Down in the pond: Isolation and characterization of a new Serratia marcescens strain (LVF3) from the surface water near frog’s lettuce (Groenlandia densa)

Ines Friedrich; Bernhard Bodenberger; Hannes Neubauer; Robert Hertel; Rolf Daniel

doi:10.1371/journal.pone.0259673

Abstract

Serratia marcescens is a species that belongs to the family of Yersiniaceae. This family comprises taxa representing opportunistic human- and phytopathogens but also plant growth-promoting rhizobacteria (PGPR). This study describes a novel Gram-negative strain (LVF3^R) of the species Serratia marcescens. The strain was characterized genomically, morphologically, and physiologically. In addition, the potential of the isolate to act as a host strain to assess the diversity of Serratia associated phages in environmental samples was explored. Average nucleotide identity analysis revealed that LVF3^R belongs to the species Serratia marcescens. In silico analysis and ProphageSeq data resulted in the identification of one prophage, which is capable of viral particle formation. Electron microscopy showed cells of a rod-shaped, flagellated morphotype. The cells revealed a length and width of 1–1.6 μm and 0.8 μm, respectively. LVF3^R showed optimal growth at 30 C and in the presence of up to 2% (w/v) NaCl. It exhibited resistances to ampicillin, erythromycin, oxacillin, oxytetracycline, rifampicin, tetracycline, and vancomycin. Genome data indicate that strain S. marcescens LVF3^R is a potential PGPR strain. It harbors genes coding for indole acetic acid (IAA) biosynthesis, siderophore production, plant polymer degradation enzymes, acetoin synthesis, flagellar proteins, type IV secretion system, chemotaxis, phosphorous solubilization, and biofilm formation.

Citation: Friedrich I, Bodenberger B, Neubauer H, Hertel R, Daniel R (2021) Down in the pond: Isolation and characterization of a new Serratia marcescens strain (LVF3) from the surface water near frog’s lettuce (Groenlandia densa). PLoS ONE 16(11): e0259673. https://doi.org/10.1371/journal.pone.0259673

Editor: Chih-Horng Kuo, Academia Sinica, TAIWAN

Received: July 26, 2021; Accepted: October 22, 2021; Published: November 8, 2021

Copyright: © 2021 Friedrich et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The whole-genome shotgun project of Serratia marcescens LVF3R has been deposited at GenBank under the accession numbers CP063229 (chromosome) and CP063230 (plasmid) and BioProject accession number PRJNA669584. BioSample accession number is SAMN16456043. The raw reads have been deposited in the NCBI SRA database under the accession numbers SRR12951277 (Oxford Nanopore) and SRR12951278 (Illumina MiSeq) and BioProject PRJNA669584. The strain has been deposited at the DSMZ under collection number DSM 112280.

Funding: The authors received no specific funding for this work.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The genus Serratia belongs to the order Enterobacterales, which is part of the Gammaproteobacteria, a large and diverse group of facultatively anaerobic, non-spore-forming, Gram-negative, rod-shaped bacteria. Related families are Budviciaceae, Enterobacteriaceae, Erwiniaceae, Hafniaceae, Morganellaceae, Pectobacteriaceae and Yersiniaceae [1]. The genus Serratia is part of the family Yersiniaceae, consisting of the eight genera Chania, Chimaeribacter, Ewingella, Rahnella, Rouxiella, Samsonia, Serratia and Yersinia [1]. Yersiniacea members are described as motile, catalase-positive and unable to produce hydrogen disulfide [1]. To date, the genus Serratia consists of 24 species (LPSN [2] accessed on 28 January 2021), which can be isolated from diverse environments such as soil, plants, animals, insects, and water [3,4].

The genus Serratia is named after the Italian physicist Serafino Serrati and was first discovered in 1819 by Bartolomeo Bizio in Padua, Italy. However, the history of Serratia reaches back to the Middle Ages when it played a role in eucharist miracles. Some Serratia strains produce a red and non-diffusible pigment designated prodigiosin. As they are able to grow on bread, these Serratia may have been used to mimic blood on church bread at the time [5]. Serratia cells are Gram-negative and rod-shaped with rounded ends, and do not form endospores [3], except the potential spore-forming Serratia marcescens subsp. Sakuensis [6]. However, the International Committee on Systematics of Prokaryotes has not yet been able to confirm this [4].

Serratia is frequently associated with animals and plants. It can be isolated from healthy individuals [3] and is associated with conjunctivitis in horses, septicemia in foals, pigs and goats, and mastitis in cows [7,8]. Some strains are opportunistic pathogens causing pneumonia, septicemia, or cutaneous lesions [9,10]. Serratia marcescens account for 1–2% of nosocomial infections in humans, mostly occurring in the respiratory or urinary tract, surgical wounds, and soft tissues [11–13]. On plants, Serratia marcescens strains can cause the cucurbit yellow vine disease (CYVD) in watermelons, pumpkins, and yellow squash, as well as soft-rot disease in the bell pepper [14–16]. Nevertheless, reports of plant-promoting S. marcescens strains also exist [17,18].

Serratia strains can produce industrially relevant extracellular enzymes such as highly active DNA/RNA endonucleases, lipases, proteinases and chitinases [3,19]. The pigment prodigiosin has antibacterial and antitumor properties and is produced by S. marcescens, S. plymuthica and S. rubidaea [3,20,21]. As Serratia species exhibit multiple antibiotic resistances, there is now a revival of interest in phages as therapeutic agents [22].

Phages or bacteriophages are viruses of bacteria. Lytic phages reproduce directly after infection, while temperate phages can integrate into the bacterial genome. There they inactivate, and replicate together with their host, resulting in a prophage and a lysogenic bacterium. A prophage can impart new properties to its host through the addition of its genetic material, thereby protecting it from infection with related and unrelated viruses [23].

Active Serratia bacteriophages can frequently be found in rivers and sewage [24–26]. Serratia phages are often able to infect related genera [27–29]. Lysogeny can frequently be observed within the genus Serratia [3]. To date, the complete genomic sequences of 14 Serratia-associated phages are available (accessed on 28 January 2021) in the NCBI Viral RefSeq database [30]. In order to isolate novel phages from the environment, safe and well-characterized host strains are required. Ideally, these should be non-pathogenic and have no or only few prophages to avoid prophage-induced resistance, which would lead to a strain which cannot be infected by phages.

In a previous study, we succeeded to isolate an environmental Serratia marcescens strain which originated from an oligotrophic pond in Göttingen, Germany (51° 33’ 59" N 9° 56’ 22" E 230 m, collected on 18 September 2018). The Serratia strain was isolated as potential model strain to study the local viral diversity associated with it. While 16S rRNA gene analysis confirmed its species assignment, no further characterization has been done previously [31].

In this study, an environmental Serratia marcescens isolate is characterized morphologically, physiologically and genomically. In addition, its potential as a host strain to access the environmental diversity of Serratia associated phages is explored.

Material and methods

Isolation of Serratia marcescens LVF3 strain, DNA extraction, and 16S rRNA gene sequencing

Serratia marcescens LVF3^R was isolated from the surface water near frog’s lettuce (Groenlandia densa) from an oligotrophic pond located in the northern part of Weende, Göttingen, Germany [31]. In this study, no specific permissions were required for the location, which is a public pond in Göttingen outside of any protected area. As culture medium, 25 mL TSB-10 (1.7% peptone from casein, 0.3% peptone from soybean, 0.25% K₂HPO₄, 1% NaCl, 0.25% glucose monohydrate) were used. DNA was extracted as described by Friedrich et al., 2021 [31].

Genome and prophage sequencing, assembly, and annotation

The genome and prophages were sequenced, assembled and annotated as described in Friedrich et al. 2021. In brief, Illumina paired-end sequencing libraries were prepared using the Nextera XT DNA Sample Preparation kit and sequenced using the MiSeq System and Reagent Kit version 3 (2 x 300 bp) according to the manufacturer’s recommendations (Illumina, San Diego, CA, USA) [31]. For Nanopore sequencing, the Ligation Sequencing Kit (SQK-LSK109) and the Native Barcode Expansion Kit EXP-NBD114 (Barcode 14; Oxford Nanopore Technologies, Oxford, UK) were used [31].

Potential CRISPR regions were identified with CRISPRFinder [32]. Assembled genomes were quality-checked with CheckM v1.1.2 [33]. Genome annotation was performed by the NCBI (National Centre for Biotechnological Information) using the Prokaryotic Genome Annotation Pipeline v4.13 (PGAP) [34].

The whole-genome sequence of Serratia marcescens LVF3^R has been deposited at GenBank under the accession numbers CP063229 (chromosome) and CP063230 (plasmid). The BioProject with the accession number PRJNA669584 contains the BioSample SAMN16456043. The raw reads have been deposited in the NCBI SRA database under the accession numbers SRR12951277 (Oxford Nanopore) and SRR12951278 (Illumina MiSeq) and BioProject PRJNA669584. The strain has been deposited at the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany) under collection number DSM 112280.

