https://orcid.org/0000-0002-1048-0832
Abstract
Here we report urine-derived cell (UDC) culture and subsequent use for cloning which resulted in the successful development of cloned canine pups, which have remained healthy into adulthood. Bovine UDCs were used in vitro to establish comparative differences between cell sources. UDCs were chosen as a readily available and noninvasive source for obtaining cells. We analyzed the viability of cells stored in urine over time and could consistently culture cells which had remained in urine for 48hrs. Cells were shown to be viable and capable of being transfected with plasmids. Although primarily of epithelial origin, cells were found from multiple lineages, indicating that they enter the urine from more than one source. Held in urine, at 4°C, the majority of cells maintained their membrane integrity for several days. When compared to in vitro fertilization (IVF) derived embryos or those from traditional SCNT, UDC derived embryos did not differ in total cell number or in the number of DNA breaks, measured by TUNEL stain. These results indicate that viable cells can be obtained from multiple species’ urine, capable of being used to produce live offspring at a comparable rate to other cell sources, evidenced by a 25% pregnancy rate and 2 live births with no losses in the canine UDC cloning trial. This represents a noninvasive means to recover the breeding capacity of genetically important or infertile animals. Obtaining cells in this way may provide source material for human and animal studies where cells are utilized.
Figures
Citation: Olsson PO, Yeonwoo J, Park K, Yoo Y-M, Hwang WS (2023) Live births from urine derived cells. PLoS ONE 18(1): e0278607. https://doi.org/10.1371/journal.pone.0278607
Editor: Wilfried A. Kues, Friedrich-Loeffler-Institute, GERMANY
Received: March 7, 2022; Accepted: November 21, 2022; Published: January 25, 2023
Copyright: © 2023 Olsson et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: There are no ethical or legal restrictions on sharing a de-identified data set, based on the original owner agreements data may only be made on request. Data may be requested including all primary blots/gels etc. from the UAE Biotech Research Center in Abu Dhabi (info@uaebrc.ae, +971501878464).
Funding: This work was supported in part by the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET), through the Agri-Bio Industry Technology Development Program, funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA; grant number: 318016-5). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: No competing interests to declare.
Introduction
Human and animal cells have several applications, with potential uses ranging from disease detection and treatments, to reproductive biology, including cloning [1–3]. Cultured cells are particularly useful for biological applications as they can be used with consistency and expanded in number for subsequent use. Generally, to obtain cells, a tissue sample is taken, a process which may be relatively invasive and although it generally does not cause lasting harm, can lead to complications. There are several risks associated with obtaining biopsies from sensitive animals, particularly related to potential injury and stress with capture, anesthesia and infection. Where risks are high or sampling potential is limited, e.g. in critically endangered or particularly sensitive individuals, biopsies may not be a suitable option to obtain cells. Animals of critically endangered species may not be captured, yet their urine may be obtained. Likewise, in human practice, patients may be hesitant to be subjected to biopsy procedures. Here we show the ability to obtain and culture cells from urine, which may further facilitate cellular-based technologies and research and show that urine derived cells (UDCs) can be used to obtain embryos and live offspring through cloning via somatic cell nuclear transfer (SCNT).
The production of viable offspring, after cloning, validates genomic integrity making clear a range of cellular applications. SCNT produces genetically identical offspring or embryos or in the generation of syngeneic embryonic stem cells (ESCs) [4, 5]. The cell source for SCNT, referred to as donor cells, are generally obtained from biopsies and primary cell culture, most commonly from skin or muscle tissues [6] from living or recently deceased individuals [7]. A significant aspect of cloning efficiency is the ability to reprogram somatic cells. Cell type and passage number have been implicated as effectors of cloning efficiency, with cumulus cells, stem cells and embryonic cells being more efficient in producing offspring, lacking abnormalities, than terminally differentiated cells [8–10]. As cloning efficiencies from terminally differentiated cells, average between 1 to 3% across species, there exists a need to establish superior methods [6, 11]. The ability to produce embryos and live offspring and to produce pluripotent stem cells (iPSCs) formation were considered as hallmarks for cellular integrity and utility. Together these cellular resources and SCNT may prove to be valuable in the restoration of endangered and or extinct species and similar technologies have the potential for human medical advancements [12].
In this manuscript, we describe our investigation into the possibility of using cultured urine-derived cells (UDCs) as donor nuclei for SCNT in canine and bovine species, as well as to show the potential use for transfection in an iPSCs induction system. We additionally aimed to establish the potential for UDCs in conservation related biology and their stability for potential cellular modification as needed for medical research or genetic editing. The canine and bovine species were chosen as the model system due to practicality of access as well as having the cloning systems in place. There are multiple reviews on canine use with many common inheritable diseases [13–15]. The canine genome was sequenced in the early 2000´s [16, 17]. Canine stem cell establishment has been previously described, although several limitations for culture of canine oocytes and embryos persist [18, 19]. Bovine UDCs were selected to generate and compare embryo quality between embryos generated from standard biopsy derived cells, UDCs and in vitro fertilized (IVF) embryos as, although problems still exist [20], methods for bovine embryo culture are well established [21]. Additionally, the establishment and use of UDCs from non-related species may indicate the potential to utilize this methodology in multiple species.
Results
Deriving cells from urine: Urine-derived cells (UDCs)
Cell cultures, supplemented with sterile filtered urine, were as capable of attachment as their non-supplemented counterparts. An average of 7.1x105 cells were collected per ml of canine urine (n = 26). Bovine urine cells were observed at a much lower concentration, approximately 100-fold less than in canine urine, with an average of 5.3x103 cells per ml (n = 10) (Fig 1). The majority of urine cells were small and round, while larger cells were also present, predominantly in canine samples as they were almost absent from bovine samples. In canines, small cells occurred at an average proportion of 33.68 small to one large cell counted from 21 samples from 14 individuals. Trypan Blue (Sigma) staining was insufficient in determining viability, Hoechst and propidium iodine (P.I.) were used to indicate cell number and nonviable cells, those which had lost membrane integrity. Large cells were never observed to attach and rapidly lost viability. Urine samples held for 24 hrs lacked observable numbers of viable large cells (Fig 2B). Small cells however, retained their membrane integrity >120 hrs, defined by a negative P.I stain (Fig 2C), although successful adherence (Fig 2D) and derivation of cultivable cells diminished drastically with time in both canine and bovine samples (Fig 2). After 72 hrs, attempts at culturing cells on any substrate, including vitronectin/fibronectin, laminin and collagen yielded only poor results. The percentage of PI negative cells decreased significantly from fresh to 24 hrs (p = 0.014) but did not significantly decrease between subsequent 24 hr time points, after 48 hrs, showing a sharp initial decrease followed by slow degradation of cellular integrity (Fig 2). Eighty percent confluence was achieved at approximately 21 days, in general, however cell seeding density varied based on urine cell concentration. Earliest attachment was seen at 24 hrs and latest observed at three weeks. Delayed attachment generally resulted in failure to achieve sufficient number of UDCs for culture. Cells were found to contain markers for cells of three different origins (Fig 3). The majority of attached cells were of epithelial origin, staining positive for pancytokeratin, although markers for multiple cell types were also present (Fig 3).
