalent sub-assemblage detected (41.7%, 10/24), followed by BIII (25.0%, 6/24), discordant BIII/BIV (5/24) or AII/AIII (2/24) sequences, and BIV (1/24). No significant correlation was demonstrated between a given assemblage/sub-assemblage and the occurrence of clinical symptoms. No genotypes adapted to animal hosts other than humans (e.g. assemblages C-F) were found circulating in the investigated human population, suggesting that transmission of human giardiasis in this Iranian region is primarily of anthroponotic nature. Further molecular-based studies are needed to confirm and expand these results, and to ascertain the presence and public health relevance of the parasite in environmental (e.g. drinking water) samples.
Citation: Rafiei A, Baghlaninezhad R, Köster PC, Bailo B, Hernández de Mingo M, Carmena D, et al. (2020) Multilocus genotyping of Giardia duodenalis in Southwestern Iran. A community survey. PLoS ONE 15(2): e0228317. https://doi.org/10.1371/journal.pone.0228317
Editor: Rodney D. Adam, Aga Khan University - Kenya, KENYA
Received: October 17, 2019; Accepted: January 13, 2020; Published: February 6, 2020
Copyright: © 2020 Rafiei et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All data generated or analyzed during this study are included in the article. Sequencing data from this study are available in the GenBank database, under the accession numbers listed in Table 3.
Funding: This study was funded by the Infectious and Tropical Diseases Research Center, Health Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz (Iran) under grant OG/9731 to MB. Additional funding was obtained from the Health Institute Carlos III (ISCIII), Ministry of Economy and Competitiveness (Spain), under project PI16CIII/00024 to DC. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Abbreviations: °C, Centigrade; bg, beta-giardin; BLAST, Basic Local Alignment Search Tool; bp, Base pair; DNA, Deoxyribonucleic acid; g, Gram; gdh, Glutamate dehydrogenase; km2, Square kilometre; LMICs, living in low and middle-income countries; M, Molar; MEGA, Molecular Evolutionary Genetics Analysis; min, Minute; mL, Millilitre; MLG, Multilocus genotyping; NCBI, National Centre for Biotechnology Information; NJ, Neighbor-Joining; p, probability; PCR-RFLP, Polymerase chain reaction- restriction fragment length polymorphism; S, Second; SD, Standard deviation; SNP, Single-nucleotide polymorphism; SPSS, Statistical Package for the Social Sciences; ssu-rRNA, small subunit of ribosomal RNA; tpi, Triose phosphate isomerase; WHO, World Health Organization; μL, Microliter
Introduction
Parasitic diseases are public health problems in poor-resourced communities living in low and middle-income countries (LMICs) [1]. Giardiasis and cryptosporidiosis, the two most important waterborne diseases of protozoan origin, are a frequent cause of diarrheal outbreaks throughout the world [2–5]. Because giardiasis has a negative impact on child health, pregnancy and worker productivity and affect their socio-economic development, the disease was included in the WHO Neglected Diseases Initiative in 2004. Giardia duodenalis is a protozoan that colonize/infect the small intestine of humans and other vertebrates [6]. It is estimated that near 200 million people in Africa, Asia, and Latin America have symptomatic giardiasis every year [7], although the number of subclinical infections is much higher. The parasite has a direct life cycle comprising two developmental stages, the trophozoite and the cyst. The trophozoite is the replicative stage and causes the clinical symptoms of giardiasis, whereas the cyst is the infective stage and are shed in the faeces of infected individuals [8, 9]. Giardia duodenalis infection occurs by accidental ingestion of infectious cysts through contaminated food or water, or by direct contact with infected humans or animals [8].
Clinical giardiasis is particularly prevalent among children under five years of age, the elderly and immunocompromised patients [10, 11]. The prevalence of the infection has been reported at 2–3% in industrialized countries and at 20–30% in LMICs [12]. Variations in the occurrence rate of giardiasis have been attributed to different factors such as the sensitivity of the diagnostic tool used, the geographical location, and the socio-demographic features of the studied population [13]. Of the eight G. duodenalis assemblages (A to H) currently recognized (which are all morphologically similar and difficult to differentiate), A and B are the main assemblages causing infections in humans as well as other mammal species [14, 15]. Multilocus genotyping (MLG) approaches, based on the amplification and sequencing of the glutamate dehydrogenase (gdh), the triose phosphate isomerase (tpi), and the beta-giardin (bg) genes of the parasite represent a powerful tool to systematically ascertain the genetic diversity within G. duodenalis. Accordingly, assemblage A has been classified into three distinct (AI-AIII) sub-assemblages [16, 17], whereas assemblage B has been subdivided into two (BIII-BIV) sub-assemblages [8]. The most common sub-assemblages in humans are AII, BIII, and BIV, although their frequencies differ largely depending on the geographical region and sub-population considered [16]. Many studies have been conducted to clarify the potential correlation between Giardia assemblages and clinical symptoms; however no clear associations have been demonstrated yet [6].
In Iran, giardiasis is one of the main parasitic diseases in humans [18]. The prevalence of G. duodenalis was estimated at 1.2% to 38.0% in Iranian populations [1]. Molecular studies carried out to date, although limited, indicate that assemblage A is more prevalent than assemblage B both in symptomatic and asymptomatic populations [1, 19–21]. However, in these studies assemblage identification was based either on restriction fragment length polymorphism (PCR-RFLP) analysis or PCR and sequencing of a single genetic locus. To the best of our knowledge, only one study by Razmjou et al., presented at the 27th European Congress of Clinical Microbiology and Infectious Diseases, attempted to identify G- duodenalis genotypes of human origin by MLG in the country [22]. Therefore, this study was conducted to assess the occurrence and molecular diversity of G. duodenalis in rural and urban populations in Shushtar County, southwestern Iran, using an MLG approach. No such studies have been conducted in this region of the country to date.