Phylogenetic classification of Serratia marcescens LVF3^R

To provide an initial taxonomic classification of the Serratia marcescens isolate, the Genome Taxonomy Database Toolkit (GTDB-Tk) v1.0.2 [35] was used as well a whole-genome-based phylogeny with Type (Strain) Genome Server (TYGS [36], accessed on 31 January 2021). In-depth phylogenetic analysis was done with the ANIm method included in pyani v0.2.10 [37]. A species boundary of 95% ANI was used [35]. The isolate was compared to all available type strain and reference genomes based on the lists of the DSMZ and the NCBI (accessed on 28 April 2021): Enterobacter asburiae ATCC 35953^T (PRJNA285282), Kluyvera cryocrescens NBRC 102467^T (PRJDB285), Raoultella planticola ATCC 33531^T (PRJNA65511), Raoultella planticola DSM 2688^R (PRJNA500331), Serratia ficaria NBRC 102596^T (PRJDB1514), S. inhibens S40^T (PRJNA491277), S. liquefaciens ATCC 27592^T (PRJNA208332), S. marcescens ATCC 13880^T (PRJNA59561), S. marcescens subsp. sakuensis KCTC 42172^T (PRJNA484649), S. nematodiphila DSM 21420^T (PRJNA257492), S. plymuthica NBRC 102599^T (PRJDB268), S. proteamaculans CCUG 14510^T (PRJNA563568), S. quinivorans NCTC 11544^T (PRJEB6403), S. rubidae NBRC 103169^T (PRJDB269), Serratia sp. S119^R (PRJNA342012) and Skermanella stibiiresistens SB22^T (PRJNA214805).

Comparative genomics

Metabolic capabilities of LVF3^R were investigated using BlastKOALA v2.2 [38] (S2 Fig). Putative secondary metabolite biosynthetic gene clusters were identified with antiSMASH v6.0.0b [39,40]. Putative phage regions were identified with PHASTER [41]. Antibiotic resistance annotation was investigated through Resfams v1.2.2 [42].

Cell morphology and Gram staining procedure

Colony morphology was studied by microscopy (Primo Star, Zeiss, Carl Zeiss Microscopy, Jena, Germany) of single colonies (4X magnification) after growth on TSA-10 solid medium (Fluka, Munich, Germany) for 24 h. A Gram staining analysis was performed using Hucker’s crystal violet, an iodine and safranin solution and 1-propanol [43]. Microscopy images and staining were processed and evaluated with the software ZEISS Labscope (Carl Zeiss).

Transmission electron microscopy

Cell morphology of LVF3^R was assessed by transmission electron microscopy (TEM). Data were imaged onto the screen using the digital Micrograph software (Gatan GmbH, Munich, Germany). The isolate was grown in liquid TSB-10 medium overnight at 30°C. Afterwards, a negative staining technique was performed. For this purpose, 5 μL cell suspension were mixed with the same amount of diluted 0.5% phosphotungstic acid (3% stock, pH 7) and were transferred to a vaporized carbon mica for 1 min. The mica was washed briefly with demineralized water and transferred to a thin copper-coated grid (PLANO GmbH, Marburg, Germany). The coated grids were dried at room temperature and examined through a Jeol 1011 TEM (Georgia Electron Microscopy, Freising, Germany).

Determination of salt tolerance and temperature optimum

For the determination of the salt tolerance, LVF3^R was inoculated in 4 mL TSB medium amended with 0, 5 and 10 to 100 g/L NaCl in increments of 10 g. The optical density of the cell suspensions was measured using the Ultraspec 3300 pro photometer (Amersham Pharmacia Biotec Europe GmbH, Munich, Germany) at a wavelength of 600 nm (OD₆₀₀). OD₆₀₀ of the cell suspensions were set to 0.3 at the beginning of the experiment [44], followed by an incubation period of 3 h at 30°C and 180 rpm in a Infors HT shaker (Orbitron, Einsbach, Germany). After 3 h incubation, the OD₆₀₀ was measured and the initial OD subtracted to assess growth [44]. All measurements were performed in biological replicates.

To quantify the temperature optimum, the isolate was grown in 4 mL TSB-10 medium at 10°C, 20°C, 30°C, 37°C, 40°C and 50°C at 180 rpm. The starting OD₆₀₀ of the cell cultures was set to 0.1. The optical cell density of LVF3^R was measured after 3 h. The collected data was illustrated with R studio version 4.0.0 [45] using ggplot2 package [46].

Determination of growth kinetics

The growth kinetics in liquid cultures were measured with the cell growth quantifier (CGQuant 8.1) (Aquila Biolabs GmbH, Baesweiler, Germany) at 30°C for 47 h. 25 mL of LVF3^R with a final OD₆₀₀ of 0.1 in TSB-10 medium were filled into 250 mL shake flasks. All flasks were mounted onto the CGQuant sensor plate and were shaken for 47 h. The CGQuant enables a dynamic approach of backscattered light measurement, monitoring the growth of the liquid cultures in real-time [47]. All measurements were performed as biological replicates. All collected data were illustrated with R studio version 4.0.0 [45] using ggplot2 package [48].

Metabolic activity and antibiotic resistances

Metabolic activities were identified using API ZYM and API 20 E tests (BioMérieux, Nuertingen, Germany). Both tests were performed according to the instructions of the manufacturer. Catalase activity was determined using 3% H₂O₂ [49]. For determination of antibiotic resistances, a soft-agar (0.4% (w/v) agarose in TSA-10 medium) overlay technique was used with discs, and strips (Oxoid, Thermo Fisher Scientific) containing ampicillin (25 μg), chloramphenicol (30 μg), doxycycline (30 μg), erythromycin (10 μg), kanamycin (30 μg), oxytetracycline (30 μg), rifampicin (2 μg), streptomycin (10 μg), vancomycin (30 μg), meropenem (0.002–32 μg), and oxacillin (0.015–256 μg). Soft agar (2.5 mL) was used to inoculate the isolates with a final OD₆₀₀ of 0.1. Afterwards, discs or strips were placed on the soft agar. All plates were incubated overnight at 30°C.

Plaque assay with sewage water

For phage enrichment, the same procedure was conducted as described by Willms & Hertel, 2016 [50] and Willms et al., 2017 [51]. After incubation, different plaque morphologies such as clear or turbid, the size of plaques, and the presence or absence of a halo were differentiated. Generally, the performance of a plaque assay requires the ability of the host to grow in bacterial lawns [52].

Results and discussion

Morphological characterization

Grown on TSA-10 medium agar LVF3^R revealed round cream-white colonies with an average diameter of 0.340 mm (S3 Fig). A Gram staining of LVF3^R resulted in pink stained cells (S4 Fig), indicating a Gram-negative type. The cells’ size ranged from 1–1.6 μm, with epileptic and short cells or straight rods with rounded ends (Fig 1A). The isolate displays a typical morphological characteristic of the Serratia genus, such as motility by means of polar flagella, a cell size that ranges from 0.9–2.0 μm and rod-shaped cells with rounded ends [3]. Further, phage particles, presumably originating from activated prophages, could be observed in the bacterial culture (Fig 1B).

Download:

Fig 1. Transmission electron microscopy images of LVF3^R.

The micrograph (A) shows the typically observed cell morphotypes of S. marcescens strain LVF3^R. Micrograph (B) shows S. marcescens LVF3^R surrounded by its active prophages. Cells were grown for 24 h at 30°C in TSB-10 medium, negatively stained and used for TEM analysis.

https://doi.org/10.1371/journal.pone.0259673.g001

Physiological characterization

LVF3^R showed growth up to 10% (w/v) NaCl in TSB medium with an optimum between 0–2% (w/v) NaCl (Fig 2A). The LVF3^R strain was able to grow at a temperature range between 20 and 40°C, which is indicative of a mesophilic organism. The highest cell densities were observed at 30°C with an OD₆₀₀ of 2.670 (which is a ratio of 8.9) (Fig 2B). This observation is in good agreement with data obtained from related strains [3].

Download:

Fig 2. S. marcescens LVF3^R growth properties.

(A) Growth of LVF3^R in 4 mLTSB medium with different salt concentrations after 3 h incubation at 180 rpm and 30°C. (B) LVF3^R growth in TSB-10 medium at different temperatures after 3 h incubation at 180 rpm. (C) Growth analysis of LVF3^R at the optimum temperature (30°C) in 25 mL TSB-10 medium. Measurements were performed in triplicate. The standard deviation in (A) and (B) is shown as error bars. In (C) different shades of purple indicate each replicate.

https://doi.org/10.1371/journal.pone.0259673.g002

The growth kinetics of LVF3^R were determined under optimal salt and temperature conditions (Fig 2C). The isolate enters the log phase after a lag phase of approximately three hours which continued for 12 hours until entering a transient phase with reduced growth. Maximum cell densities were observed after around 28 h of cultivation. After the culture reached its peak of maximum growth, cell densities decline, indicating cell-lysis. LVF3^R has a doubling time of 304 minutes and a growth rate μ of 0.14 h^-1.