Cells number per volume (ml) of urine following micturition collection in A) Canine and B) Bovine samples C) Average cell number per ml, canine numbers displayed divided by 100 for scale. Error bars SEM *(p = 0.036).
Canine Urine and UDCs A) Urine cells following isolation. B) Cellular morphological variation of large and small cells and integrity staining utilizing Propidium Iodide (red) and Hoechst 33342 (blue). Red stained cells indicate membrane permeability and thus non-viable cells; blue stain illustrates nuclei with intact membranes. C) Urine cell integrity indicate by Propidium iodide negative stain over time stored at 4°C (*p<0.05, *** p<0.001).
UDC immunohistochemical characterization with Hoechst indicating nuclei (Blue) A) Vimentine positive cells (Red) B) E-Cadherin positive staining(Green) C Pancytokeratin stain (Green). D. Pancytokeratin stain overlaid on light microscopy image. E) Presense of Mesynchymal cellular marker Vimentin, F) Epithelial marker P-Glycoprotein. G Further markers for cell characterization indicating a heterogeneous cell population in UDCs.
Addition of EGF and insulin appeared to increase initial cellular attachment; however cells often receded and appeared to arrest or undergo apoptosis. The loss was corrected with continued dilution, through media changes. Hormonal addition was not necessary to obtain cells, however addition appeared to increase the yield and reduced attachment times, with less failures. 10ng/ml EGF+ Insulin 0.1%, diluted at least 1:1 with the media change/refreshment after 4 days yielded the best and most consistent results. Coating of dishes with either collagen or laminin or the two together, did not increase the frequency or time required for cellular attachment. No addition of insulin, hydrocortisone or growth factors was used in the continued growth of cells after establishment. Original cultures contained an addition of sterile filtered urine, at concentrations up to 20% by volume, without an observed effect on cellular adherence or proliferation. When crystals were observed in urine, cellular attachment and proliferation was retarded or ablated. Obtaining UDCs from samples stored more than 48 hrs was less effective, despite the presence of P.I. negative cells (S1 Table).
Somatic cell nuclear transfer
To determine the developmental capability as donor nuclei for SCNT to produce live offspring, canine fibroblasts and UDCs were allowed to grow to near confluence or confluence before being used for somatic cell nuclear transferF. Fibroblasts were obtained from dermal samples from living donors. Oocytes (n = 87) were checked for fusion and resultant complexes (72.4%, n = 63) were transferred into surrogates (n = 4). Pregnancy was diagnosed and of the four surrogates used, one surrogate was pregnant with 2 pups, consistent with SCNT results using dermal fibroblasts as donor cells (Table 1).
Bovine UDCs generated embryos at rate of 42.0% +/- 17.3SD n = 4 from 250 oocytes, compared to a rate of 26.5% +/- 7.0 SD from SCNT performed with fibroblast donor cells. IVF derived blastocysts formed at a rate of 25.1% +/- 22.1SD. The three group’s blastocyst formation rate did not differ significantly. To determine the genetic integrity of bovine embryos derived from UDCs, TUNEL staining was employed and no major differences were observed in SCNT embryos derived from UDCs or fibroblasts, nor from either UDC or fibroblast derived to IVF derived blastocysts. Although the average did total stain differ significantly between groups, there was an increased deviation in the ratio of TUNEL positive cells in SCNT derived embryos from fibroblasts than from UDC derived embryos which in turn was greater than the deviation observed in TUNEL staining of embryos of IVF origin indicating potential biological relevance(Fig 4).
Embryo quality analysis A) Representative images of blastocyst with total cells (Blue) and TUNEL positive cells (Green), indicating DNA breaks B) Total cell number and TUNEL staining in 8 day embryos derived from IVF, SCNT with standard grown cells, and UDC SCNT. C) average ratio of tunnel positive cells to total cell counts. Error bars are SD.
Production of UDC derived offspring.
After collecting urine, samples were analyzed to determine viability, UDCs were obtained and subjected to SCNT then after embryo transfer, female surrogates were monitored and at day 28 and 30 were submitted to pregnancy detection by ultrasonography. One of the four surrogates was shown to be pregnant and was carrying two pups. Pregnancies were closely monitored and both pups and surrogate were healthy after parturition (Fig 5). This represents a 25% pregnancy rate and a cloning efficiency rate of 3.2%, with two live births from 87 reconstructed oocytes (Table 1). No abnormalities were detected and pups developed normally with consistent normal growth. When compared with their syngeneic sibling, from the same original donor, and from that of naturally produced pups, growth did not vary (Fig 6A). At the time of submission, the cloned offspring both from UDC and fibroblast origin, have developed normally and passed their fourth year and exhibit no apparent adverse conditions and appear indistinguishable in their health, vigor and vitality (Fig 6).
A) Urine collected, B) Analysis of cellular viability, C) UDCs established D) SCNT performed, E) Ultrasonic pregnancy confirmation at ~30 days after embryo transfer, F) Cloned puppies.
Growth and Development of standard SCNT and UDC clone development A) Growth rate until weaning, B) newborns, C) UDC clones at 4 months of age, D) mature UDC clones. Error bars ae SD.
Establishment of presumptive induced Pluripotent Stem Cells (iPSCs).
In order to further elucidate the potential of UDCs the pDON-5 plasmid was co-transfected with GFP and used to generate induced pluripotent stem cells (iPSCs). Initial GFP expression could be detected at 24 hrs in culture and initial stem cell-like colonies were visible at 72 hrs, adhesion independent spheroids, reminiscent of embryoid bodies, were observed between 7 and 10 days (S1 Fig). This rationale, that these cells are usefully for multiple purposes, is further supported by the potential applications for iPSCs where cloning is not currently feasible, i.e. in species with inadequate oocyte or surrogate source. Transfection efficiency, evident by GFP expression, was unexpectedly high, 57.34%, +/- 14.69 SD, (n = 3). OCT4 expression was present when tested 10 days after introducing the plasmid. We did not attempt to optimize culture conditions of iPSCs nor to maintain their pluripotent state or differentiation capacity.
