https://orcid.org/0000-0001-7164-8363
Figures
Abstract
Snakes of the genus Boa are outstanding elements of the New World biota with a broad sociological influence on pop culture. Historically, several taxa have been recognized in the past 300 years, being mostly described in the early days of binomial nomenclature. As a rule, these taxa were recognized based on a suite of phenotypic characters mainly those from the external morphology. However, there is a huge disagreement with respect to the current taxonomy and available molecular phylogenies. In order to reconcile both lines of evidence, we investigate the phylogenetic reconstruction (using mitochondrial and nuclear genes) of the genus in parallel to the detailed study of some phenotypic systems from a geographically representative sample of the cis-Andean mainland Boa constrictor. We used cyt-b only (744bp) from 73 samples, and cyt-b, ND4, NTF3, and ODC partial sequences (in a total of 2305 bp) from 35 samples, comprising nine currently recognized taxa (species or subspecies), to infer phylogenetic relationships of boas. Topologies recovered along all the analyses and genetic distances obtained allied to a unique combination of morphological traits (colouration, pholidosis, meristic, morphometric, and male genitalia features) allowed us to recognize B. constrictor lato sensu, B. nebulosa, B. occidentalis, B. orophias and a distinct lineage from the eastern coast of Brazil, which we describe here as a new species, diagnosing it from the previously recognized taxa. Finally, we discuss the minimally necessary changes in the taxonomy of Boa constrictor complex; the value of some usually disregarded phenotypic character system; and we highlight the urgency of continuing environmental policy to preserve one of the most impacted Brazilian hotspots, the Atlantic Forest, which represents an ecoregion full of endemism.
Citation: Gonzalez RC, Bezerra de Lima LC, Passos P, Silva MJJ (2024) The good, the bad and the boa: An unexpected new species of a true boa revealed by morphological and molecular evidence. PLoS ONE 19(4): e0298159. https://doi.org/10.1371/journal.pone.0298159
Editor: Michael Schubert, Laboratoire de Biologie du Développement de Villefranche-sur-Mer, FRANCE
Received: May 4, 2023; Accepted: January 15, 2024; Published: April 17, 2024
Copyright: © 2024 Gonzalez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the paper and its Supporting Information files.
Funding: RCG: Conselho Nacional de Desenvolvimento Científico e Tecnológico [https://www.gov.br/cnpq/pt-br], Grant/Award Number: 142370/2014-2; Fundação Cearense de Apoio ao Desenvolvimento Científico e Tecnológico [https://www.funcap.ce.gov.br/], Grant/Award Number: 06319627/2021; LCBL: Coordenação de Aperfeiçoamento de Pessoal de Nível Superior [https://www.gov.br/capes/pt-br], Grant/Award Number: 51652900268; PP Conselho Nacional de Desenvolvimento Científico e Tecnológico [https://www.gov.br/cnpq/pt-br], Grant/Award Number: 309560/2018-7; Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro [https://www.faperj.br/], Grant/Award Number: E- 26/202.737/2018; MJJS Fundação de Amparo à Pesquisa do Estado de São Paulo [https://fapesp.br/], Grant/Award Number: #14/02885-2. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The constrictor snakes popularly referred to as boas are very well known both for science and for the general public since it is a common pet and also largely used in the leather and cinematographic industries [1–3]. Members of the genus Boa Linnaeus, 1758 are remarkably generalists with respect to several niche axes. The generalist habits of boas has led them to colonize the New World [3], with a distribution range from Mexico to Argentina [4–9], including several continental and oceanic islands [10–12]. Members of this genus are distributed over diverse vegetation types ranging from 30° of latitude north to 33° degrees latitude south, from sea level to a maximum altitude of 1,500 meters above sea level [1,6,10]. They have strong developed axial musculature used for constricting prey, and reach massive body sizes [13,14], although dwarfism has been reported on island populations [11,12,15,16]. Boas feed on birds [10,17,18], amphibians [19] mammals [20–23], and other reptiles [24].
The considerable variation in colour and patterns exhibited by these snakes has been traditionally used for the recognition of several subspecies [1]. However, the polychromatism phenomena added to the overlap in some meristic and/or morphometric data make the identification of these subspecies a hard task [3,25]. To date, no comprehensive taxonomic study grounded on hypothesis testing has been performed for the New World boas, mainly comprising the South American lineages.
Though there have been some modifications in the genus [26,27], the name Boa constrictor Linnaeus, 1758 has been stable for over 260 years [3,28,29]. Due to the loose boundaries among previously recognized taxa, scientists preferred to be more conservative and treat them as a single polytypic species (e.g. [5,29]), so several subspecies have been recognized as a single taxon, named Boa constrictor [25].