The metabolic capabilities of LVF3^R were analyzed by using the API ZYM and the API 20 E tests. Twenty different enzyme activities were determined via API ZYM for the S. marcescens isolate. In 13 cases, no enzymatic activity could be determined. The remaining enzymes activities comprised alkaline phosphatase, esterase, esterase lipase, leucine arylamidase, acid phosphatase, naphthol-AS-BI-phosphohydrolase and β-galactosidase activity. Enzymes such as alkaline phosphatase and β-galactosidase were confirmed in the genome playing a role in signaling and cellular processes as well galactose metabolism were confirmed by genome analysis (S1 Table). The alkaline phosphatase is part of the periplasm, whereas the β-galactosidase is part of the outer membrane in Serratia marcescens [53]. Interestingly, strain LVF3^R is able to utilize urea, which has previously only been described in Serratia ureilytica [54]. LVF3^R was oxidase-negative and catalase-positive, which is characteristic for the Yersiniaceae family [1]. A general overview of all enzymatic activities of the strain and closely related strains from TYGS [36] is listed in Table 1. LVF3^R is capable of D-glucose fermentation/oxidation. The antibiogram (S5 Fig) showed that LVF3^R is resistant to ampicillin (25 μg/disc), erythromycin (10 μg/disc), oxytetracycline (30 μg/disc), rifampicin (2 μg/disc), tetracycline (30 μg/disc), vancomycin (30 μg/disc), oxacillin (256 μg/disc) and meropenem (until 0.06 μg/disc). Resfams in silico analysis [42] identified genes encoding an ABC transporter for erythromycin or vancomycin (PRJNAA669584|IM817_08890), an MFS transporter for tetracycline or oxytetracycline (IM817_13485), β-lactamases for meropenem (IM817_13270), oxacillin and ampicillin inactivation (IM817_09360), and an efflux pump system of the RND family putatively exporting rifampicin (IM817_09370; S2 Table). The antibiogram as well the congruent in silico investigation of strain LVF3^R, showed a resistance potential to medically relevant antibiotics. Serratia marcescens LVF3^R shows a different antibiogram compared to its phylogenetically closest relatives. It is not resistant to chloramphenicol, doxycycline, kanamycin, meropenem and streptomycin. Like S. marcescens DSM 17174^R and S. nematodiphila DSM 21420^T, LVF3^R is not resistant to chloramphenicol, kanamycin, and streptomycin. Ampicillin and oxacillin resistance seem to be unique to our isolate (Table 1).

Download:

Table 1. Phenotypic characteristics of strain LVF3^R and phylogenetically related species Serratia sp. S119^R, S marcescens ATCC 13880^T, S. marcescens DSM 17174^R, S. nematodiphila DSM 21420^T.

https://doi.org/10.1371/journal.pone.0259673.t001

Interestingly, non-pigmented strains of S. marcescens are usually more resistant to antibiotics than pigmented strains as they often harbor resistance plasmids [59]. No potential genes encoding antibiotic resistance were detected in the plasmid sequence of strain LVF3^R. Environmental Serratia marcescens strains are resistant to colistin, cephalothin, ampicillin, tetracycline, and nitrofurantoin [3]. Strain LVF3^R does not produce the red-pigmented antibiotic prodigiosin. This is in agreement with the genome analysis as genes of the pig cluster encoding the biosynthesis of prodigiosin [60]. were not detected. In a study by Haddix & Shanks (2018), pigmented cells were shown to have twice the biomass yield of non-pigmented S. marcescens strains [61]. Furthermore, LVF3^R appears to produce secondary metabolites such as the antibiotic andrimid, the cyclic lipopeptide orfamide and the O-antigen of lipopolysaccharides (S3 Table). Andrimid production was also detected in the plant-associated Serratia plymuthica A153 and Serratia marcescens MSU97 [62,63]. Orfamide as a bioactive compound may be released for plant protection [64]. The O-antigen of lipopolysaccharides is responsible for a normal growth rate in plants such as tomatoes [65].

Comparisons of the LVF3^R genome to the genomes of the phylogenetically most closely related strain Serratia sp. S119^R and the PGPR strain Serratia marcescens UENF-22GI showed that they share numerous plant-growth promoting genes (49 with S119^R and 11 with UENF-22GI). These genes code for components of indole acetic acid (IAA) biosynthesis, siderophore production, plant polymer degradation enzymes, acetoin synthesis, flagellar proteins, type IV secretion system, chemotaxis, phosphorous solubilization, and biofilm formation (S4 Table). All of these genes are known to provide important plant growth-promoting properties [55,66]. Serratia sp. S119^R, a known biofertilizer for peanut and maize, is closely related to LVF3^R with 96.08% average nucleotide identity (S5 Table). Based on these results, the environmental origin of isolation (surface water near frog’s lettuce) and the detected physiological properties, it is indicated that Serratia marcescens strain LVF3 has the potential to promote plant growth.

Genomic characterization

Genome.

Genome sequencing using Illumina and Oxford Nanopore technologies resulted in a high-quality closed genome (S6 Table). The genome of LVF3^R consists of one circular chromosome (5,440,698 bp) with a GC-content of 59.29% and one circular plasmid (87,710 bp) with a GC-content of 53.27%. The difference in GC content (6.02%) suggests that the plasmid was obtained recently. The chromosome has a 285.9-fold and the plasmid a 418.7-fold coverage, implying that the plasmid is present in two copies per cell. The chromosome encodes 5,159 protein-encoding genes, 129 rRNAs and 92 tRNAs. The plasmid encodes 94 protein-encoding genes. No CRISPR regions were detected. Genomic characteristics are listed in Table 2.

Download:

Table 2. Genome statistics of the LVF3^R chromosome and p87710 plasmid.

https://doi.org/10.1371/journal.pone.0259673.t002

Whole-genome phylogeny.

Initial taxonomic assignment of strain LVF3^R was performed with GTDB-Tk pipeline [35]. It revealed an average nucleotide identity (ANI) of approximately 96% to the closest related species Serratia marcescens (ANI value of 96.3). This supports LVF3^R’s assignment to the species S. marcescens (S6 Table). However, taxonomic assignment of LVF3^R employing the Type Strain Genome Server (TYGS) suggests that our strain is a potential new species, although the calculated digital DNA-DNA hybridization (dDDH) value is 73.3%, showing close relationship with the type strain Serratia marcescens ATCC 13880 (S1 Fig; S7 Table). The threshold for a new species is below 70% dDDH [67]. ANI-analysis using the 15 closest related type strain genomes derived from the TYGS database [36] as well as the genome of the reference strain (Serratia sp. S119) is shown in Fig 3 (data in S6 Table).

Download:

Fig 3. Genome-based phylogenetic analysis of Serratia marcescens LVF3^R.

All genomes from available type strains (T) included in the TYGS database [36] and a representative strain (R) from the genus Serratia were examined. Calculations were done with pyani [37,68] using ANIm method with default parameters. LVF3^R is depicted in bold red.

https://doi.org/10.1371/journal.pone.0259673.g003

The genome of strain LVF3^R builds a cluster with the type strains S. marcescens ATCC 13880, S. nematodiphila DSM 21420 and S. marcescens subsp. sakuensis KCTC 42172, and the reference strain Serratia sp. S119. LVF3^R shares the closest average nucleotide identity with Serratia sp. S119^R (96.08%) and S. marcescens ATCC 13880^T (95.33%).

Based on the results of TYGS, GTDB-Tk and ANI analyses, we suggest that strain LVF3 belongs to the species Serratia marcescens.

Prophages.

The prophage potential of LVF3^R was of particular interest as the strain represents a potential host system for studying phage diversity in the environment. Prophage region were initially analyzed using PHASTER [41], revealing two putative prophage regions (region 1: 2,088,804–2,147,829; region 2: 2,353,448–2,400,701). The regions comprised 59.0 and 47.2 kb and were classified as intact (S7 Table).

Sequence data of phage particle-packed dsDNA was mapped to the LVF3^R genome using ProphageSeq [69] (Fig 4). Prophage activity is indicated when prophage reads accumulate closely associated with the PHASTER-predicted prophage regions. The coverage profile exhibits an even distribution of reads with a substantial coverage increase from base 2,089,081 to 2,143,727 (Fig 4). As the PHASTER-predicted prophage region one was annotated with a preceding start site, the precise location of prophage one was investigated. Reads obtained from particle-packed dsDNA were used for genome assembly. This resulted in one circular contig with a size of 45,631 bp representing the phage genome of the identified prophage. Comparison of the phage genome with the chromosome of LVF3^R enabled us to precisely locate the corresponding prophage region. Thus, prophage one is located between 2,098,352 and 2,144,007 bp flanked by perfect direct repeats of 25 bp (5’ AGGAATCGTATTCGGTCTTTTTTTG), which represented the attL and attR sites. For prophage two, neither a pronounced sequence accumulation was observed at the predicted prophage region, nor was it possible to assemble the respective phage genome.

Download:

Fig 4. Read coverage profile of sequenced LVF3^R prophages, mapped onto its corresponding host genome.

The blue arrows depict the prophage regions predicted by PHASTER [41]. Green arrows indicate the experimentally verified prophage region. The image displays the read coverage of the genome between base 2,022,912 to 2,5011,011 (478,099 kb).

https://doi.org/10.1371/journal.pone.0259673.g004

In conclusion, one prophage region was experimentally confirmed as particle-forming and capable of packing its genome. The second predicted prophage was unable to form particles under the employed experimental conditions. As prophages can mediate resistance against related phages, a low number or absence of prophages in the genome is required for a potential host strain employed for phage isolation [23] and covering viral diversity in an isolation experiment.

Strain suitability for phage isolation.

So far, S. marcescens strain LVF3^R has proven to be an easy-to-cultivate organism with simple growth requirements and few intrinsic antibiotic resistances. This provides a good basis for making it a potential working strain in molecular biology. In a next step, we aimed to assess its potential as host strain for environmental phage isolations. For this purpose, LVF3^R was infected with a viral suspension derived from raw sewage. An overlay plaque assay was employed to analyze the infected cells (Fig 5). Results revealed diverse plaque morphologies corresponding to different phages, thus confirming the suitability of S. marcescens LVF3^R as a host strain for phage isolation,

Download:

Fig 5. Host strain LVF3 challenged with metaviral sample.