Materials and methods
Ethics approval and consent to participate
The study protocol was reviewed and approved by the Ethics Committee of Ahvaz Jundishapur University of Medical Sciences (Approval No IR.AJUMS.REC.1397.461). The study aims and the procedures involved were explained to, and written informed consent was obtained from voluntary participants.
Study area
Shushtar County (32° 02’ N 48° 51’ E) is one of the 27 counties conforming the Khuzestan Province in Southwestern Iran. It is approximately 150 meters above sea level and extends over an area of 2,436 km2. Based on the 2016 Iranian census, reported population is about 192,028 inhabitants distributed into two urban (Markazi and Shoaybiyeh) and 6 rural (Sardarabad, Western Shoaybiyeh, Eastern Shoaybiyeh, Shahid Modares, Northern Mianab, and Southern Mianab) districts. Most of the rural inhabitant usually keep domestic animals including dogs, cattle, goats, and chickens, at homes. Shushtar County has a Mediterranean climate, with warm and dry summers and mild winters.
Study population
A prospective, community-based epidemiological study was conducted by simple random sampling among rural and urban people in Shushtar County during 2017–2018. Informative meetings were held with local education authorities and asked for collaboration. Voluntary participants were provided with polystyrene plastic flask and requested to provide individual stool samples. A standardized questionnaire covering basic sociodemographic (age, gender, residency, and household size) and clinical (occurrence of gastrointestinal symptoms) data was completed by researchers interviewing participating individuals at the moment of sampling. Collected stool samples were transported in refrigerated containers or insulated boxes to the Department of Parasitology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences (Ahvaz) for further microbiological and molecular analyses.
Sample processing, detection and isolation of G. duodenalis cysts
Direct microscopy with formalin-ether concentration technique was used as screening test in all the stool samples collected. In those samples with a G. duodenalis-positive result after microscopy examination the sucrose-flotation method was performed to isolate the cysts of the parasite as described previously with slight modifications on centrifugation speed and volume of sucrose used [23]. Briefly, approximately 5 g of faecal material was emulsified in 50 mL of distilled water, filtered through a four-layer gauze, and centrifuged at 1000 ×g for five min. After removing the supernatant, the remaining sediment was re-suspended in 30 mL of distilled water, mixed thoroughly for one min, and added to the top of a 15 mL cold sucrose solution (1 M). After centrifugation at 800 ×g for 5 min, the top two layers containing the G. duodenalis cysts were transferred into a clean Falcon tube and the volume adjusted to 50 mL with distilled water. After three consecutive centrifugations at 1000 ×g for five min, an aliquot of the obtained pellet was examined under the light microscope at ×400 magnification. The remaining sediment was kept at −20 °C for downstream molecular analyses.
DNA extraction
Faecal sediments were subjected to seven freeze-thaw cycles consisting of 7 min in liquid nitrogen and 7 min in a boiling water bath to facilitate cyst rupture and parasite DNA extraction. Genomic DNA was purified using the QIAamp DNA stool mini kit (Qiagen, Hilden, Germany) according to the manufacture’s protocol. DNA was eluted in 200 μL of AE buffer and stored at −20 °C until use.
Molecular detection and characterization of Giardia duodenalis
Faecal samples with a positive result for G. duodenalis at microscopy were re-assessed by molecular (including PCR and sequencing) methods. Confirmation of the presence of the parasite was conducted by a nested PCR protocol to amplify a ~130-bp fragment of the small subunit of ribosomal RNA (ssu-rRNA) gene of the parasite as described previously [24]. Primary and secondary reactions were carried out using the outer primer pair RH11 (5´–CATCCGGTCGATCCTGCC–3´) and RH4 (5´–AGTCGAACCCTGATTCTCCGCCAGG–3´), and the inner primer set GiarF (5´–GACGCTCTCCCCAAGGAC–3´) and GiarR (5´–CTGCGTCACGCTGCTCG–3´), respectively. Reaction mixtures included of 2 μL of template DNA both in the primary and secondary PCR reactions. Cycling conditions were identical for the first and second round of PCR, and consisted of an initial denaturation at 95 °C for 3 min, followed by 35 cycles of amplification (denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 60 s), and a final extension at 72 °C for 7 min.
DNA samples with a positive result at ssu-PCR were subsequently investigated using a multilocus genotyping (MLG) scheme based on the amplification of partial sequences of the gdh, the bg, and the tpi genes of G. duodenalis. To amplify a ~432-bp fragment of the gdh gene, a semi-nested PCR was performed as described elsewhere [25]. The protocol included the outer primer set GDHeF (5´–TCAACGTYAAYCGYGGYTTCCGT–3´) and GDHiR (5´–GTTRTCCTTGCACATCTCC–3´), and the inner primer set GDHiF (5´–CAGTACAACTCYGCTCTCGG–3´) and GDHiR (5´–GTTRTCCTTGCACATCTCC–3´). Both PCR reaction mixtures included 5 μl of template DNA. Both the primary and secondary PCRs were carried out as follows: an initial denaturation step of 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s, with a final extension of 72 °C for 7 min.
For the bg gene, a partial sequence of ~511 bp was amplified using the outer primer pair G7 (5´–AAGCCCGACGACCTCACCCGCAGTGC–3´) and G759 (5´–GAGGCCGCCCTGGATCTTCGAGACGAC–3´) and the inner primer pair BG-F (5´–GAACGAACGAGATCGAGGTCCG–3´) and BG-R (5´–CTCGACGAGCTTCGTGTT–3´) as described previously [26]. Reaction mixtures included of 3 μL of template DNA in both PCR rounds. The primary PCR was performed as follows: initial heat activation step at 96 °C for 5 min, 40 cycles of 95 °C for 30 s, 50 °C for 30 s, and 72 °C for 60 s, with a final extension of 72 °C for 7 min. Cycling conditions for the secondary PCR included an initial heat activation step at 96 °C for 5 min followed by 35 cycles of 96 °C for 45 s, 55 °C for 30 s, 72 °C for 45 s, with a final extension of 72 °C for 7 min.