Discussion
Our results suggest that UDCs are at least as viable a source of nuclear donor material for use in somatic cell nuclear transfer, as conventionally obtained cells, and that they may be useful for other cell-based technologies.
Nuclear transfer for cloning, and for establishing cells and animal and disease models is a long standing technology. This, to our knowledge the first report of a species, other than mice [3] to be cloned from cultured UDCs used as donor nuclei, and the first to use UDCs from clones, or to make the cloning comparisons with other cloned and IVF derived embryos. Fibroblasts are a standard cell type for SCNT, many other cell types have been used and various efficiencies have been reported [22]. This may be in part due to methylation, shown to influence SCNT efficiency [23]. Most biological fluids require some form of ingress to be obtained, urine is an exception and methods for its retrieval may circumvent the need for active sampling. Noninvasive techniques for obtaining somatic cells, including from milk, blood and isolated reports from urine have also been shown, yet few methods have established urine derived cell culture prior to SCNT [24, 25]. Here we show for the first time that canines can be cloned from urine derived cells. Additionally, we have circumstantial evidence, through the presence of what was morphologically an embyroid body (S1 Fig) that iPSCs can be generated from urine directly, as has previously been done with human urine, further validating its potential across species. This is, also to our knowledge, the first report of cloned cattle embryos produced from UDCs and; the only other report of cloning using UDCs was in the production of a buffalo (Bubalus bubalis) calf, by means of handmade cloning (HMC) from cells isolated from urine and from milk [26, 27]. In this report they noted significant difference in genes related to histone modifications of H3K27me3 and cellular differentiation and to have a potential regulatory capacity in stem cells [28, 29]. This increased activation potential observed in in UDC derived SCNT may reflect a stem cell population of the donor cell origin [30]. If UDCs have an increased capacity for gene activation, they may make better candidates for gene modification [31]. This may in part explain the unexpected transfection efficiency observed.
In this study, UDCs were generated from a minimum of three different cell and or tissue types (Fig 3) and the urine contained additional cell types which were not represented in the culture or subsequent analysis. This agrees with the reports of up to seven, often difficult to identify, cell types are found in urine [32, 33]. The cells were found to be primarily of epithelial origin but mesenchymal cells were present (Fig 3). These cells may have originated from the bladder, urethra or kidney, likely renal tubular cells [3] or other potential cell types of urothelial origin [34]. Further immunohistochemical staining, i.e. for alpha smooth muscle actin and myosin may provide information to the origin of the VIM positive cells observed [35]. Epithelial cells may originate from the bladder, urethra or kidney, renal and may be proximal tubular epithelial cells CD10/CD13 double-positive [36] Several markers may be used to further clarify the origin of cells within the UDC population. For instance blood, kidney, by the mesynchymal marker CD90 [37], granulocyte/eosinophils by CD16/CD34 and neutrofiles CD11b/CD18 [38, 39], pericytes by NG2 [40] and myofibroblast by aSMA [41]. The epithelial cells observed may further be identified by markers such as Cytokeratin 7, indicating epithelia lining cavities of the internal organs, ducts and vessels or CD45 positivity for hematopoietic cells [42]. Further investigation is warranted to determine the cell source and results may be inferred from the study of other species. Human and murine studies, combined with the potential for medical revelation, have a more complete molecular toolset available, and may be better candidates for study.
It has been suggested that urinary epithelial cells may be a suitable source for transplantation utilizing stem cell technologies [43]. The population and origin of UDCs is not completely understood, although we have indicated there are likely multiple originators including a potential stem cell component, and thus more pluripotent cell state may have contributed to the success in the use of UDCs for SCNT.
Cell number and culture efficacy varied widely between individuals and urinations. In general, when crystals were observed in urine, efficiency decreased, although there was too little consistency to objectively determine the differences. Health, age and hydration are likely variables which may contribute to the number and quality of cells, culturable or otherwise in urine. In canines, it was empirically observed that darker urine, presumably due to a dehydrated stated, contained fewer cells, those present appeared highly keratinized and culture efficiency was poor. UDCs were obtained from animals of varying ages and no observable differences were seen between breeds in either canine or bovine groupings. The significant difference in the number of cells per volume of urine between canine and bovine specimens with an approximate 100-fold difference by volume remains unexplained (Fig 1). Urination volume did not strongly correlate with cell numbers, a potential indication that the majority of urine cells may originate from epithelial linings, pulled away during the flow of urine (Fig 2). This would be consistent with the apparent majority of cells being epithelial in nature (Fig 3). The large cells observed were not identified, they could represent a number of cell types reported in urine from macrophages to lymphocytes and eosinophils [32], but further species specific investigation would be required.
Despite the prolonged exposure to urine both in the body and in storage, up to 140 hrs many cells maintained their membrane integrity, and some were able to be cultured, up to 72 hrs (Fig 2). Due to the negative P.I. stain, we theorize that these cells may still be usefully in either direct SCNT or use in obtaining iPSCs, further study is required. There is one report of mice being cloned directly from urine cells [3], the viable uncultured cells may prove functional in this application, or for the generation of ESCs. It was a surprise that cells maintained their viability after prolonged storage of urine at 4°C, initial thoughts were that may be related to the presence of the function urate oxidase (UOX), a gene in canids and other mammals, lost in hominids, its product, uricase, is involved in urate degradation, which is toxic to cells, to allantoin [44, 45].
Some practical limitations to urine collection and transportation exist and collection of wild animal urine may be limited to species with routine urination or marking behaviors. Collection from retromingent animals is more easily accomplished, yet contamination remains an issue as aseptic collection of any animal urine is difficult. We were able to culture cells collected from urine obtained from a cleaned surface, however multiple attempts and several washing and centrifugation steps were required before cells could be obtained that were free from contamination. A limitation and area for further investigation would be a comparison of UDC iPSC induction efficiency, as we did not have a direct comparison with fibroblasts. Additionally, direct induction of fresh urine cells, which has been reported in other species, further justifies the continued investigation of urine as a cell source [46].