Different plaque morphologies can be observed.

https://doi.org/10.1371/journal.pone.0259673.g005

Conclusion

In the framework of this study, the novel Serratia strain LVF3R was characterized and determined to be a suitable host strain for environmental phage isolation as it only contains one active and one degenerated prophage in its genome. Further, we could confirm that our strain showed after infection with a viral pool, a high phage diversity. The viral diversity associated with this strain will be the subject of future studies.

Supporting information

S1 Fig. Phylogenetic classification of Serratia marcescens strain LVF3.

https://doi.org/10.1371/journal.pone.0259673.s001

(PDF)

S2 Fig. Visualization of functional categories through BlastKoala (Kanehisa et al., 2016) [38] for Serratia marcescens LVF3^R.

Functional categories of (A) chromosome and (B) plasmid can be seen by the presented color code.

https://doi.org/10.1371/journal.pone.0259673.s002

(PDF)

S3 Fig. Colony morphotype of Serratia marcescens LVF3^R.

Growth experiments were performed using TSA-10 agar plates.

https://doi.org/10.1371/journal.pone.0259673.s003

(PDF)

S4 Fig. Gram staining of Serratia marcescens LVF3^R.

https://doi.org/10.1371/journal.pone.0259673.s004

(PDF)

S5 Fig.

Analysis of antibiotic resistances through soft-agar assay with discs (A) and strips (B). Exemplarily, antibiotic resistance of isolate LVF3R is indicated by halo formation. Incubation took place overnight at 30°C. (A) Meropenem (0.002–32 μg), and (B) kanamycin (30 μg), chloramphenicol (30 μg), streptomycin (10 μg) and rifampicin (2 μg) were used as antibiotics.

https://doi.org/10.1371/journal.pone.0259673.s005

(PDF)

S1 Table. KEGG Mapper Reconstruction Result of Serratia marcescens LVF3^R.

https://doi.org/10.1371/journal.pone.0259673.s006

(XLSX)

S2 Table. Resfams prediction of Serratia marcescens LVF3^R.

https://doi.org/10.1371/journal.pone.0259673.s007

(XLSX)

S3 Table. List of putative biosynthetic gene clusters in Serratia marcescens LVF3^R.

https://doi.org/10.1371/journal.pone.0259673.s008

(XLSX)

S4 Table. Comparison of putative genes involved in important plant growth promoting traits of Serratia marcescens LVF3R, Serratia sp. S119^R and Serratia marcescens UENF-22GI.

Table was modified from Ludueña et al., 2017 and Matteoli et al., 2018. In purple: Potential plant growth promoting gene products encoded by the genome of LVF3^R. References: Ludueña LM, Anzuay MS, Angelini JG, McIntosh M, Becker A, Rupp O, et al. Strain Serratia sp. S119: A potential biofertilizer for peanut and maize and a model bacterium to study phosphate solubilization mechanisms. Appl Soil Ecol. 2017;126:107–12. Matteoli FP, Passarelli-Araujo H, Reis RJA, da Rocha LO, de Souza EM, Aravind L, et al. Genome sequencing and assessment of plant growth-promoting properties of a Serratia marcescens strain isolated from vermicompost. BMC Genomics. 2018;19:750.

https://doi.org/10.1371/journal.pone.0259673.s009

(XLSX)

S5 Table. Phylogenetic analysis for Serratia marcescens LVF3^R.

https://doi.org/10.1371/journal.pone.0259673.s010

(XLSX)

S6 Table. GTDB-Tk of Serratia marcescens LVF3^R isolate.

https://doi.org/10.1371/journal.pone.0259673.s011

(XLSX)

S7 Table. Pairwise comparisons of LVF3 against type strain genomes from TYGS (Meier-Kolthoff and Göker, 2019).

Reference: Meier-Kolthoff JP, Göker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat Commun. 2019;10:2182.

https://doi.org/10.1371/journal.pone.0259673.s012

(XLSX)

S8 Table. PHASTER analysis of Serratia marcescens LVF3^R.

https://doi.org/10.1371/journal.pone.0259673.s013

(XLSX)

Acknowledgments

We thank Dr. Anja Poehlein for sequencing, Sarah-Theresa Schüßler and Mechthild Bömeke for technical assistance, Dr. Dominik Schneider for his help with bioinformatics and Dr. Michael Hoppert for support with TEM-imaging. We thank Avril von Hoyningen-Huene for her diligent proofreading of this paper. We also acknowledge support by the Open Access Publication Funds of the University of Göttingen.