For the tpi gene, a ~530-bp fragment was amplified using the outer primer pair AL3543 (5´–AAATIATGCCTGCTCGTCG–3´) and AL3546 (5´–CAAACCTTITCCGCAAACC–3´), and the inner primer pair AL3544 (5´–CCCTTCATCGGIGGTAACTT–3´) and AL3545 (5´–GTGGCCACCACICCCGTGCC–3´) as described by Sulaiman et al. (2003) [27]. The primary PCR conditions consisted of an initial denaturation step at 94 °C for 5 min followed by 35 cycles of 94 °C for 45 s, 50 °C for 45 s, and 72 °C for 60 s, with a final extension of 72 °C for 10 min. The conditions for the secondary PCR were identical to the primary PCR.
All PCR reactions described above were carried out in a FlexCycler2 PCR Thermal Cycler (Analytik Jena, Jena, Germany). PCR mixtures (25 μL) contained 12.5 μL of 2× Master Mix RED already including Taq DNA polymerase (Ampliqon-Biomol, Hamburg, Germany), 200 nM of each forward and reverse primer, and nuclease-free water. Negative (no DNA template) and positive (known G. duodenalis PCR-positive sample) controls were routinely included in all PCR runs. Secondary PCR products were analysed by electrophoresis on 1.5% agarose gels (Sinacolon, Tehran, Iran) and visualized after ethidium bromide staining.
DNA sequencing and phylogenetic analyses
Obtained gdh, bg, and tpi amplicons of the right size were directly sent for sequencing in both directions using the corresponding internal primer pairs at Microsynth AG (Balgach, Switzerland). Raw sequences were visually inspected using the free software Chromas version 2.1 as quality control and to detect the presence of single nucleotide polymorphisms (SNPs) including double peaks. Obtained consensus sequences were compared with those previously deposited at the National Centre for Biotechnology Information (NCBI) using the BLAST tool (http://www.ncbi.nlm.nih.gov/blast). Assignment of assemblages and sub-assemblages was carried out by sequence alignment using ClustalW in MEGA 6.0 (www.megasoftware.net). A phylogenetic analysis was performed on the sequences obtained in the present survey at the gdh, bg, and tpi loci and previously published sequences of human and animal origin retrieved from GenBank using the Neighbor-Joining (NJ) method. Sequences including heterozygous (di-nucleotide) sites were excluded from the analyses in order to avoid distorting the topology of the phylogenetic trees. Evolutionary relationships were calculated by the Kimura-2-parameter model in MEGA 6.0. The reliability of these trees was assessed by using the bootstrap method with 1,000 pseudoreplicates; only values >70% were reported. Representative sequences at the gdh, bg, and tpi loci generated in the present survey were deposited in GenBank under accession numbers LC504257 to LC504276 and LC505038 to LC505051.
Results
In the present epidemiological study, individual faecal samples were collected from a total of 1,163 volunteers during the sampling period. The male/female ratio was 0.9. The age range of the participating individuals was 2–75 years (mean: 27.3; SD: 19.3). Regarding the place of residence, 43.5% (506/1,163) of the recruited subjects lived in rural settings. Individuals in the age groups <10 years and 31 to 40 years were the most represented in the surveyed population. Most participants lived in households with 4 to 6 (66.0%, 767/1,163) or above (11.3%, 131/1,163) members, respectively. Gastrointestinal symptoms including diarrhoea, bloating and abdominal pain were reported by 22.2% (258/1,163) of the participants at the moment of sampling. Symptoms were predominantly seen (7.3%, 85/1,163) in individuals younger than 10 years of age.
Using conventional microscopy methods, the overall prevalence of G. duodenalis infection was estimated at 7.7% (90/1,163, 95% confidence interval: 6.2% to 9.3%). The distribution of the infection according to the variables (gender, age, area of residence, household size, symptomatology) considered in the study are summarized in Table 1. Briefly, males (9.7%) were significantly more infected by G. duodenalis than females (5.9%) (p = 0.014). Giardia infections were more likely to occur in children under 10 years of age (p < 0.001). No significant correlation was found between the occurrence of giardiasis and the number of family members in each household. Human cases of giardiasis were more frequently found in rural (11.7%, 59/506) than in urban (4.7%, 31/657) areas (p < 0.001). Approximately three out of four cases of giardiasis (74/90) occurred in households with four or more persons. Giardia duodenalis infections were mostly subclinical (57.8%, 52/90) (p < 0.001). Diarrhoea was reported in 10.0% (9/90) of the Giardia-infected individuals.
Shushtar County (Iran), 2017–2018. Estimated p-values are indicated. Regarding the age, the infection rate was compared within the age groups.
Molecular detection and genotyping data
Of the 90 Giardia-positive cases detected by microscopy examination, 82 (91.1%) were confirmed using ssu-PCR. Under the MLG scheme adopted in the present study, successful PCR amplification and sequencing data were achieved for 9.8% (8/82), 8.5% (7/82) and 23.2% (19/82) of the confirmed samples tested at the gdh, bg, and tpi loci, respectively. A total of 24 Giardia-positive samples were genotyped at least at a single locus. MLG data at the three loci tested were available for two samples only (Table 2). Sequencing results revealed that assemblages A and B were equally present (50%, 12/24 each) in the surveyed human population. No A+B mixed infections, nor host-specific assemblages of canine, feline, or livestock (C-F) origin were detected. Overall, AII was the most prevalent sub-assemblage detected (41.7%, 10/24), followed by BIII (25.0%, 6/24), discordant BIII/BIV (5/24) or AII/AIII (2/24) sequences, and BIV (1/24).