One disadvantage to this method is the relatively low number of initial cells obtained and the time required to obtain confluence, approximately 21 days in most cases. Efficiency of culture can be increased using growth factor and cytokine supplementation, with i.e. SingleQuots (Lonza). Due to this low relative growth, we wondered about senescence, which is known in a number of disorders affecting the urinary system [47]. A benefit to the use of this method for SCNT is the low number of cells required, theoretically one cell per oocyte. In practice, larger cell numbers are easier to work with and cloning efficiencies are increased by confluent culture by contact inhibition and culture methods [48]. The 25% pregnancy rate and cloning efficiency achieved (Table 1) in the production of pups from UDCs was consistent with cloning rates we have observed and those reported by others [49]. Although SCNT rates are reported to be quite low, pregnancy rates can be significantly higher, depending on the species, number of oocytes and method of transfer [50]. Variables in efficiency rates can be influenced by a number of factors including: donor cell type, methylation status, cell cycle stage, transfer techniques and oocyte quality 11. Varying cloning efficiency rates been reported, with the vast majority under 5% [11, 51], this warrants further investigation for cell type and led to the testing of iPSC generation, from which embryoid body like structures were formed (S1 Fig).
The transfection rate following iPSC plasmid transfection was unexpectedly high. The resultant cell clusters exhibiting adhesion independent growth, resembled embryoid bodies. Further investigation to the potential growth, culture and developmental competence of these cells would be required to determine the nature of their pluripotency. Recent work has also established the potential of complete male and female gamete generation in vitro in multiple species, including from stem cells [52–55]. Furthermore, mice have been produced with the genetic material from cells originating from two male mice [56]. Several of our associated labs have expressed difficulty in the establishment and maintenance in canines, it wasn’t until recently that canine iPSCs were produced [57]. Although ES and iPSCs from canines have been established, standard protocols for their culture are currently lacking [58]. The transfection results and presumptive embryoid body formation we observed would indicate that canine iPSCs may not be as difficult to produce and culture as we had assumed. It is postulated that certain cells are more capable of being reprogramed, although other experiments and our own observations have shown that difficult to determine [59]. This difference in cloning efficiency and phenotypic variation remains poorly characterized and without explanation, although generally assumed to be due to epigenetic reprograming failure [8, 60]. This warrants further investigation of cellular reprograming and iPSC induction prior to use in SCNT, which may increase cloning efficiencies which would in turn decrease or increase the potential positive outcome of difficult cloning cases.
We attempted to determine the maximum storage time of urine to obtain viable cells. We were able to successfully culture UDCs from urine stored up to 72 hrs, although the efficiency dropped after 48 hrs and obtained membrane integrity for more than 120hrs, indicated by negative PI staining. This further validates the potential use of urine as cell source for conservation biology, addressing concerns about storage times associated with urine obtained in remote places.
Conclusion
In this study we have verified the potential for UDCs as a noninvasive source for obtaining cells which could be used for producing viable offspring and likely a number of applications including diagnostics and or human therapeutic uses [43]. The methods warrant further investigation and other applications may be arise from our production of live offspring, embryo analysis and UDC transfection and potential iPSCs formation [61].
We conclude that urine is both a viable cells source of vital cells and that UDCs may be obtained from multiple species, that UDCs are useful for expansion as donor nucleus for somatic cell nuclear transfer and dedifferentiated stem cells capable of producing viable progeny.
Methods
All materials were purchased from Sigma-Aldrich, unless otherwise indicated.
Animals
Urine was obtained from adult and adolescent, male and female dogs, analysis was conducted on all cell types. Urine-derived cells used for cloning were done so from clones, which acted as their traditional biopsy controls. Surrogate and donors were used from mixed breed dogs with ages between 2 and 7 years (body weight 20-25kg), housed in indoor kennels, fed standard commercial dog food once daily, and given water ad libitum. All animals included within this study were done so with owner consent. All animal procedures were conducted in accordance with the animal study guidelines and approved by the committee at the Sooam Biotech Research Foundation, Korea (permit no. C-12-01).
UDCs
Urine was obtained from bovine (n = 27) and canine (n = 10) origin, from multiple breeds, sampled during micturition in a sterile vessel, or collected from a sterilized surface and placed directly on ice or in refrigeration at 4 degrees centigrade until further use. Samples were stored for various time points, but used within a 1hour +/- variation for all time points given. Urine was centrifuged at 150 RCF and washed with phosphate buffered saline five times before resuspension in DMEM+20%FBS, counted and diluted to 1x105 cells/ml as available. Urine cells were cultured in media containing 10–20% sterile filtered urine (0.2μm filter), from the supernatant of the first centrifugation + a mixture of hormones and substrates including 0.5 μg/mL hydrocortisone, 10ng/ml bFGF and 0.1% insulin. Culture plating with protein: BSA (1%), Laminin, Collagen, Vitronectin and Fibronectin were done with 0.12-1mg/ml in 0.4ml 4 well dishes (Cat No 176740 Nunc, Thermo Fisher Scientific) for 1hr at 37°C were washed gently 1x with PBS before seeding with urine cells (S1 Table). Cells from fresh urine consistently adhered to culture plates by day six. Increased contamination rates and an inability for cells to attach to culture plates increased with storage time, cells stored in chilled media or from freshly collected urine fared better.
Preparation of cells for SCNT.
To obtain cells for nuclear transfer; a skin biopsy was obtained from a living Saluki. These clones would later be used as a syngeneic control for UDC SCNT. After mechanical and enzymatic dissociation of the tissue (Hossein, 2009 #2), cells were allowed to attach to a culture dish (Product No. 353002, Falcon®, Corning) in Dulbecco modified Eagle medium (Cat. #11995065, DMEM high glucose pyruvate, GibcoTM) with 10% fetal bovine serum (Cat. #16000044, FBS, GibcoTM) at 37 °C in an atmosphere of 5% CO2 and air. Media was changed every 48 hrs until the cellular monolayer reached approximately 80% confluence. UDCs used in the cloning experiments were obtained, as described above (UDCs), from two cloned saluki pups of the same donor origin. Both explants and UDCs were cultured until they approached 90% confluence, trypsinized and reconstituted at concentrations of approximately 1 x 106 cells per mL, then cryopreserved in cryovials containing DMEM + 20% FBS +10% DMSO. Prior to cryopreservation cells were taken in the same manner to be used as donor cells for SCNT. After cell populations reached near confluence, cells were used for SCNT (Nuclear Transfer).
Nuclear transfer (SCNT).