Hynkovà et al. [30] published the first study addressing the interrelationships for the Boa constrictor complex using a fragment of the cytochrome b mitochondrial gene (cyt b) from 115 individuals from many populations across the Neotropics. Such study, comprising six subspecies (B. c. constrictor, B. c. imperator, B. c. longicauda, B. c. sabogae, B. c. amarali, and B. c. occidentalis), included some "hybrid" representatives from different subspecies crossing (e.g., B. c. constrictor x B. c. imperator). Hynkovà et al. [30] recovered two main clades (into 67 haplotypes): one to Central America and another to South America. According to the results, there would also be genetic exchanges in border areas where individuals would have more contact, in northern Peru (subspecies B. c. longicauda and B. c. ortonii), Ecuador (subspecies B. c. melanogaster), Colombia and Venezuela. Hynkovà et al. [30] suggested that B. c. imperator might be elevated to full species rank, but they did not formalize this taxonomic proposal. They also recognized all populations from Central America clade under B. c. imperator (sensu lato), including B. c. longicauda (originally described from the Pacific coast of Peru) and B. c. sabogae (described from the Saboga Island in the Pacific coast of Panama). The authors recovered B. c. occidentalis as the most distinct haplotype within the South American Clade, being the sister group to other subspecies in this clade. Finally, still according to Hynkovà et al. [30], there was no molecular support to distinguish between B. c. constrictor and B. c. amarali in the South American clade.
Reynolds et al. [31] performed an extensive study using snakes of the families Boidae and Pythonidae, compiling a dataset that included 127 taxa and 11 loci (totalling up to 7561 bp per taxon). They recovered B. c. occidentalis as the sister group to B. c. amarali + B. c. constrictor, and B. c. imperator as the sister group to B. i. sabogae. These authors claimed to have found high support for the recognition of B. imperator in the specific rank as early proposed by Hynkovà et al. [30], although they admitted that a broader phylogenetic study throughout the distribution of B. constrictor (sensu lato) would be necessary to evaluate many of the previously proposed subspecies.
Suárez-Atilano et al. [32] used cyt b (1063 bp), Ornithine Decarboxylase (ODC—610 bp) nuclear intron and 10 microsatellite loci to infer phylogeographic structure, divergence times and historical demography of 149 individuals from B. c. imperator from Central America and Mexico. They recovered the dichotomy between samples from Central America/Mexico (North) and South America (South), and B. c. occidentalis as the sister group to other southern clade subspecies, corroborating the previous results by Hynkovà et al. [30]. In addition, Suárez-Atilano et al. [32] found two reciprocally monophyletic lineages in B. c. imperator associated with the main geographic barriers found in Mexico, which they named, respectively, PAC (Mexican Pacific Coast) and GYCA (Gulf of Mexico-Yucatan Peninsula-Central America), allied to five geographically differentiated genetic clusters. According to Suárez-Atilano et al. [32], these two B. c. imperator lineages have 4% genetic divergence among them and are in agreement with the genetic criteria established by Moritz [33] for recognizing evolutionary significant units (ESUs) and that, therefore, considers PAC and GYCA as ESUs. Suárez-Atilano et al. [32] further pointed that, although B. c. imperator is traditionally recognized throughout Mexico and Central America as a subspecies, the results obtained provided evidence that it can be considered as two distinct species.
Card et al. [11] used high-density RADseq data to identify relevant protein-coding genes that could be used for differentiating island and mainland populations of boas. According to their results, three dwarf island populations of boas would have independent origins. However, some sequences would have signs of convergence, implicating in strong connections amongst convergent phenotypes.
Currently, five species are recognized: Boa constrictor Linnaeus, 1758, B. imperator Daudin, 1803, B. sigma (Smith, 1943), B. nebulosa (Lazell, 1964), B. orophias Linnaeus, 1758, with some subspecies associate to B. imperator Daudin, 1803 along North and Central America (B. i. sabogae (Barbour, 1906)) and trans-Andean portion of South America (B. i. eques (Eydoux & Souleyet, 1841), B. i. longicauda (Price & Russo, 1991), B. i. ortonii (Cope, 1878)), and B. constrictor (B. c. amarali (Stull, 1932), B. c. constrictor Linnaeus, 1758 and B. c. melanogaster Langhammer, 1983) along mainland cis-Andean South America [3,34]. Nonetheless, despite several studies focusing on the genus diversity by using distinct molecular techniques and phylogeographic approaches [11,12,30,32,35], all of them pointed out a scenario claiming for a morphological review of the genus to understand its specific boundaries, taxa diagnosis and taxonomy [3–5,11,29,30,32,35–37].