Shushtar County (Iran), 2017–2018.
Out of the eight gdh sequences identified five were assigned to the sub-assemblage AII and three were discordant BIII/BIV results. Of the five AII sequences, one showed 100% identity with a previously described reference sequence (GenBank accession number L40510) and the remaining four varied from one to two SNPs with L40510. The three BIII/BIV sequences had 4–14 SNPs, some of them corresponding to polymorphic (double peaks) positions (Table 3).
GenBank accession numbers are provided. Shushtar County (Iran), 2017–2018.
A total of seven bg sequences were generated, of which one was identified as AII (showing 100% identity with AY072723) and two as AIII (showing 100% identity with AY072724). The four sequences assigned to assemblage B at this locus differed by one to six SNPs from reference sequence AY072727. Ambiguous positions were identified in two of these B sequences, but at a mch lower rate than those found at the gdh locus (Table 3).
Multiple sequence alignment analyses of the 19 tpi sequences available revealed the presence of sub-assemblages AII in eight of them, of which one showed 100% identity with reference sequence U57897and the remaining seven differed from it by 1–3 SNPs. Ambiguous (double peaks) positions were detected in two sequences (Table 3). Similar to what was observed at the gdh locus, a high genetic diversity was also present within the tpi sequences assigned to assemblage B. All BIII sequences differed among them and from reference sequence AF069561 by 1–7 SNPs. The only BIV sequence identified at this locus varied from reference sequence AF069560 by 3 SNPs, whereas two additional sequences showed discordant genotype BIII/BIV results, very likely representing mixed infections by both sub-assemblages of the parasite.
Phylogenetic analyses using the NJ method revealed that all sequences generated in the present study at the gdh, bg, and tpi loci grouped in well-defined clusters with appropriate reference sequences and previously published sequences retrieved from GenBank (Figs 1 to 3).
Filled black circles represent gdh sequences generated in the present study. Previously published sequences of human origin and reference sequences retrieved from GenBank were included in the analyses for comparative purposes. Spironucleus vortens was used as outgroup taxa.
Filled black circles represent gdh sequences generated in the present study. Previously published sequences of human origin and reference sequences retrieved from GenBank were included in the analyses for comparative purposes.
Filled black circles represent tpi sequences generated in the present study. Previously published sequences of human origin and reference sequences retrieved from GenBank were included in the analyses for comparative purposes. Spironucleus vortens was used as outgroup taxa.
Discussion
Giardiasis is one of the main causes of diarrhoea, particularly in children under five years of age in the developing world [28]. In Iran, human giardiasis has been reported at infection rates ranging from 5% to 23% in different parts of the country [29]. Documented animal prevalences were 5–16% in goats, 6–20% in sheep, and 4% in cattle [30, 31]; however, molecular epidemiological surveys based on MLG schemes are lacking in the country. The available molecular data on giardiasis in Iran are limited to few studies conducted by PCR-RFLP and nested PCR at the gdh or tpi locus [1, 21, 32, 33]. These surveys coincide to identify assemblage A, sub-assemblage AII as the predominant G. duodenalis genetic variant circulating in Iranian human population. Khuzestan Province, with a prevalence ranging from 2% to 11%, is considered an endemic area for giardiasis in Iran [19, 20, 32, 34–36]. However, available epidemiological data are restricted to people living in urban settings, with those inhabiting rural areas being largely neglected. In addition, previous studies have relied on microscopy examination only, and those using molecular approached were based in single-locus analyses. Therefore, little is known about the frequency and genotypic diversity of G. duodenalis in human and animal populations in the province [19, 20, 34].
An overall G. duodenalis prevalence of near 8% was estimated by microscopy examination in the surveyed general population of Khuzestan Province. This figure is well in the range with those (2–11%) previously reported in this geographical area [19, 20, 32, 34, 35]. In this regard, an average prevalence of 30% has been estimated in a recent systematic review and meta-analysis study focusing in Iranian children populations [37]. Of note, eight out of the 90 Giardia-positive cases detected by microscopy examination could not be confirmed by ssu-PCR. This discrepancy may be due to a number of factors including insufficient amount or suboptimal quality of parasite DNA, or inefficient removal of PCR inhibitors during the DNA extraction and purification process. It is important to bear in mind that the G. duodenalis infection rate reported here is very likely a conservative estimation of the true prevalence of the disease, as the diagnostic sensitivity of conventional microscopy is limited. Based on these data, giardiasis was more frequently detected in children under 10 years of age living in rural settings (28.9%; 26/90). Poorer sanitation facilities and hygienic conditions, limited access to drinking water and more crowded living conditions may account for this higher prevalence of the disease in rural areas compared to those detected in urban areas. In a few studies, G. duodenalis cysts have been identified in surface waters intended for human consumption in north and southwestern Iran [38, 39].