References

1. Adeolu M, Alnajar S, Naushad S, S. Gupta R. Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Int J Syst Evol Microbiol. 2016;66:5575–99. pmid:27620848
- View Article
- PubMed/NCBI
- Google Scholar
2. Parte AC, Carbasse JS, Meier-Kolthoff JP, Reimer LC, Göker M. List of prokaryotic names with standing in nomenclature (LPSN) moves to the DSMZ. Int J Syst Evol Microbiol. 2020;70:5607–12. pmid:32701423
- View Article
- PubMed/NCBI
- Google Scholar
3. Grimont PAD, Grimont F. The genus Serratia. Annu Rev Microbiol. 1978;32:221–48. pmid:360966
- View Article
- PubMed/NCBI
- Google Scholar
4. Mahlen SD. Serratia infections: from military experiments to current practice. Clin Microbiol Rev. 2011;24:755–91. pmid:21976608
- View Article
- PubMed/NCBI
- Google Scholar
5. Bennett JW, Bentley R. Seeing red: the story of prodigiosin. Adv Appl Microbiol. 2000;47:1–32. pmid:12876793
- View Article
- PubMed/NCBI
- Google Scholar
6. Ajithkumar B, Ajithkumar VP, Iriye R, Doi Y, Sakai T. Spore-forming Serratia marcescens subsp. sakuensis subsp. nov., isolated from a domestic wastewater treatment tank. Int J Syst Evol Microbiol. 2003;53:253–8. pmid:12656181
- View Article
- PubMed/NCBI
- Google Scholar
7. Carter ME, Chengappa MM. Enterobacteria. In: Diagnostic Procedure in Veterinary Bacteriology and Mycology. Elsevier; 1990. p. 107–28.
8. Wijewanta E, Fernando M. Infection in goats owing to Serratia marcescens. Vet Rec. 1970;87:282–4. pmid:4919387
- View Article
- PubMed/NCBI
- Google Scholar
9. Manfredi R, Nanetti A, Ferri M, Chiodo F. Clinical and microbiological survey of Serratia marcescens infection during HIV disease. Eur J Clin Microbiol Infect Dis. 2000;19:248–53. pmid:10834812
- View Article
- PubMed/NCBI
- Google Scholar
10. Ray U, Dutta S, Chakravarty C, Sutradhar A. A case of multiple cutaneous lesions due to Serratia marcescens in an immunocompromised patient. JMM Case Rep. 2015;2:1–4.
- View Article
- Google Scholar
11. Khanna A, Khanna M, Aggarwal A. Serratia marcescens–a rare opportunistic nosocomial pathogen and measures to limit its spread in hospitalized patients. J Clin Diagn Res. 2013;7:243–6. pmid:23543704
- View Article
- PubMed/NCBI
- Google Scholar
12. Abreo E, Altier N. Pangenome of Serratia marcescens strains from nosocomial and environmental origins reveals different populations and the links between them. Sci Rep. 2019;9:1–8. pmid:30626917
- View Article
- PubMed/NCBI
- Google Scholar
13. Maki DG, Hennekens CG, Phillips CW, Shaw WV, Bennett JV. Nosocomial urinary tract infection with Serratia marcescens: an epidemiologic study. J Infect Dis. 1973;128:579–87. pmid:4588701
- View Article
- PubMed/NCBI
- Google Scholar
14. Rascoe J, Berg M, Melcher U, Mitchell FL, Bruton BD, Pair SD, et al. Identification, phylogenetic analysis, and biological characterization of Serratia marcescens strains causing cucurbit yellow vine disease. Phytopathology. 2003;93:1233–9. pmid:18944322
- View Article
- PubMed/NCBI
- Google Scholar
15. Sikora EJ, Bruton BD, Wayadande AC, Fletcher J. First report of the cucurbit yellow vine disease caused by Serratia marcescens in watermelon and yellow squash in Alabama. Plant Dis. 2012;96:761. pmid:30727534
- View Article
- PubMed/NCBI
- Google Scholar
16. Gillis A, Rodríguez M, Santana MA. Serratia marcescens associated with bell pepper (Capsicum annuum L.) soft-rot disease under greenhouse conditions. Eur J Plant Pathol. 2013;138:1–8.
- View Article
- Google Scholar
17. Khan AR, Park GS, Asaf S, Hong SJ, Jung BK, Shin JH. Complete genome analysis of Serratia marcescens RSC-14: a plant growth-promoting bacterium that alleviates cadmium stress in host plants. PLOS ONE. 2017;12:1–17. pmid:28187139
- View Article
- PubMed/NCBI
- Google Scholar
18. Devi KA, Pandey P, Sharma GD. Plant growth-promoting endophyte Serratia marcescens AL2-16 enhances the growth of Achyranthes aspera L., a medicinal plant. Hayati. 2016;23:173–80.
- View Article
- Google Scholar
19. Monreal J, Reese ET. The chitinase of Serratia marcescens. Can J Microbiol. 1969;15:689–96. pmid:4894282
- View Article
- PubMed/NCBI
- Google Scholar
20. Ibrahim D, Nazari TF, Kassim J, Lim SH. Prodigiosin—an antibacterial red pigment produced by Serratia marcescens IBRL USM 84 associated with a marine sponge Xestospongia testudinaria. J Appl Pharm Sci. 2014;4:1–6.
- View Article
- Google Scholar
21. Hong B, Prabhu VV, Zhang S, van den Heuvel APJ, Dicker DT, Kopelovich L, et al. Prodigiosin rescues deficient p53 signaling and antitumor effects via upregulating p73 and disrupting its interaction with mutant p53. Cancer Res. 2014;74:1153–65. pmid:24247721
- View Article
- PubMed/NCBI
- Google Scholar
22. Parmar KM, Dafale NA, Tikariha H, Purohit HJ. Genomic characterization of key bacteriophages to formulate the potential biocontrol agent to combat enteric pathogenic bacteria. Arch Microbiol. 2018;200:611–22. pmid:29330592
- View Article
- PubMed/NCBI
- Google Scholar
23. Kohm K, Hertel R. The life cycle of SPβ and related phages. Arch Virol. 2021;166:2119–30. pmid:34100162
- View Article
- PubMed/NCBI
- Google Scholar
24. Bhetwal A, Maharjan A, Shakya S, Satyal D, Ghimire S, Khanal PR, et al. Isolation of potential phages against multidrug-resistant bacterial isolates: promising agents in the rivers of Kathmandu, Nepal. Biomed Res Int. 2017;1–10. pmid:29359149
- View Article
- PubMed/NCBI
- Google Scholar
25. Frederick GL, Lloyd BJ. Evaluation of bacteriophage as a tracer and a model for virus removal in waste stabilization ponds. Water Sci Technol. 1995;31:291–302.
- View Article
- Google Scholar
26. Matsushita K, Uchiyama J, Kato S, Ujihara T, Hoshiba H, Sugihara S, et al. Morphological and genetic analysis of three bacteriophages of Serratia marcescens isolated from environmental water. FEMS Microbiol Lett. 2009;291:201–8. pmid:19087204
- View Article
- PubMed/NCBI
- Google Scholar
27. Prinsloo HE, Coetzee JN. Host-range of temperate Serratia marcescens bacteriophages. Nature. 1964;203:211. pmid:14207257
- View Article
- PubMed/NCBI
- Google Scholar
28. Prinsloo HE. Bacteriocins and phages produced by Serratia marcescens. J Gen Microbiol. 1966;45:205–12. pmid:5339480
- View Article
- PubMed/NCBI
- Google Scholar
29. Evans TJ, Crow MA, Williamson NR, Orme W, Thomson NR, Komitopoulou E, et al. Characterization of a broad-host-range flagellum-dependent phage that mediates high-efficiency generalized transduction in, and between, Serratia and Pantoea. Microbiology. 2010;156:240–7. pmid:19778959
- View Article
- PubMed/NCBI
- Google Scholar
30. Brister JR, Ako-Adjei D, Bao Y, Blinkova O. NCBI viral genomes resource. Nucleic Acids Res. 2015;43:D571–7. pmid:25428358
- View Article
- PubMed/NCBI
- Google Scholar
31. Friedrich I, Klassen A, Neubauer H, Schneider D, Hertel R, Daniel R. Living in a puddle of mud: Isolation and characterization of two novel Caulobacteraceae strains Brevundimonas pondensis sp. nov. and Brevundimonas goettingensis sp. nov. Appl Microbiol. 2021;1:38–59.
- View Article
- Google Scholar
32. Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35:W52–7. pmid:17537822
- View Article
- PubMed/NCBI
- Google Scholar
33. Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25:1043–55. pmid:25977477
- View Article
- PubMed/NCBI
- Google Scholar
34. Tatusova T, DiCuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, et al. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res. 2016;44:6614–24. pmid:27342282
- View Article
- PubMed/NCBI
- Google Scholar
35. Chaumeil P-A, Mussig AJ, Hugenholtz P, Parks DH. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics. 2019;36:1925–7. pmid:31730192
- View Article
- PubMed/NCBI
- Google Scholar
36. Meier-Kolthoff JP, Göker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat Commun. 2019;10:2182. pmid:31097708
- View Article
- PubMed/NCBI
- Google Scholar
37. Pritchard L, Glover RH, Humphris S, Elphinstone JG, Toth IK. Genomics and taxonomy in diagnostics for food security: soft-rotting enterobacterial plant pathogens. Anal Methods. 2016;8:12–24.
- View Article
- Google Scholar
38. Kanehisa M, Sato Y, Morishima K. BlastKOALA and GhostKOALA: KEGG tools for functional characterization of genome and metagenome sequences. J Mol Biol. 2016;428:726–31. pmid:26585406
- View Article
- PubMed/NCBI
- Google Scholar
39. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 2011;39:W339–46. pmid:21672958
- View Article
- PubMed/NCBI
- Google Scholar
40. Blin K, Shaw S, Steinke K, Villebro R, Ziemert N, Lee SY, et al. antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res. 2019;47:W81–7. pmid:31032519
- View Article
- PubMed/NCBI
- Google Scholar
41. Arndt D, Grant JR, Marcu A, Sajed T, Pon A, Liang Y, et al. PHASTER: a better, faster version of the PHAST phage search tool. Nucleic Acids Res. 2016;44:W16–21. pmid:27141966
- View Article
- PubMed/NCBI
- Google Scholar
42. Gibson MK, Forsberg KJ, Dantas G. Improved annotation of antibiotic resistance determinants reveals microbial resistomes cluster by ecology. ISME J. 2015;9:207–16. pmid:25003965
- View Article
- PubMed/NCBI
- Google Scholar
43. Claus D. A standardized Gram staining procedure. World J Microbiol Biotechnol. 1992;8:451–2. pmid:24425522
- View Article
- PubMed/NCBI
- Google Scholar
44. Abraham W-R, Strompl C, Meyer H, Lindholst S, Moore ERB, Christ R, et al. Phylogeny and polyphasic taxonomy of Caulobacter species. Proposal of Maricaulis gen. nov. with Maricaulis maris (Poindexter) comb. nov. as the type species, and emended description of the genera Brevundimonas and Caulobacter. Int J Syst Bacteriol. 1999;49:1053–73. pmid:10425763
- View Article
- PubMed/NCBI
- Google Scholar
45. R Core Team. R: a language and environment for statistical computing [Internet]. R Foundation for Statistical Computing, Vienna, Austria; 2020. Available from: https://www.r-project.org/
46. Wickham H. ggplot2—elegant graphics for data analysis. Vol. 77, Journal of Statistical Software. New York, NY: Springer New York; 2009.
47. Bruder S, Reifenrath M, Thomik T, Boles E, Herzog K. Parallelized online biomass monitoring in shake flasks enables efficient strain and carbon source dependent growth characterization of Saccharomyces cerevisiae. Microb Cell Fact. 2016;15:127. pmid:27455954
- View Article
- PubMed/NCBI
- Google Scholar
48. Wickham H. Journal of Statistical Software. 2017;77:3–5.
- View Article
- Google Scholar
49. Clarke PH, Cowan ST. Biochemical methods for bacteriology. J Gen Microbiol. 1952;6:187–97. https://doi.org/10.1099/00221287-6-1-2-187 pmid:14927866
50. Willms IM, Hertel R. Phage vB_BsuP-Goe1: the smallest identified lytic phage of Bacillus subtilis. FEMS Microbiol Lett. 2016;363:fnw208. pmid:27609230
- View Article
- PubMed/NCBI
- Google Scholar
51. Willms I, Hoppert M, Hertel R. Characterization of Bacillus subtilis viruses vB_BsuM-Goe2 and vB_BsuM-Goe3. Viruses. 2017;9:146. pmid:28604650
- View Article
- PubMed/NCBI
- Google Scholar
52. Kropinski AM, Mazzocco A, Waddell TE, Lingohr E, Johnson RP. Enumeration of bacteriophages by double agar overlay plaque assay. Methods Mol Biol. 2009;501:69–76. pmid:19066811
- View Article
- PubMed/NCBI
- Google Scholar
53. Bogomol’naya LM, Filimonova MN. Activity dynamics of potential marker enzymes of Serratia marcescens cytoplasm and periplasm. Appl Biochem Microbiol. 2010;46:390–4.
- View Article
- Google Scholar
54. Bhadra B, Roy P, Chakraborty R. Serratia ureilytica sp. nov., a novel urea-utilizing species. Int J Syst Evol Microbiol. 2005;55:2155–8. pmid:16166724
- View Article
- PubMed/NCBI
- Google Scholar
55. Ludueña LM, Anzuay MS, Angelini JG, McIntosh M, Becker A, Rupp O, et al. Strain Serratia sp. S119: A potential biofertilizer for peanut and maize and a model bacterium to study phosphate solubilization mechanisms. Appl Soil Ecol. 2017;126:107–12.
- View Article
- Google Scholar
56. Reimer LC, Vetcininova A, Carbasse JS, Söhngen C, Gleim D, Ebeling C, et al. BacDive in 2019: bacterial phenotypic data for high-throughput biodiversity analysis. Nucleic Acids Res. 2019;47:D631–6. pmid:30256983
- View Article
- PubMed/NCBI
- Google Scholar
57. Zhang C-X, Yang S-Y, Xu M-X, Sun J, Liu H, Liu J-R, et al. Serratia nematodiphila sp. nov., associated symbiotically with the entomopathogenic nematode Heterorhabditidoides chongmingensis (Rhabditida: Rhabditidae). Int J Syst Evol Microbiol. 2009;59:1603–8. pmid:19578149
- View Article
- PubMed/NCBI
- Google Scholar
58. Parte AC. LPSN—List of prokaryotic names with standing in nomenclature (bacterio.net), 20 years on. Int J Syst Evol Microbiol. 2018;68:1825–9. pmid:29724269
- View Article
- PubMed/NCBI
- Google Scholar
59. Roy P, Ahmed , Nishat Hussain, Grover RK. Non-pigmented strain of Serratia marcescens: an unusual pathogen causing pulmonary infection in a patient with malignancy. J clin diagn. 2014;8:DD05–6.
- View Article
- Google Scholar
60. Harris AKP, Williamson NR, Slater H, Cox A, Abbasi S, Foulds I, et al. The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species- and strain-dependent genome context variation. Microbiology. 2004;150:3547–60. pmid:15528645
- View Article
- PubMed/NCBI
- Google Scholar
61. Haddix PL, Shanks RMQ. Prodigiosin pigment of Serratia marcescens is associated with increased biomass production. Arch Microbiol. 2018;200:989–99. pmid:29616306
- View Article
- PubMed/NCBI
- Google Scholar
62. Matilla MA, Nogellova V, Morel B, Krell T, Salmond GPC. Biosynthesis of the acetyl-coA carboxylase-inhibiting antibiotic, andrimid in Serratia is regulated by hfq and the LysR-type transcriptional regulator, admX. Environ Microbiol. 2016;18:3635–50. pmid:26914969
- View Article
- PubMed/NCBI
- Google Scholar
63. Matilla MA, Udaondo Z, Krell T, Salmond GPC. Genome sequence of Serratia marcescens MSU97, a plant-associated bacterium that makes multiple antibiotics. Genome Announc. 2017;5:e01752–16. pmid:28254993
- View Article
- PubMed/NCBI
- Google Scholar
64. Ruiu L. Plant-growth-promoting bacteria (PGPB) against insects and other agricultural pests. Agronomy. 2020;10:861.
- View Article
- Google Scholar
65. Dekkers LC, van der Bij AJ, Mulders IHM, Phoelich CC, Wentwoord RAR, Glandorf DCM, et al. Role of the O-antigen of lipopolysaccharide, and possible roles of growth rate and of NADH:ubiquinone oxidoreductase (nuo) in competitive tomato root-tip colonization by Pseudomonas fluorescens WCS365. Mol Plant Microbe Interact. 1998;11:763–71. pmid:9675892
- View Article
- PubMed/NCBI
- Google Scholar
66. Matteoli FP, Passarelli-Araujo H, Reis RJA, da Rocha LO, de Souza EM, Aravind L, et al. Genome sequencing and assessment of plant growth-promoting properties of a Serratia marcescens strain isolated from vermicompost. BMC Genomics. 2018;19:750. pmid:30326830
- View Article
- PubMed/NCBI
- Google Scholar
67. Chun J, Oren A, Ventosa A, Christensen H, Arahal DR, da Costa MS, et al. Proposed minimal standards for the use of genome data for the taxonomy of prokaryotes. International Journal of Systematic and Evolutionary Microbiology. 2018;68:461–6. pmid:29292687
- View Article
- PubMed/NCBI
- Google Scholar
68. Richter M, Rosselló-Móra R. Shifting the genomic gold standard for the prokaryotic species definition. PNAS. 2009;10:191:26–31. pmid:19855009
- View Article
- PubMed/NCBI
- Google Scholar
69. Hertel R, Rodríguez DP, Hollensteiner J, Dietrich S, Leimbach A, Hoppert M, et al. Genome-based identification of active prophage regions by next generation sequencing in Bacillus licheniformis DSM13. PLOS ONE. 2015;10:e0120759. pmid:25811873
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Adeolu M, Alnajar S, Naushad S, S. Gupta R. Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Int J Syst Evol Microbiol. 2016;66:5575–99. pmid:27620848
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Parte AC, Carbasse JS, Meier-Kolthoff JP, Reimer LC, Göker M. List of prokaryotic names with standing in nomenclature (LPSN) moves to the DSMZ. Int J Syst Evol Microbiol. 2020;70:5607–12. pmid:32701423
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Grimont PAD, Grimont F. The genus Serratia. Annu Rev Microbiol. 1978;32:221–48. pmid:360966
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Mahlen SD. Serratia infections: from military experiments to current practice. Clin Microbiol Rev. 2011;24:755–91. pmid:21976608
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Bennett JW, Bentley R. Seeing red: the story of prodigiosin. Adv Appl Microbiol. 2000;47:1–32. pmid:12876793
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Ajithkumar B, Ajithkumar VP, Iriye R, Doi Y, Sakai T. Spore-forming Serratia marcescens subsp. sakuensis subsp. nov., isolated from a domestic wastewater treatment tank. Int J Syst Evol Microbiol. 2003;53:253–8. pmid:12656181
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Carter ME, Chengappa MM. Enterobacteria. In: Diagnostic Procedure in Veterinary Bacteriology and Mycology. Elsevier; 1990. p. 107–28.