Canine oocytes were collected from domestic canines exhibiting spontaneous estrus, with ovulation status determined by serum progesterone concentration, as previously described [62]. Oviducts were flushed bilaterally with 10ml TCM 199 supplemented with HEPES (Invitrogen Corporation, Carlsbad, CA). Oocytes were enucleated after cumulus cell denuding and pre-staining with 5μg/ml bisbenzimide (Hoechst 33342) as previously described [63] utilizing an inverted microscope equipped with epifluorescence (TE2000-E; Nikon Corporation, Japan).
Bovine oocytes were obtained from aspiration of ovaries obtained from a local abattoir, oocyte complexes were cultured in groups of 20 to 25 per well in a 6-well dish for 40 to 42 hrs in BO-IVM (IVF Bioscience, Falmouth, UK) at 38°C in 5% CO2 in humidified atmosphere after they had first been selected for homogenous cytoplasm with adequate cumulus layers and washed three times in Dulbecco’s phosphate buffered saline (DPBS; Welgene, Gyeongsan, KR) supplemented with 5 mg/ml bovine serum albumin (Thermo Fisher Scientific, Waltham, MA, USA) and 1% (v/v) antibiotic-antimycotic (Thermo Fisher Scientific, Waltham, MA, USA). For in vitro maturation (IVM), selected COCs were cultured in Enucleated metaphase II oocytes and donor cells, a dermal fibroblast or UDC derived cell, with a smooth surface, was transferred into the perivitelline space of an enucleated canine or bovine oocyte, in the same manner, using a fine glass pipette. Cell oocyte couplets were equilibrated in a 0.26 M mannitol solution containing 0.5 mM of HEPES, 0.1 mM of CaCl2 and MgSO4 for 4 min. Following equilibration couplets were transferred to a chamber containing mannitol, with two platinum electrodes. Couplets were fused using two DC pulses of 1.75 to 1.85 kV/cm for 15 μs, provided by a BTX Electro-Cell Manipulator 2001 (BTX, Inc., San Diego, CA, USA). After simultaneous fusion and activation, reconstructed oocytes, were cultured in groups of 5 to 6 in 25 μL microdrops of mSOF covered with mineral oil for a maximum of 1 hr at 39 °C in a humidified atmosphere (5% O2, 5% CO2 and 90% N2) until embryo transfer [64]. Bovine couplets were fused in a similar manner with two 580 Volts, 15 mS pulses reconstructed embryos were activated by treatment to 5 μM ionomycin for 3 min and subsequently with 2 mM 6-dimethylaminopurine (6-DMAP) in BO-IVC (IVF Bioscience, Falmouth, UK) under a humidified atmosphere of 5% CO2 at 39°C for 4 hrs. Embryos were then cultured at 38°C in a humidified atmosphere of 5% CO2 and 5% O2in groups of 6 to 8 per droplet oil-covered for 7–8 days at which point they were fixed in 0.2% Formalin before embryo evaluation.
Collection of oocytes, embryo transfer and pregnancy diagnosis
Surrogate dogs exhibiting natural estrus were matched with oocyte donors at the same cycle stage as described [64]. The ovary exposed via a ventral laparotomy, the fat layer covering the ovary grasped with forceps and suspended with a suture to exteriorize the fimbriated end of the oviduct. Reconstructed embryos were loaded into a tomcat catheter (3.5 Fr × 5.5”; Severeign, Sherwood, USA) with a minimum volume of fluid (2 to 4μl) and gently transferred into the 2/3 distal position of oviduct through infundibulum. After 25 to 30 days, pregnancy was confirmed using transabdominal ultrasound with a real-time ultrasonography. Ultrasonography was performed either in standing or in a dorsal recumbent position using a portable ultrasound machine with a 3.5 MHz curved transducer (Sonace R7; Samsung Medison, Seoul, Korea). No bovine embryos were transferred.
Transfection using iPSC plasmids
Urine cells washed and held in PBS as well as UDCs, trypsinized and held in PBS were electroporated in the presence of our plasmid then cultured in ES medium atop a bed of mitomycin C inactivated mouse embryo fibroblasts (MEFs) as described [65] for 10 days. Cells were imaged using a fluorescent microscope (Nikon, Eclipse TE2000).
iPSC generation was done using the pDON-5 OSKLN plasmid co-transfected with a generic GFP plasmid and the iPSC inducing plasmid pDon-5 OKSLN (Cat No. 3671 Takara-bio, Shiga, Japan). The plasmid was linearized prior to use using the restriction enzyme DraI at 5μg of plasmid in a reaction volume of 30μl. Plasmids were purified using equal volume of phenol chlorophorm followed by isopropanol precipitation and washing before being suspended in 10μl of distilled and autoclaved water. 1μg of plasmid per ml was used for transfection with a single 20ms pulse of 1600V. Transfection efficiency was validated using a circular GFP plasmid. Cells expressing GFP were considered to be positively transfected and were further confirmed with staining for OCT3/4 and CDX2. Cells were plated in ES media (DMEM/F12) with 1% NEAA, 1% glutamax, 1% antibiotic antimycotic, 0.1% beta mercaptoethanol, 1% B-27 Serum Free supplement 50x, 1% N-2 supplement, 3μM CHIR99021, 25μM PD98059 (Cat NoPHZ1164 Thermo Fisher Scientific), 10ng/ml bFGF recombinant human protein and 20% KnockOutTM Serum replacement. Following verification of transfection and morphological change, further culture was not attempted.
Polymerase Chain Reaction (PCR)
Cells were treated with TRIzol (Ambion, Austin, TX, USA). Total RNA concentration was determined at absorbance 260 nm. 1 μg of RNA was transcribed by MMLV (iNtRON Bio, Gyeonggi-do, Republic of Korea) with a 9-mer random primer (TaKaRa Bio, Kusatsu, Japan) to produce the complementary DNA (cDNA). PCR was performed with 10 pM of each specific primer. The primer sequences were as follows: permeability-glycoprotein 1 (P-gp) or multidrug resistance protein 1 (ABCB1), forward ctcgcatcttgcttctggat, reverse gctccttgattctgccattc; β-actin, forward ctcttccagccttccttcct, reverse gggcagtgatctctttctgc. And for Vimentin: forward Vimentin, reverse ttcgacggcaaagttctctt; β-actin, forward agaacatcatccctgcttc, reverse ttgaagtcacatgagaccac. The PCR was performed 40 cycles under the following conditions: denaturation at 95°C for 30 sec, annealing at 59°C for 30 sec, and extension at 72°C for 30 sec.