This study presents novel data on the diversity of G. duodenalis among both rural and urban populations in Khuzestan Province, southwestern Iran. Success amplification rates at the gdh, bg, and tpi loci varied from 8% to 23%. These figures were lower than those (51%- 58%) achieved by our research team in a previous survey conducted in Andimeshk County, north of Khuzestan Province [34]. The reasons for these discrepancies are unclear, but limited sensitivities of PCRs based in single-copy genes (as it is the case for the gdh, bg, and tpi loci used in our MLG scheme) may explain, at least partially, this situation. This is probably the main limitation of the present study. It should be noted that previous molecular studies based on ribosomal RNA gene sequence analysis were able to successfully differentiate G. duodenalis sub-assemblages AI and AII from assemblage B [40]. In this regard, in their study Weiss et al. amplified a183-bp DNA fragment of the ssu rRNA gene, a sequence 40% longer than the fragment (130-bp) amplified in our ssu-PCR protocol. In practical terms this means that amplicons obtained by Weiss et al. were more informative (in terms of genetic diversity) than those obtained in the present study. Despite this drawback, single-copy genes provide the necessary discriminatory power to differentiate among different genetic variants within G. duodenalis [41]. This is supported by the fact that the ssu-PCR (based on a multi-copy gene) used for confirmatory purposes in the present survey was able to amplify a much higher number (n = 82) of Giardia-positive samples. The very same problem has been reported in similar studies targeting schoolchildren populations in endemic areas in Angola and Ethiopia [42, 43].
In the present study G. duodenalis assemblages A and B were found at identical proportions in the investigated population. The reported geographical distribution and frequency of G. duodenalis assemblages/sub-assemblages in Iran varies according to the region of the country considered. Thus, assemblage A has been more prevalently found in the north [21], south [18, 44], west [45], southwest [19], and centre of Iran [1], while some studies carried out in southwestern [46] and north western [47, 48] regions of the country reported assemblage B as the predominant assemblage. These discrepancies may be associated to differences in the total number of samples successfully genotyped in each region, or to specific socio-economic and epidemiological factors of the population studied. In many rural areas of Shushtar County, people keep animals at homes [36], suggesting that companion animals may play a role as source of human infections. Previous studies have shown that assemblage A can be divided into sub-assemblages of AI-AIII, and assemblage B into sub-assemblages BIII and BIV [49]. Sub-assemblages AI, AII, BIII, and BIV have all been reported causing infections in humans and other animal host species, and are therefore considered zoonotic [15]. However, the fact that no host-adapted canine (C, D), livestock (E) or feline (F) genotypes have been identified in the present study seem to suggest that most of the Giardia infections reported here are of anthroponotic origin. This hypothesis should be confirmed in future molecular studies investigating the occurrence and molecular diversity of G. duodenalis infections in production and companion animals in this region.
Association between Giardia assemblages and clinical symptoms has been investigated in several molecular surveys with discrepant results [34, 50–53]. Host adaptive immunity driven by G. duodenalis-assemblage specific responses may play a role in the observed differences. In the current study, no significant association was observed between a given assemblage of the parasite and the occurrence of clinical manifestations. Of the 10 cases infected with sub-assemblages AII, one case had diarrhea. This gastrointestinal condition was also present in one out of the six cases infected with sub-assemblage BIII. In an earlier molecular epidemiological study based on gdh-PCR-RFLP conducted in the Khuzestan Province mixed assemblage A+B infections were allegedly reported in 54.0% of the investigated isolates [46]. In contrast, we did not find mixed infections involving different assemblages of the parasite by PCR and sequencing methods. These large differences are likely due to the inherent difficulty of interpreting band profiles after restriction enzyme digestion. Analysis of the sequences obtained at the gdh locus allowed the identification of sub-assemblage AII and discordant genotype BIII/BIV results in 5 (62.5%) and 3 (37.5%) isolates, respectively. Azcona-Gutierrez et al. (2017) genotyped 90 human isolates of G. duodenalis at the gdh and bg genes, reporting discordant genotyping results in one (6%) isolate [54]. In another study conducted by Skhal et al. (2017) discordant genotype results BIII/BIV were reported in four (10%) isolates [55]. Despite the fact that Giardia is believed to be a strictly clonal (asexual) organism, there is evidence for recombination at the telomeres (but not the internal regions) of some of the chromosomes of the parasite [9, 56]. Additional evidence of genetic recombination has been demonstrated at the cellular level in cultured assemblage B trophozoites and in cysts from clinical samples [57], and at the population level within sub-assemblages BIII and BIV [58]. Taken together, these findings may explain the occurrence of discordant genotypes BIII/BIV, as those described in the present survey.
The predominance of sub-assemblage AII in this study confirms previous genotyping data reported from the same region [19, 32, 34], but it is inconsistent with those found by Rafiei et al. showing that sub-assemblage BIII was the predominant genotype among symptomatic and asymptomatic patients [46]. This discrepancy may be due to differences in the transmission route of the parasite, the studied regions, and the studied population including their life style and personal hygienic habits. Sequencing at the bg locus revealed sub-assemblages AII and AIII, and assemblage B in 1 (14.3%), 2 (28.6%), and 4 (57.1%) isolates, respectively. The AII and two of the three AIII isolates showed 100% homology with their specific reference sequences, while the four assemblage B sequences presented a much higher degree of genetic diversity among them. Previous assemblage A sequence analyses have demonstrated approximately 1% genetic divergence between AI and AII sequences, which represent ∼100,000 SNPs [56]. Assemblage A shows large differences in allelic sequence heterozygosity (ASH). Maximum values of 0.25% to 0.35% correspond to sub-assemblage AII isolates AS-98 and AS-175, whereas and ASH <0.01% has been reported for assemblage AI isolate WB. Reasons for this 100-fold difference in ASH values between sub-assemblages are still unknown [6].
In the current study, 65.6% of the surveyed population lived in rural settings. However, the fact that assemblage B and sub-assemblage AII, but not animal-specific sub-assemblage AI, were found circulating in the general population investigated in the present study strongly suggests that giardiasis in the Shushtar County is acquired directly or indirectly from human sources.