[ref8] 8. Wijewanta E, Fernando M. Infection in goats owing to Serratia marcescens. Vet Rec. 1970;87:282–4. pmid:4919387
View Article
PubMed/NCBI
Google Scholar

[27] View Article

[28] PubMed/NCBI

[29] Google Scholar

[ref9] 9. Manfredi R, Nanetti A, Ferri M, Chiodo F. Clinical and microbiological survey of Serratia marcescens infection during HIV disease. Eur J Clin Microbiol Infect Dis. 2000;19:248–53. pmid:10834812
View Article
PubMed/NCBI
Google Scholar

[31] View Article

[32] PubMed/NCBI

[33] Google Scholar

[ref10] 10. Ray U, Dutta S, Chakravarty C, Sutradhar A. A case of multiple cutaneous lesions due to Serratia marcescens in an immunocompromised patient. JMM Case Rep. 2015;2:1–4.
View Article
Google Scholar

[35] View Article

[36] Google Scholar

[ref11] 11. Khanna A, Khanna M, Aggarwal A. Serratia marcescens–a rare opportunistic nosocomial pathogen and measures to limit its spread in hospitalized patients. J Clin Diagn Res. 2013;7:243–6. pmid:23543704
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref12] 12. Abreo E, Altier N. Pangenome of Serratia marcescens strains from nosocomial and environmental origins reveals different populations and the links between them. Sci Rep. 2019;9:1–8. pmid:30626917
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref13] 13. Maki DG, Hennekens CG, Phillips CW, Shaw WV, Bennett JV. Nosocomial urinary tract infection with Serratia marcescens: an epidemiologic study. J Infect Dis. 1973;128:579–87. pmid:4588701
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref14] 14. Rascoe J, Berg M, Melcher U, Mitchell FL, Bruton BD, Pair SD, et al. Identification, phylogenetic analysis, and biological characterization of Serratia marcescens strains causing cucurbit yellow vine disease. Phytopathology. 2003;93:1233–9. pmid:18944322
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref15] 15. Sikora EJ, Bruton BD, Wayadande AC, Fletcher J. First report of the cucurbit yellow vine disease caused by Serratia marcescens in watermelon and yellow squash in Alabama. Plant Dis. 2012;96:761. pmid:30727534
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref16] 16. Gillis A, Rodríguez M, Santana MA. Serratia marcescens associated with bell pepper (Capsicum annuum L.) soft-rot disease under greenhouse conditions. Eur J Plant Pathol. 2013;138:1–8.
View Article
Google Scholar

[58] View Article

[59] Google Scholar

[ref17] 17. Khan AR, Park GS, Asaf S, Hong SJ, Jung BK, Shin JH. Complete genome analysis of Serratia marcescens RSC-14: a plant growth-promoting bacterium that alleviates cadmium stress in host plants. PLOS ONE. 2017;12:1–17. pmid:28187139
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref18] 18. Devi KA, Pandey P, Sharma GD. Plant growth-promoting endophyte Serratia marcescens AL2-16 enhances the growth of Achyranthes aspera L., a medicinal plant. Hayati. 2016;23:173–80.
View Article
Google Scholar

[65] View Article

[66] Google Scholar

[ref19] 19. Monreal J, Reese ET. The chitinase of Serratia marcescens. Can J Microbiol. 1969;15:689–96. pmid:4894282
View Article
PubMed/NCBI
Google Scholar

[68] View Article

[69] PubMed/NCBI

[70] Google Scholar

[ref20] 20. Ibrahim D, Nazari TF, Kassim J, Lim SH. Prodigiosin—an antibacterial red pigment produced by Serratia marcescens IBRL USM 84 associated with a marine sponge Xestospongia testudinaria. J Appl Pharm Sci. 2014;4:1–6.
View Article
Google Scholar

[72] View Article

[73] Google Scholar

[ref21] 21. Hong B, Prabhu VV, Zhang S, van den Heuvel APJ, Dicker DT, Kopelovich L, et al. Prodigiosin rescues deficient p53 signaling and antitumor effects via upregulating p73 and disrupting its interaction with mutant p53. Cancer Res. 2014;74:1153–65. pmid:24247721
View Article
PubMed/NCBI
Google Scholar