Immunohistochemistry and staining
The cell numbers of blastocysts were counted following HOESCT staining and imagine under a fluorescent microscope. Immunohistochemical stains and the proportion of cells stained were counted similarly using ImageJ estimated ICM and Trofectoderm cells were not distinguished and total blastocyst cell count was used as a measure of developmental quality at day 6–8 post SCNT or IVM, in the case of controls. Embryos were fixes and stained for TUNEL, TUNEL cells were counted and compared between groups. Nearly confluent cells cultured from direct urine derivation or sub-cultured frozen cells were washed with PBS and fixed in 4% formaldehyde, washed with PBS 1% BSA and 0.1% Tween and blocked with the same washing solution+ 10% donkey serum for 6 hrs at room temperature. Primary antibodies for E-Cad, VIM, and pan-cytokeratin were used at a dilution of 1:500, in 4% Donkey Serum in PBS supplemented with 1%BSA and 0.1% tween at 4C for 8 hrs. (overnight).
Stained cells were washed 4x with PBS container 1%BSA and 0.1% tween and were counter stained with no secondary antibodies or Donkey anti-Rat, anti-rabbit, and anti-mouse. 488, 488 and 555 respectively. Secondary antibody dilution of 1:500 was done in PBS + 1% donkey serum. Staining was done in the culture with cells which had been cultured on glass coverslips added prior to seeding.
Hoechst was added and allowed to stain for 5 minutes at the second to the last of 5 PBS washes prior to imaging. Images were taken on an inverted fluorescent microscope (Nikon, Eclipse TE2000) and analyzed using ImageJ.
Western blot
Western blot analyses were performed as previously described unless stated otherwise [66]. 1 × 105 cumulus cells were sampled and lysed using the EzRIPA Lysis kit (WSE-7420; ATTO Corporation, Republic of Korea) following the manufacturer’s instructions. BCA (Bicinchoninic acid) TM Protein Assay kit (23225; Thermo Fisher Scientific) were used to for protein determination, and 10 μg samples were separated on 12% SDS-PAGE gels prior to transfer to polyvinylidene fluoride (PVDF) membranes. PVDF membranes were incubated at 4°C with primary antibodies: Anti-E Cadherin (DECMA-1) and Anti-Reticular Fibroblast and Fibers (ER-TR7)(Abcam) and Vimentin and Cytokeratin Pan Type I/II (MA5-13156) (Thermo Fisher) at 1:1000 dilutions overnight. After overnight incubation, the membranes were incubated with the appropriate IgG-conjugated horseradish peroxidase secondary antibody (Cell Signaling Technology) for 2 hrs at room temperature. Immunoreactive proteins were visualized using X-ray film and the bands were imaged using a scanner. ImageJ software (version 1.37; Wayne Rasband, NIH, USA) was used for the measurement of optical density and the data were normalized to internal control. All experiments were repeated three times (n = 3).
Statistical analysis
Offspring development rates were evaluated using chi-squared tests. P < 0.05 was considered significant. A one-way ANOVA was used to evaluate differences between TUNEL staining for the three conditions and students t-tests were used for comparison between two groupings, such as cell number and viability between two groups.
Supporting information
S1 Fig.
A) co-transfected canine UDCs with an iPSC inducing plasmid and expressing GFP (green) and UDCs morphological change 48hrs following transfection. B) embryoid body like formation C) senescent cell morphology and embyroid body like structure 10 days following iPSC plasmid transfection.
https://doi.org/10.1371/journal.pone.0278607.s001
(TIF)
S1 Table. UDC culture conditions and result of culture.
Effectivity compared with the same conditions, replicates of 3 or more were done in each case using the same urine source and cell number, effectivity represents observational differences alone rated “+” beneficial, “n” = neutral or effect not noticeably different than the control and “-” representing negative or potentially negative effects. *-/+ concentration dependent, high concentration negative effect, lower concentration positive effect.
https://doi.org/10.1371/journal.pone.0278607.s002
(DOCX)
Acknowledgments
We would like to acknowledge Bae JinHyun for her assistance in urine collection and Mr. Han and Dr. Lee for their support. We would like to additionally acknowledge His highness Mohammed bin Rashid Al Maktoum for the ability to obtain urine and produce and report on the UDC clones from his dogs.
References
- 1. Bondue T, Arcolino FO, Veys KRP, Adebayo OC, Levtchenko E, et al. (2021) Urine-Derived Epithelial Cells as Models for Genetic Kidney Diseases. Cells 10. pmid:34204173
- 2. Pavathuparambil Abdul Manaph N, Al-Hawwas M, Bobrovskaya L, Coates PT, Zhou XF (2018) Urine-derived cells for human cell therapy. Stem Cell Res Ther 9: 189. pmid:29996911
- 3. Mizutani E, Torikai K, Wakayama S, Nagatomo H, Ohinata Y, et al. (2016) Generation of cloned mice and nuclear transfer embryonic stem cell lines from urine-derived cells. Sci Rep 6: 23808. pmid:27033801
- 4. Tachibana M, Amato P, Sparman M, Gutierrez NM, Tippner-Hedges R, et al. (2013) Human embryonic stem cells derived by somatic cell nuclear transfer. Cell 153: 1228–1238. pmid:23683578