Conclusions
This is the first published study conducted by MLG genetically characterize G. duodenalis human isolates in Khuzestan Province, Iran. Results of our MLG analysis indicated a similar frequency of assemblages A and B in the human community living in Khuzestan Province. The results demonstrated no correlation between clinical symptoms and the G. duodenalis assemblage involved in the infection. Lack of sub-assemblage AI in the surveyed population support the hypothesis that most human infections in this geographical area are acquired though anthroponotic sources. Further molecular-based epidemiological studies are needed to corroborate the extent of the findings reported here.
Acknowledgments
The authors would like to thank all the volunteers who have participated in the study. This research project was the M.Sc. thesis of R. Baghlaninezhad.
References
- 1. Hooshyar H, Ghafarinasab S, Arbabi M, Delavari M, Rasti S. Genetic variation of Giardia lamblia isolates from food-handlers in Kashan, Central Iran. Iran J Parasitol 2017; 12(1):83. pmid:28761464
- 2. Ebner J, Koehler AV, Robertson G, Bradbury RS, Jex AR, Haydon SR, et al. Genetic analysis of Giardia and Cryptosporidium from people in Northern Australia using PCR-based tools. Infect Genet Evol. 2015; 36:389–95. Epub 2015/09/01. pmid:26321301.
- 3. Baldursson S, Karanis P. Waterborne transmission of protozoan parasites: review of worldwide outbreaks—an update 2004–2010. Water Res. 2011; 45(20):6603–14. Epub 2011/11/04. pmid:22048017.
- 4. Efstratiou A, Ongerth JE, Karanis P. Waterborne transmission of protozoan parasites: Review of worldwide outbreaks—An update 2011–2016. Water Res. 2017; 114:14–22. Epub 2017/02/20. pmid:28214721.
- 5. Omarova A, Tussupova K, Berndtsson R, Kalishev M, Sharapatova K. Protozoan parasites in drinking water: a system approach for improved water, sanitation and hygiene in developing countries. Int J Environ Res Public Health. 2018; 15(3):495. pmid:29534511.
- 6. Ortega-Pierres MG, Jex AR, Ansell BRE, Svärd SG. Recent advances in the genomic and molecular biology of Giardia. Acta Trop. 2018; 184:67–72. https://doi.org/10.1016/j.actatropica.2017.09.004 pmid:28888474
- 7. Yason JA, Rivera WL. Genotyping of Giardia duodenalis isolates among residents of slum area in Manila, Philippines. Parasitol Res. 2007; 101(3):681–7. Epub 2007/04/03. pmid:17401723.
- 8. Ryan U, Caccio SM. Zoonotic potential of Giardia. Int J Parasitol. 2013; 43(12–13):943–56. Epub 2013/07/17. pmid:23856595.
- 9. Caccio SM, Lalle M, Svard SG. Host specificity in the Giardia duodenalis species complex. Infect Genet Evol. 2017. Epub 2017/12/12. pmid:29225147.
- 10. Stark D, Barratt JL, van Hal S, Marriott D, Harkness J, Ellis JT. Clinical significance of enteric protozoa in the immunosuppressed human population. Clin Microbiol Rev. 2009; 22(4):634–50. Epub 2009/10/14. pmid:19822892 m.
- 11. ogawski ET, Bartelt LA, Platts-Mills JA, Seidman JC, Samie A, Havt A, et al. Determinants and impact of Giardia infection in the first 2 Years of life in the MAL-ED birth cohort. J Pediatric Infect Dis Soc. 2017; 6(2):153–60. Epub 2017/02/17. pmid:28204556
- 12. Erismann S, Diagbouga S, Odermatt P, Knoblauch AM, Gerold J, Shrestha A, et al. Prevalence of intestinal parasitic infections and associated risk factors among schoolchildren in the Plateau Central and Centre-Ouest regions of Burkina Faso. Parasit Vectors. 2016; 9(1):554. Epub 2016/10/21. pmid:27756339.
- 13. Akinkuotu OA, Takeet MI, Otesile EB, Olufemi F, Greenwood SJ, McClure JT. Prevalence and multilocus genotypes of Giardia duodenalis infecting pigs in Ogun state, Nigeria. Infect Genet Evol. 2019; 70:53–60. https://doi.org/10.1016/j.meegid.2019.02.017 pmid:30798034
- 14. Einarsson E, Ma’ayeh S, Svärd SG. An up-date on Giardia and giardiasis. Curr Opin Microbiol. 2016; 34:47–52. https://doi.org/10.1016/j.mib.2016.07.019 pmid:27501461
- 15. Monis PT, Andrews RH, Mayrhofer G, Ey PL. Genetic diversity within the morphological species Giardia intestinalis and its relationship to host origin. Infect Genet Evol. 2003; 3(1):29–38. https://doi.org/10.1016/S1567-1348(02)00149-1 pmid:12797970
- 16. Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. 2011; 24(1):110–40. Epub 2011/01/15. pmid:21233509
- 17. Plutzer J, Ongerth J, Karanis P. Giardia taxonomy, phylogeny and epidemiology: Facts and open questions. Int J Hyg Environ Health. 2010; 213(5):321–33. https://doi.org/10.1016/j.ijheh.2010.06.005 pmid:20619729
- 18. Rayani M, Zasmy Unyah N, Hatam G. Molecular identification of Giardia duodenalis isolates from Fars Province, Iran. Iran J Parasitol. 2014; 9(1):70–8. Epub 2015/02/03. pmid:25642262
- 19. Kasaei R, Carmena D, Jelowdar A, Beiromvand M. Molecular genotyping of Giardia duodenalis in children from Behbahan, southwestern Iran. Parasitol Res. 2018; 117(5):1425–31. Epub 2018/03/16. pmid:29541855.