[75] View Article

[76] PubMed/NCBI

[77] Google Scholar

[ref22] 22. Parmar KM, Dafale NA, Tikariha H, Purohit HJ. Genomic characterization of key bacteriophages to formulate the potential biocontrol agent to combat enteric pathogenic bacteria. Arch Microbiol. 2018;200:611–22. pmid:29330592
View Article
PubMed/NCBI
Google Scholar

[79] View Article

[80] PubMed/NCBI

[81] Google Scholar

[ref23] 23. Kohm K, Hertel R. The life cycle of SPβ and related phages. Arch Virol. 2021;166:2119–30. pmid:34100162
View Article
PubMed/NCBI
Google Scholar

[83] View Article

[84] PubMed/NCBI

[85] Google Scholar

[ref24] 24. Bhetwal A, Maharjan A, Shakya S, Satyal D, Ghimire S, Khanal PR, et al. Isolation of potential phages against multidrug-resistant bacterial isolates: promising agents in the rivers of Kathmandu, Nepal. Biomed Res Int. 2017;1–10. pmid:29359149
View Article
PubMed/NCBI
Google Scholar

[87] View Article

[88] PubMed/NCBI

[89] Google Scholar

[ref25] 25. Frederick GL, Lloyd BJ. Evaluation of bacteriophage as a tracer and a model for virus removal in waste stabilization ponds. Water Sci Technol. 1995;31:291–302.
View Article
Google Scholar

[91] View Article

[92] Google Scholar

[ref26] 26. Matsushita K, Uchiyama J, Kato S, Ujihara T, Hoshiba H, Sugihara S, et al. Morphological and genetic analysis of three bacteriophages of Serratia marcescens isolated from environmental water. FEMS Microbiol Lett. 2009;291:201–8. pmid:19087204
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref27] 27. Prinsloo HE, Coetzee JN. Host-range of temperate Serratia marcescens bacteriophages. Nature. 1964;203:211. pmid:14207257
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref28] 28. Prinsloo HE. Bacteriocins and phages produced by Serratia marcescens. J Gen Microbiol. 1966;45:205–12. pmid:5339480
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref29] 29. Evans TJ, Crow MA, Williamson NR, Orme W, Thomson NR, Komitopoulou E, et al. Characterization of a broad-host-range flagellum-dependent phage that mediates high-efficiency generalized transduction in, and between, Serratia and Pantoea. Microbiology. 2010;156:240–7. pmid:19778959
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref30] 30. Brister JR, Ako-Adjei D, Bao Y, Blinkova O. NCBI viral genomes resource. Nucleic Acids Res. 2015;43:D571–7. pmid:25428358
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref31] 31. Friedrich I, Klassen A, Neubauer H, Schneider D, Hertel R, Daniel R. Living in a puddle of mud: Isolation and characterization of two novel Caulobacteraceae strains Brevundimonas pondensis sp. nov. and Brevundimonas goettingensis sp. nov. Appl Microbiol. 2021;1:38–59.
View Article
Google Scholar

[114] View Article

[115] Google Scholar

[ref32] 32. Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35:W52–7. pmid:17537822
View Article
PubMed/NCBI
Google Scholar

[117] View Article

[118] PubMed/NCBI

[119] Google Scholar

[ref33] 33. Parks DH, Imelfort M, Skennerton CT, Hugenholtz P, Tyson GW. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25:1043–55. pmid:25977477
View Article
PubMed/NCBI
Google Scholar

[121] View Article

[122] PubMed/NCBI

[123] Google Scholar

[ref34] 34. Tatusova T, DiCuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, et al. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res. 2016;44:6614–24. pmid:27342282
View Article
PubMed/NCBI
Google Scholar

[125] View Article

[126] PubMed/NCBI

[127] Google Scholar

[ref35] 35. Chaumeil P-A, Mussig AJ, Hugenholtz P, Parks DH. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics. 2019;36:1925–7. pmid:31730192
View Article
PubMed/NCBI
Google Scholar

[129] View Article

[130] PubMed/NCBI

[131] Google Scholar

[ref36] 36. Meier-Kolthoff JP, Göker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat Commun. 2019;10:2182. pmid:31097708
View Article
PubMed/NCBI
Google Scholar

[133] View Article

[134] PubMed/NCBI

[135] Google Scholar

[ref37] 37. Pritchard L, Glover RH, Humphris S, Elphinstone JG, Toth IK. Genomics and taxonomy in diagnostics for food security: soft-rotting enterobacterial plant pathogens. Anal Methods. 2016;8:12–24.
View Article
Google Scholar

[137] View Article

[138] Google Scholar

[ref38] 38. Kanehisa M, Sato Y, Morishima K. BlastKOALA and GhostKOALA: KEGG tools for functional characterization of genome and metagenome sequences. J Mol Biol. 2016;428:726–31. pmid:26585406
View Article
PubMed/NCBI
Google Scholar

[140] View Article

[141] PubMed/NCBI

[142] Google Scholar

[ref39] 39. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, et al. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 2011;39:W339–46. pmid:21672958
View Article
PubMed/NCBI
Google Scholar

[144] View Article

[145] PubMed/NCBI

[146] Google Scholar

[ref40] 40. Blin K, Shaw S, Steinke K, Villebro R, Ziemert N, Lee SY, et al. antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res. 2019;47:W81–7. pmid:31032519
View Article
PubMed/NCBI
Google Scholar

[148] View Article

[149] PubMed/NCBI

[150] Google Scholar

[ref41] 41. Arndt D, Grant JR, Marcu A, Sajed T, Pon A, Liang Y, et al. PHASTER: a better, faster version of the PHAST phage search tool. Nucleic Acids Res. 2016;44:W16–21. pmid:27141966
View Article
PubMed/NCBI
Google Scholar

[152] View Article

[153] PubMed/NCBI

[154] Google Scholar

[ref42] 42. Gibson MK, Forsberg KJ, Dantas G. Improved annotation of antibiotic resistance determinants reveals microbial resistomes cluster by ecology. ISME J. 2015;9:207–16. pmid:25003965
View Article
PubMed/NCBI
Google Scholar

[156] View Article

[157] PubMed/NCBI

[158] Google Scholar

[ref43] 43. Claus D. A standardized Gram staining procedure. World J Microbiol Biotechnol. 1992;8:451–2. pmid:24425522
View Article
PubMed/NCBI
Google Scholar

[160] View Article

[161] PubMed/NCBI

[162] Google Scholar

[ref44] 44. Abraham W-R, Strompl C, Meyer H, Lindholst S, Moore ERB, Christ R, et al. Phylogeny and polyphasic taxonomy of Caulobacter species. Proposal of Maricaulis gen. nov. with Maricaulis maris (Poindexter) comb. nov. as the type species, and emended description of the genera Brevundimonas and Caulobacter. Int J Syst Bacteriol. 1999;49:1053–73. pmid:10425763
View Article
PubMed/NCBI
Google Scholar

[164] View Article

[165] PubMed/NCBI

[166] Google Scholar

[ref45] 45. R Core Team. R: a language and environment for statistical computing [Internet]. R Foundation for Statistical Computing, Vienna, Austria; 2020. Available from: https://www.r-project.org/

[ref46] 46. Wickham H. ggplot2—elegant graphics for data analysis. Vol. 77, Journal of Statistical Software. New York, NY: Springer New York; 2009.

[ref47] 47. Bruder S, Reifenrath M, Thomik T, Boles E, Herzog K. Parallelized online biomass monitoring in shake flasks enables efficient strain and carbon source dependent growth characterization of Saccharomyces cerevisiae. Microb Cell Fact. 2016;15:127. pmid:27455954
View Article
PubMed/NCBI
Google Scholar

[170] View Article

[171] PubMed/NCBI

[172] Google Scholar

[ref48] 48. Wickham H. Journal of Statistical Software. 2017;77:3–5.
View Article
Google Scholar

[174] View Article

[175] Google Scholar

[ref49] 49. Clarke PH, Cowan ST. Biochemical methods for bacteriology. J Gen Microbiol. 1952;6:187–97. https://doi.org/10.1099/00221287-6-1-2-187 pmid:14927866

[ref50] 50. Willms IM, Hertel R. Phage vB_BsuP-Goe1: the smallest identified lytic phage of Bacillus subtilis. FEMS Microbiol Lett. 2016;363:fnw208. pmid:27609230
View Article
PubMed/NCBI
Google Scholar

[178] View Article

[179] PubMed/NCBI

[180] Google Scholar

[ref51] 51. Willms I, Hoppert M, Hertel R. Characterization of Bacillus subtilis viruses vB_BsuM-Goe2 and vB_BsuM-Goe3. Viruses. 2017;9:146. pmid:28604650
View Article
PubMed/NCBI
Google Scholar

[182] View Article

[183] PubMed/NCBI

[184] Google Scholar

[ref52] 52. Kropinski AM, Mazzocco A, Waddell TE, Lingohr E, Johnson RP. Enumeration of bacteriophages by double agar overlay plaque assay. Methods Mol Biol. 2009;501:69–76. pmid:19066811
View Article
PubMed/NCBI
Google Scholar