- 5. Trounson A, DeWitt ND (2013) Pluripotent stem cells from cloned human embryos: success at long last. Cell Stem Cell 12: 636–638. pmid:23746970
- 6. Gouveia C, Huyser C, Egli D, Pepper MS (2020) Lessons Learned from Somatic Cell Nuclear Transfer. Int J Mol Sci 21. pmid:32230814
- 7. Jeong Y, Olson OP, Lian C, Lee ES, Jeong YW, et al. (2020) Dog cloning from post-mortem tissue frozen without cryoprotectant. Cryobiology 97: 226–230. pmid:32268132
- 8. Hwang KC, Cho SK, Lee SH, Park JY, Kwon DN, et al. (2009) Depigmentation of skin and hair color in the somatic cell cloned pig. Dev Dyn 238: 1701–1708. pmid:19504460
- 9. Cho SK, Kim JH, Park JY, Choi YJ, Bang JI, et al. (2007) Serial cloning of pigs by somatic cell nuclear transfer: restoration of phenotypic normality during serial cloning. Dev Dyn 236: 3369–3382. pmid:17849457
- 10. Wakayama S, Kohda T, Obokata H, Tokoro M, Li C, et al. (2013) Successful serial recloning in the mouse over multiple generations. Cell Stem Cell 12: 293–297. pmid:23472871
- 11. Whitworth KM, Prather RS (2010) Somatic cell nuclear transfer efficiency: how can it be improved through nuclear remodeling and reprogramming? Mol Reprod Dev 77: 1001–1015. pmid:20931660
- 12. Liu S, Zhang D, Chen Y, Wang B, Qiao L (2015) Potential applications of induced pluripotent stem cells (iPSCs) in the modeling of gastrointestinal disorders. Curr Stem Cell Res Ther 10: 220–227. pmid:25723188
- 13. Hytonen MK, Lohi H (2016) Canine models of human rare disorders. Rare Dis 4: e1241362. pmid:27803843
- 14. Starkey MP, Scase TJ, Mellersh CS, Murphy S (2005) Dogs really are man’s best friend—canine genomics has applications in veterinary and human medicine! Brief Funct Genomic Proteomic 4: 112–128. pmid:16102268
- 15. Shearin AL, Ostrander EA (2010) Leading the way: canine models of genomics and disease. Dis Model Mech 3: 27–34. pmid:20075379
- 16. Kirkness EF, Bafna V, Halpern AL, Levy S, Remington K, et al. (2003) The dog genome: survey sequencing and comparative analysis. Science 301: 1898–1903. pmid:14512627
- 17. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, et al. (2005) Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 438: 803–819. pmid:16341006
- 18. Songsasen N, Wildt DE (2007) Oocyte biology and challenges in developing in vitro maturation systems in the domestic dog. Anim Reprod Sci 98: 2–22. pmid:17097840
- 19. Lee BC, Kim MK, Jang G, Oh HJ, Yuda F, et al. (2005) Dogs cloned from adult somatic cells. Nature 436: 641. pmid:16079832
- 20. Biase FH, Rabel C, Guillomot M, Hue I, Andropolis K, et al. (2016) Massive dysregulation of genes involved in cell signaling and placental development in cloned cattle conceptus and maternal endometrium. Proc Natl Acad Sci U S A 113: 14492–14501. pmid:27940919
- 21. Oback B, Wells DN (2007) Cloning cattle: the methods in the madness. Adv Exp Med Biol 591: 30–57. pmid:17176553
- 22. Inoue K, Ogonuki N, Mochida K, Yamamoto Y, Takano K, et al. (2003) Effects of donor cell type and genotype on the efficiency of mouse somatic cell cloning. Biol Reprod 69: 1394–1400. pmid:12801984
- 23. Blelloch R, Wang Z, Meissner A, Pollard S, Smith A, et al. (2006) Reprogramming efficiency following somatic cell nuclear transfer is influenced by the differentiation and methylation state of the donor nucleus. Stem Cells 24: 2007–2013. pmid:16709876
- 24. Kamimura S, Inoue K, Ogonuki N, Hirose M, Oikawa M, et al. (2013) Mouse cloning using a drop of peripheral blood. Biol Reprod 89: 24. pmid:23803554
- 25. Kishi M, Itagaki Y, Takakura R, Imamura M, Sudo T, et al. (2000) Nuclear transfer in cattle using colostrum-derived mammary gland epithelial cells and ear-derived fibroblast cells. Theriogenology 54: 675–684. pmid:11101030
- 26. Madheshiya PK, Sahare AA, Jyotsana B, Singh KP, Saini M, et al. (2015) Production of a Cloned Buffalo (Bubalus bubalis) Calf from Somatic Cells Isolated from Urine. Cell Reprogram 17: 160–169. pmid:26053516
- 27. Jyotsana B, Sahare AA, Raja AK, Singh KP, Singla SK, et al. (2015) Handmade Cloned Buffalo (Bubalus bubalis) Embryos Produced from Somatic Cells Isolated from Milk and Ear Skin Differ in Their Developmental Competence, Epigenetic Status, and Gene Expression. Cell Reprogram 17: 393–403. pmid:26332294
- 28. Karmodiya K, Krebs AR, Oulad-Abdelghani M, Kimura H, Tora L (2012) H3K9 and H3K14 acetylation co-occur at many gene regulatory elements, while H3K14ac marks a subset of inactive inducible promoters in mouse embryonic stem cells. BMC Genomics 13: 424. pmid:22920947
- 29. Lai Q, Du W, Wu J, Wang X, Li X, et al. (2017) H3K9ac and HDAC2 Activity Are Involved in the Expression of Monocarboxylate Transporter 1 in Oligodendrocyte. Front Mol Neurosci 10: 376. pmid:29184483
- 30. Bento G, Shafigullina AK, Rizvanov AA, Sardao VA, Macedo MP, et al. (2020) Urine-Derived Stem Cells: Applications in Regenerative and Predictive Medicine. Cells 9. pmid:32121221
- 31. Gibney ER, Nolan CM (2010) Epigenetics and gene expression. Heredity (Edinb) 105: 4–13. pmid:20461105
- 32. Ringsrud KM (2001) Cells in the Urine Sediment. Laboratory Medicine 32: 153–155.