- 20. Rafiei A, Sadat Roointan E, Samarbaf-Zadeh AR, Shayesteh AA. Genotype analysis of Giardia lamblia isolated from children in ahvaz, southwest of iran. JJM. 2013; 6(3):279–83.
- 21. Babaei Z, Oormazdi H, Akhlaghi L, Rezaie S, Razmjou E, Soltani-Arabshahi S, et al. Molecular characterization of the Iranian isolates of Giardia lamblia: application of the glutamate dehydrogenase gene. Iran J Public Health. 2008; 37(2):75–82.
- 22.
Razmjou E, Hashemi-Hafshejani S, Meamar A, Akhlaghi L. Multilocus genotyping of Giardia duodenalis reveals human-to-human transmission pattern in Tehran, Iran: ESCMID; 25 April 2017. https://www.escmid.org/escmid_publications/escmid_elibrary/.
- 23. Lebbad M, Ankarklev J, Tellez A, Leiva B, Andersson JO, Svard S. Dominance of Giardia assemblage B in Leon, Nicaragua. Acta Trop. 2008; 106(1):44–53. Epub 2008/03/08. pmid:18325480.
- 24. Gillhuber J, Pallant L, Ash A, Thompson RA, Pfister K, Scheuerle MC. Molecular identification of zoonotic and livestock-specific Giardia-species in faecal samples of calves in Southern Germany. Parasit Vector. 2013; 6(1):346.
- 25. Read CM, Monis PT, Thompson RC. Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infect Genet Evol. 2004; 4(2):125–30. Epub 2004/05/26. pmid:15157630.
- 26. Lalle M, Pozio E, Capelli G, Bruschi F, Crotti D, Caccio SM. Genetic heterogeneity at the beta-giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int J Parasitol. 2005; 35(2):207–13. Epub 2005/02/16. pmid:15710441.
- 27. Sulaiman IM, Fayer R, Bern C, Gilman RH, Trout JM, Schantz PM, et al. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg Infect Dis. 2003; 9(11):1444–52. pmid:14718089
- 28. Ramírez JD, Heredia RD, Hernández C, León CM, Moncada LI, Reyes P, et al. Molecular diagnosis and genotype analysis of Giardia duodenalis in asymptomatic children from a rural area in central Colombia. Infect Genet Evol. 2015; 32:208–13. https://doi.org/10.1016/j.meegid.2015.03.015 pmid:25795384
- 29. Taherkhani H, Shariati S, Abdolahi N, Roshandel G. Clinical manifestations of giardiasis in Iran. J Clin Diagn Res 2009; 3(2):1416–8.
- 30. Kiani-Salmi N, Fattahi-Bafghi A, Astani A, Sazmand A, Zahedi A, Firoozi Z, et al. Molecular typing of Giardia duodenalis in cattle, sheep and goats in an arid area of central Iran. Infect Genet Evol. 2019; 75:104021. https://doi.org/10.1016/j.meegid.2019.104021 pmid:31494270
- 31. Jafari H, Jalali MH, Shapouri MS, Hajikolaii MR. Determination of Giardia duodenalis genotypes in sheep and goat from Iran. J Parasit Dis. 2014; 38(1):81–4. Epub 2014/02/08. pmid:24505184
- 32. Mirzavand S, Kohansal K, Beiromvand M. Molecular genotyping of Giardia duodenalis in municipal waste workers in Ahvaz, southwestern Iran. Trop Biomed. 2019; 36(1):44–52.
- 33. Rayani M, Hatam G, Unyah NZ, Ashrafmansori A, Abdullah WO, Hamat RA. Phylogenetic analysis of Giardia lamblia human genotypes in Fars Province, southern Iran. Iran J Parasitol. 2017; 12(4):522–33. Epub 2018/01/11. pmid:29317877
- 34. Mirrezaie E, Beiromvand M, Tavalla M, Teimoori A, Mirzavand S. Molecular genotyping of Giardia duodenalis in humans in the Andimeshk County, southwestern Iran. Acta Parasitol. 2019; 64(2):376–83. Epub 2019/04/11. pmid:30968348.
- 35. Mowlavi G, MirAhmadi H, Rezaeian M, Kia E, Rokni M, Golestan B, et al. Prevalence of intestinal parasites in tribal parts of Khuzestan Province during 2005–07. Govaresh. 2008; 12(4):219–28.
- 36. Beiromvand M, Panabad E, Rafiei A. Status of intestinal parasitic infections among rural and urban populations, southwestern Iran. Asian Pac J Trop Biomed. 2019; 12(3):130–6.
- 37. Daryani A, Hosseini-Teshnizi S, Hosseini S-A, Ahmadpour E, Sarvi S, Amouei A, et al. Intestinal parasitic infections in Iranian preschool and school children: A systematic review and meta-analysis. Acta Tropica. 2017; 169:69–83. https://doi.org/10.1016/j.actatropica.2017.01.019 pmid:28130101
- 38. Rafiei A, Rahdar M, Nourozi RV. Isolation and identification of parasitic protozoa in sampled water from the southwest of Iran. Jundishapur J Health Sci. 2014; 6(4):e23462.
- 39. Mahmoudi MR, Kazemi B, Mohammadiha A, Mirzaei A, Karanis P. Detection of Cryptosporidium and Giardia (oo)cysts by IFA, PCR and LAMP in surface water from Rasht, Iran. Trans R Soc Trop Med Hyg. 2013; 107(8):511–7. Epub 2013/06/06. pmid:23736273.
- 40. Weiss JB, van Keulen H, Nash TE. Classification of subgroups of Giardia lamblia based upon ribosomal RNA gene sequence using the polymerase chain reaction. Mol Biochem Parasitol. 1992; 54(1):73–86. Epub 1992/08/01. pmid:1518534.