[186] View Article

[187] PubMed/NCBI

[188] Google Scholar

[ref53] 53. Bogomol’naya LM, Filimonova MN. Activity dynamics of potential marker enzymes of Serratia marcescens cytoplasm and periplasm. Appl Biochem Microbiol. 2010;46:390–4.
View Article
Google Scholar

[190] View Article

[191] Google Scholar

[ref54] 54. Bhadra B, Roy P, Chakraborty R. Serratia ureilytica sp. nov., a novel urea-utilizing species. Int J Syst Evol Microbiol. 2005;55:2155–8. pmid:16166724
View Article
PubMed/NCBI
Google Scholar

[193] View Article

[194] PubMed/NCBI

[195] Google Scholar

[ref55] 55. Ludueña LM, Anzuay MS, Angelini JG, McIntosh M, Becker A, Rupp O, et al. Strain Serratia sp. S119: A potential biofertilizer for peanut and maize and a model bacterium to study phosphate solubilization mechanisms. Appl Soil Ecol. 2017;126:107–12.
View Article
Google Scholar

[197] View Article

[198] Google Scholar

[ref56] 56. Reimer LC, Vetcininova A, Carbasse JS, Söhngen C, Gleim D, Ebeling C, et al. BacDive in 2019: bacterial phenotypic data for high-throughput biodiversity analysis. Nucleic Acids Res. 2019;47:D631–6. pmid:30256983
View Article
PubMed/NCBI
Google Scholar

[200] View Article

[201] PubMed/NCBI

[202] Google Scholar

[ref57] 57. Zhang C-X, Yang S-Y, Xu M-X, Sun J, Liu H, Liu J-R, et al. Serratia nematodiphila sp. nov., associated symbiotically with the entomopathogenic nematode Heterorhabditidoides chongmingensis (Rhabditida: Rhabditidae). Int J Syst Evol Microbiol. 2009;59:1603–8. pmid:19578149
View Article
PubMed/NCBI
Google Scholar

[204] View Article

[205] PubMed/NCBI

[206] Google Scholar

[ref58] 58. Parte AC. LPSN—List of prokaryotic names with standing in nomenclature (bacterio.net), 20 years on. Int J Syst Evol Microbiol. 2018;68:1825–9. pmid:29724269
View Article
PubMed/NCBI
Google Scholar

[208] View Article

[209] PubMed/NCBI

[210] Google Scholar

[ref59] 59. Roy P, Ahmed , Nishat Hussain, Grover RK. Non-pigmented strain of Serratia marcescens: an unusual pathogen causing pulmonary infection in a patient with malignancy. J clin diagn. 2014;8:DD05–6.
View Article
Google Scholar

[212] View Article

[213] Google Scholar

[ref60] 60. Harris AKP, Williamson NR, Slater H, Cox A, Abbasi S, Foulds I, et al. The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species- and strain-dependent genome context variation. Microbiology. 2004;150:3547–60. pmid:15528645
View Article
PubMed/NCBI
Google Scholar

[215] View Article

[216] PubMed/NCBI

[217] Google Scholar

[ref61] 61. Haddix PL, Shanks RMQ. Prodigiosin pigment of Serratia marcescens is associated with increased biomass production. Arch Microbiol. 2018;200:989–99. pmid:29616306
View Article
PubMed/NCBI
Google Scholar

[219] View Article

[220] PubMed/NCBI

[221] Google Scholar

[ref62] 62. Matilla MA, Nogellova V, Morel B, Krell T, Salmond GPC. Biosynthesis of the acetyl-coA carboxylase-inhibiting antibiotic, andrimid in Serratia is regulated by hfq and the LysR-type transcriptional regulator, admX. Environ Microbiol. 2016;18:3635–50. pmid:26914969
View Article
PubMed/NCBI
Google Scholar

[223] View Article

[224] PubMed/NCBI

[225] Google Scholar

[ref63] 63. Matilla MA, Udaondo Z, Krell T, Salmond GPC. Genome sequence of Serratia marcescens MSU97, a plant-associated bacterium that makes multiple antibiotics. Genome Announc. 2017;5:e01752–16. pmid:28254993
View Article
PubMed/NCBI
Google Scholar

[227] View Article

[228] PubMed/NCBI

[229] Google Scholar

[ref64] 64. Ruiu L. Plant-growth-promoting bacteria (PGPB) against insects and other agricultural pests. Agronomy. 2020;10:861.
View Article
Google Scholar

[231] View Article

[232] Google Scholar

[ref65] 65. Dekkers LC, van der Bij AJ, Mulders IHM, Phoelich CC, Wentwoord RAR, Glandorf DCM, et al. Role of the O-antigen of lipopolysaccharide, and possible roles of growth rate and of NADH:ubiquinone oxidoreductase (nuo) in competitive tomato root-tip colonization by Pseudomonas fluorescens WCS365. Mol Plant Microbe Interact. 1998;11:763–71. pmid:9675892
View Article
PubMed/NCBI
Google Scholar

[234] View Article

[235] PubMed/NCBI

[236] Google Scholar

[ref66] 66. Matteoli FP, Passarelli-Araujo H, Reis RJA, da Rocha LO, de Souza EM, Aravind L, et al. Genome sequencing and assessment of plant growth-promoting properties of a Serratia marcescens strain isolated from vermicompost. BMC Genomics. 2018;19:750. pmid:30326830
View Article
PubMed/NCBI
Google Scholar

[238] View Article

[239] PubMed/NCBI

[240] Google Scholar

[ref67] 67. Chun J, Oren A, Ventosa A, Christensen H, Arahal DR, da Costa MS, et al. Proposed minimal standards for the use of genome data for the taxonomy of prokaryotes. International Journal of Systematic and Evolutionary Microbiology. 2018;68:461–6. pmid:29292687
View Article
PubMed/NCBI
Google Scholar

[242] View Article

[243] PubMed/NCBI

[244] Google Scholar

[ref68] 68. Richter M, Rosselló-Móra R. Shifting the genomic gold standard for the prokaryotic species definition. PNAS. 2009;10:191:26–31. pmid:19855009
View Article
PubMed/NCBI
Google Scholar

[246] View Article

[247] PubMed/NCBI

[248] Google Scholar

[ref69] 69. Hertel R, Rodríguez DP, Hollensteiner J, Dietrich S, Leimbach A, Hoppert M, et al. Genome-based identification of active prophage regions by next generation sequencing in Bacillus licheniformis DSM13. PLOS ONE. 2015;10:e0120759. pmid:25811873
View Article
PubMed/NCBI
Google Scholar

[250] View Article

[251] PubMed/NCBI

[252] Google Scholar

Figures

Abstract

Introduction

Material and methods

Isolation of Serratia marcescens LVF3 strain, DNA extraction, and 16S rRNA gene sequencing

Genome and prophage sequencing, assembly, and annotation

Phylogenetic classification of Serratia marcescens LVF3R

Comparative genomics

Cell morphology and Gram staining procedure

Transmission electron microscopy

Determination of salt tolerance and temperature optimum

Determination of growth kinetics

Metabolic activity and antibiotic resistances

Plaque assay with sewage water

Results and discussion

Morphological characterization

Physiological characterization

Genomic characterization

Genome.

Whole-genome phylogeny.

Prophages.

Strain suitability for phage isolation.

Conclusion

Supporting information

S1 Fig. Phylogenetic classification of Serratia marcescens strain LVF3.

S2 Fig. Visualization of functional categories through BlastKoala (Kanehisa et al., 2016) [38] for Serratia marcescens LVF3R.

S3 Fig. Colony morphotype of Serratia marcescens LVF3R.

S4 Fig. Gram staining of Serratia marcescens LVF3R.

S5 Fig.

S1 Table. KEGG Mapper Reconstruction Result of Serratia marcescens LVF3R.

S2 Table. Resfams prediction of Serratia marcescens LVF3R.

S3 Table. List of putative biosynthetic gene clusters in Serratia marcescens LVF3R.

S4 Table. Comparison of putative genes involved in important plant growth promoting traits of Serratia marcescens LVF3R, Serratia sp. S119R and Serratia marcescens UENF-22GI.

S5 Table. Phylogenetic analysis for Serratia marcescens LVF3R.

S6 Table. GTDB-Tk of Serratia marcescens LVF3R isolate.

S7 Table. Pairwise comparisons of LVF3 against type strain genomes from TYGS (Meier-Kolthoff and Göker, 2019).

S8 Table. PHASTER analysis of Serratia marcescens LVF3R.

Acknowledgments

References

Phylogenetic classification of Serratia marcescens LVF3^R

S2 Fig. Visualization of functional categories through BlastKoala (Kanehisa et al., 2016) [38] for Serratia marcescens LVF3^R.

S3 Fig. Colony morphotype of Serratia marcescens LVF3^R.

S4 Fig. Gram staining of Serratia marcescens LVF3^R.

S1 Table. KEGG Mapper Reconstruction Result of Serratia marcescens LVF3^R.

S2 Table. Resfams prediction of Serratia marcescens LVF3^R.

S3 Table. List of putative biosynthetic gene clusters in Serratia marcescens LVF3^R.

S4 Table. Comparison of putative genes involved in important plant growth promoting traits of Serratia marcescens LVF3R, Serratia sp. S119^R and Serratia marcescens UENF-22GI.

S5 Table. Phylogenetic analysis for Serratia marcescens LVF3^R.

S6 Table. GTDB-Tk of Serratia marcescens LVF3^R isolate.

S8 Table. PHASTER analysis of Serratia marcescens LVF3^R.