- 33. Wald R, Bell CM, Nisenbaum R, Perrone S, Liangos O, et al. (2009) Interobserver reliability of urine sediment interpretation. Clin J Am Soc Nephrol 4: 567–571. pmid:19261816
- 34. Holthofer H, Miettinen A, Lehto VP, Lehtonen E, Virtanen I (1984) Expression of vimentin and cytokeratin types of intermediate filament proteins in developing and adult human kidneys. Lab Invest 50: 552–559. pmid:6201675
- 35. Lau CL, Chacko S (1996) Identification of two types of smooth muscle cells from rabbit urinary bladder. Tissue Cell 28: 339–355. pmid:8701436
- 36. Van der Hauwaert C, Savary G, Gnemmi V, Glowacki F, Pottier N, et al. (2013) Isolation and characterization of a primary proximal tubular epithelial cell model from human kidney by CD10/CD13 double labeling. PLoS One 8: e66750. pmid:23799132
- 37. Michelis KC, Nomura-Kitabayashi A, Lecce L, Franzen O, Koplev S, et al. (2018) CD90 Identifies Adventitial Mesenchymal Progenitor Cells in Adult Human Medium- and Large-Sized Arteries. Stem Cell Reports 11: 242–257. pmid:30008326
- 38. Hassani M, van Staveren S, van Grinsven E, Bartels M, Tesselaar K, et al. (2020) Characterization of the phenotype of human eosinophils and their progenitors in the bone marrow of healthy individuals. Haematologica 105: e52–e56. pmid:31101758
- 39. Abdel-Salam BK, Ebaid H (2014) Expression of CD11b and CD18 on polymorphonuclear neutrophils stimulated with interleukin-2. Cent Eur J Immunol 39: 209–215. pmid:26155126
- 40. Stallcup WB (2018) The NG2 Proteoglycan in Pericyte Biology. Adv Exp Med Biol 1109: 5–19. pmid:30523586
- 41. Wang J, Zohar R, McCulloch CA (2006) Multiple roles of alpha-smooth muscle actin in mechanotransduction. Exp Cell Res 312: 205–214. pmid:16325810
- 42. Trowbridge IS, Thomas ML (1994) CD45: an emerging role as a protein tyrosine phosphatase required for lymphocyte activation and development. Annu Rev Immunol 12: 85–116. pmid:8011300
- 43. Sauer V, Tchaikovskaya T, Wang X, Li Y, Zhang W, et al. (2016) Human Urinary Epithelial Cells as a Source of Engraftable Hepatocyte-Like Cells Using Stem Cell Technology. Cell Transplant 25: 2221–2243. pmid:27512979
- 44. Zhang C, Fan K, Zhang W, Zhu R, Zhang L, et al. (2012) Structure-based characterization of canine-human chimeric uricases and its evolutionary implications. Biochimie 94: 1412–1420. pmid:22481018
- 45. Maiuolo J, Oppedisano F, Gratteri S, Muscoli C, Mollace V (2016) Regulation of uric acid metabolism and excretion. Int J Cardiol 213: 8–14. pmid:26316329
- 46. Zhou T, Benda C, Duzinger S, Huang Y, Li X, et al. (2011) Generation of induced pluripotent stem cells from urine. J Am Soc Nephrol 22: 1221–1228. pmid:21636641
- 47. Santin Y, Lluel P, Rischmann P, Game X, Mialet-Perez J, et al. (2020) Cellular Senescence in Renal and Urinary Tract Disorders. Cells 9. pmid:33167349
- 48. Ma L, Liu X, Wang F, He X, Chen S, et al. (2015) Different Donor Cell Culture Methods Can Influence the Developmental Ability of Cloned Sheep Embryos. PLoS One 10: e0135344. pmid:26291536
- 49. Kim MJ, Oh HJ, Hwang SY, Hur TY, Lee BC (2018) Health and temperaments of cloned working dogs. J Vet Sci 19: 585–591. pmid:29929355
- 50.
(2002) Scientific and Medical Aspects of Human Reproductive Cloning: National Academies Press.
- 51.
Wilmut I, Paterson, LA (2015) Somatic Cell Nuclear Transfer (Cloning) efficiency, 2002 [dataset]. Univesrity of 2015 ed. Roslin Institute: University of Edinburgh.
- 52. Wang SY, Cui YG, Qin LJ (2017) [Differentiation of pluripotent stem cells into male germ cells: An update]. Zhonghua Nan Ke Xue 23: 468–472. pmid:29717842
- 53. Hirao Y, Naruse K, Kaneda M, Somfai T, Iga K, et al. (2013) Production of fertile offspring from oocytes grown in vitro by nuclear transfer in cattle. Biol Reprod 89: 57. pmid:23884646
- 54. Hikabe O, Hamazaki N, Nagamatsu G, Obata Y, Hirao Y, et al. (2016) Reconstitution in vitro of the entire cycle of the mouse female germ line. Nature 539: 299–303. pmid:27750280
- 55. Zhang PY, Fan Y, Tan T, Yu Y (2020) Generation of Artificial Gamete and Embryo From Stem Cells in Reproductive Medicine. Front Bioeng Biotechnol 8: 781. pmid:32793569
- 56. Deng JM, Satoh K, Wang H, Chang H, Zhang Z, et al. (2011) Generation of viable male and female mice from two fathers. Biol Reprod 84: 613–618. pmid:21148107
- 57. Baird A, Barsby T, Guest DJ (2015) Derivation of Canine Induced Pluripotent Stem Cells. Reprod Domest Anim 50: 669–676. pmid:26074059
- 58. Vaags AK, Rosic-Kablar S, Gartley CJ, Zheng YZ, Chesney A, et al. (2009) Derivation and characterization of canine embryonic stem cell lines with in vitro and in vivo differentiation potential. Stem Cells 27: 329–340. pmid:19038794
- 59. Hwang I, Jeong YW, Kim JJ, Lee HJ, Kang M, et al. (2013) Successful cloning of coyotes through interspecies somatic cell nuclear transfer using domestic dog oocytes. Reprod Fertil Dev 25: 1142–1148. pmid:23217630
- 60. Long CR, Westhusin ME, Golding MC (2014) Reshaping the transcriptional frontier: epigenetics and somatic cell nuclear transfer. Mol Reprod Dev 81: 183–193. pmid:24167064
- 61. Inoue Y, Kishida T, Kotani SI, Akiyoshi M, Taga H, et al. (2019) Direct conversion of fibroblasts into urothelial cells that may be recruited to regenerating mucosa of injured urinary bladder. Sci Rep 9: 13850. pmid:31554870
- 62. Kim JJ, Park KB, Choi EJ, Hyun SH, Kim NH, et al. (2017) Relationship between time post-ovulation and progesterone on oocyte maturation and pregnancy in canine cloning. Anim Reprod Sci 185: 75–82. pmid:28843841
- 63. Hossein MS, Jeong YW, Park SW, Kim JJ, Lee E, et al. (2009) Birth of Beagle dogs by somatic cell nuclear transfer. Animal reproduction science 114: 404–414. pmid:19059739
- 64. Kim S, Park SW, Hossein MS, Jeong YW, Kim JJ, et al. (2009) Production of cloned dogs by decreasing the interval between fusion and activation during somatic cell nuclear transfer. Molecular reproduction and development 76: 483–489. pmid:18951374
- 65. Jozefczuk J, Drews K, Adjaye J (2012) Preparation of mouse embryonic fibroblast cells suitable for culturing human embryonic and induced pluripotent stem cells. J Vis Exp. pmid:22760161
- 66. Yoo Y-M, Jeung E-B (2018) Calbindin-D28k in the Brain Influences the Expression of Cellular Prion Protein. Oxidative medicine and cellular longevity 2018. pmid:29541346