- 41. Thompson RCA, Ash A. Molecular epidemiology of Giardia and Cryptosporidium infections. Infect Genet Evol 2016; 40:315–23. https://doi.org/10.1016/j.meegid.2015.09.028 pmid:26458528
- 42. de Lucio A, Amor-Aramendia A, Bailo B, Saugar JM, Anegagrie M, Arroyo A, et al. Prevalence and genetic diversity of Giardia duodenalis and Cryptosporidium spp. among school children in a rural area of the Amhara region, North-West Ethiopia. PLoS One. 2016; 11(7):e0159992. Epub 2016/07/29. pmid:27466809
- 43. Dacal E, Saugar JM, de Lucio A, Hernandez-de-Mingo M, Robinson E, Koster PC, et al. Prevalence and molecular characterization of Strongyloides stercoralis, Giardia duodenalis, Cryptosporidium spp., and Blastocystis spp. isolates in school children in Cubal, Western Angola. Parasit Vectors. 2018; 11(1):67. Epub 2018/01/31. pmid:29378626
- 44. Sarkari B, Ashrafmansori A, Hatam G, Motazedian M, Asgari Q, Mohammadpour I. Genotyping of Giardia lamblia isolates from human in southern Iran. Trop Biomed. 2012; 29(3):366–71. pmid:23018499
- 45. Akbarian A, Sadraie J, Forozandeh M. Evaluattion of Giardia lamblia genetic differences in Khorramabad City and surrounding villages by use of PCR and sequencing. SJKUMS. 2012; 17(2):61–71.
- 46. Rafiei A, Roointan ES, Samarbafzadeh AR, Shayesteh AA, Shamsizadeh A, Borujeni MP. Investigation of possible correlation between Giardia duodenalis genotypes and clinical symptoms in southwest of Iran. Iran J Parasitol. 2013; 8(3):389. pmid:24454431.
- 47. Hazrati Tappeh K, Manafi G, Asgharzadeh M, Manafi F. Incidence of Giardia lamblia subspecies by PCR-RFLP in stool specimens of hospitalized children at Urmia Mutahhari Hospital, West Azerbaijan Province, Iran. Iran J Parasitol. 2014; 9(4):541–7. Epub 2015/03/12. pmid:25759735.
- 48. Fallah E, Nahavandi KH, Jamali R, Poor BM, Asgharzadeh M. Molecular identification of Giardia duodenalis isolates from human and animal reservoirs by PCR-RFLP. J Biol Sci. 2008; 8(5):1–6.
- 49. Andrews RH, Adams M, Boreham PFL, Mayrhofer G, Meloni BP. Giardia intestinalis: Electrophoretic evidence fora species complex. Int J Parasitol. 1989; 19(2):183–90. https://doi.org/10.1016/0020-7519(89)90006-4 pmid:2722391
- 50. Pijnacker R, Mughini-Gras L, Heusinkveld M, Roelfsema J, van Pelt W, Kortbeek T. Different risk factors for infection with Giardia lamblia assemblages A and B in children attending day-care centres. Eur J Clin Microbiol Infect Dis. 2016; 35(12):2005–13. Epub 2016/09/08. pmid:27599710
- 51. Puebla LJ, Núñez FA, Fernández YA, Fraga J, Rivero LR, Millán IA, et al. Correlation of Giardia duodenalis assemblages with clinical and epidemiological data in Cuban children. Infect Genet Evol. 2014; 23:7–12. https://doi.org/10.1016/j.meegid.2014.01.007 pmid:24462623
- 52. Gelanew T, Lalle M, Hailu A, Pozio E, Cacciò SM. Molecular characterization of human isolates of Giardia duodenalis from Ethiopia. Acta Trop. 2007; 102(2):92–9. pmid:17498637
- 53. de Lucio A, Martinez-Ruiz R, Merino FJ, Bailo B, Aguilera M, Fuentes I, et al. Molecular genotyping of Giardia duodenalis isolates from symptomatic individuals attending two major public hospitals in Madrid, Spain. PLoS One. 2015; 10(12):e0143981. Epub 2015/12/08. pmid:26641082.
- 54. Azcona-Gutiérrez JM, de Lucio A, Hernández-de-Mingo M, García-García C, Soria-Blanco LM, Morales L, et al. Molecular diversity and frequency of the diarrheagenic enteric protozoan Giardia duodenalis and Cryptosporidium spp. in a hospital setting in Northern Spain. PloS one. 2017; 12(6):e0178575–e. pmid:28617836.
- 55. Skhal D, Aboualchamat G, Al Mariri A, Al Nahhas S. Prevalence of Giardia duodenalis assemblages and sub-assemblages in symptomatic patients from Damascus city and its suburbs. Infect Genet Evol. 2017; 47:155–60. Epub 2016/12/07. pmid:27919804.
- 56. Adam RD, Dahlstrom EW, Martens CA, Bruno DP, Barbian KD, Ricklefs SM, et al. Genome sequencing of Giardia lamblia genotypes A2 and B isolates (dh and gs) and comparative analysis with the genomes of genotypes A1 and E(WB and Pig). Genome Biol Evol. 2013; 5(12):2498–511. pmid:24307482
- 57. Ankarklev J, Svard SG, Lebbad M. Allelic sequence heterozygosity in single Giardia parasites. BMC Microbiol. 2012; 12:65. Epub 2012/05/05. pmid:22554281
- 58. Siripattanapipong S, Leelayoova S, Mungthin M, Thompson RC, Boontanom P, Saksirisampant W, et al. Clonal diversity of the glutamate dehydrogenase gene in Giardia duodenalis from Thai isolates: evidence of genetic exchange or mixed infections? BMC Microbiol. 2011; 11:206. Epub 2011/09/22. pmid:21933419