The Atlantic Forest, boas, and other “good” histories
When examining South-American specimens of boas, we came across a cohesive and geographically structured variation, phenotypic and molecular, found along the Brazilian Atlantic Forest populations.
The Atlantic Forest was originally a large ecosystem that covered about 1,5000.000 km2, mostly within Brazil. Considering its localization, the Portuguese colonizers harboured in Brazil in 1500 in the Atlantic coast, and since then the forest has been suffering deforestation for several purposes (e.g., logging, human occupation, industrialization, agricultural expansion) [38–42]. Nowadays, the Atlantic Forest contains the most populous areas in the country (70%), including the two largest Brazilian cities (São Paulo and Rio de Janeiro), so that the remaining 12% of this biome is highly fragmented [43,44]. This biome houses about 2500 vertebrates and 20,000 plant species, and hundreds of endemic species, and many others are yet to be discovered and described [45,46]. Due to its high levels of endemism and threats, the Atlantic Forest was considered a hotspot for conservation [41,47]. Nevertheless, very little has been done to prevent this habitat loss, since past Brazilian authorities simply ignore demands on conservation and also encourage further deforestation [43].
The epic spaghetti western movie ’The Good, the Bad and the Ugly’ is part of the classical Sergio Leone’s ‘Blood Money’ Trilogy, together with ‘A Fistful of Dollars’ and ‘For a Few Dollars More’. In the story, during the United States Civil War, three gunslingers know only a part of the treasure’s location and, so they decide to join forces to find the expected prize. Here, likewise the movie, we joined forces to find a better taxonomic resolution for the cis-Andean taxa from the Boa constrictor complex (= Boa constrictor Clade sensu Hynkovà et al., [30] based on the reconciliation between the ‘good’ molecular evidence and the aledgely ‘bad’ morphological evidence. We discuss the minimal changes in the taxonomy of Boa constrictor and allied taxa in order to accommodate the current knowledge on both monophyly and diagnosability. In addition, we highlight the urgency of continuing environmental policies to preserve what remains of the Brazilian hotspots which are largely impacted nowadays, such as Atlantic Forest, one of the hottest of the 36 global biodiversity hotspots [42].
Material and methods
Molecular analyses
Tissue samples, DNA extraction, and amplification.
We have obtained tissue samples from 48 Boa individuals from museum collections, directly from fieldwork or from captive specimens (with known origin and without known hybridization, Table 1).
Genomic DNA was extracted from muscle, liver, scales and shed skin (ecdysis) using Chelex 5% following Walsh et al. [48], with some minor adaptations. Some scales and shed skin were obtained from live animals by non-invasive techniques (according to the Animal Ethics Committee from the Instituto Butantan Protocol #1148/13). We used two mitochondrial genes, cytochrome b oxidase gene (cyt-b) and NADH dehydrogenase subunit 4 (nd4), and two nuclear markers, neurotrophin 3 gene (ntf3) and nuclear intron of the ornithine decarboxylase gene (odc) as molecular markers. We amplified the mitochondrial gene cyt b with the same primers described by Hynkovà et al. [30]: L14910 (GACCTGTGATMTGAAAACCAYCGTTGT) and H16064 (CTT TGG TTT ACA AGA ACA ATG CTT TA), based on Burbrink et al. [49]. The NADH gene was amplified using primers ND4 (CACCTATGACTACCAAAAGCTCATGTAGAAGC) and LEU (CATTACTTTTACTTGGATTTGGACCA) [50]. The NTF3 primers were NTF3 F3 (ATATTTCTGGCTTTTCTCTGTGGC) and NTF3 R4 (GCGTTTCATAAAAATATTGTTTGACCGG) [8], and for ODC we used OD-F (GACTCCAAAGCAGTTTGTCGTCTCAGTGT) and OD-R (TCTTCAGAGCCAGGGAAGCCACCACCAAT) [8]. See S1 File for detailed amplification protocols. The fragment sizes amplified are about 744 bp for cyt-b, 640 bp for ND4, 590 bp for NTF3 and 500 bp for ODC. In this study, we produced a total of 153 partial sequences, being 48 referred to cyt-b, 35 to ND4, 35 to NTF3, and 35 to ODC (Table 1). We also used 30 cytb sequences obtained from the National Center for Biotechnology Information (NCBI)—GenBank—from Boa spp., including four sequences to compose the outgroup: Charina bottae, Corallus hortulana, Epicrates cenchria, and Eunectes murinus (Table 2, Fig 1).
A) sampling in western Brazil; B) sampling in southeastern Brazil.
Morphotype identification, voucher or collection number in the field, locality, country of origin, and geographical coordinates. Genes accessed from NCBI: Cytochrome-b (cyt-b). See material and methods for the rationale of re-identifications to GenBank sequences without examination of voucher specimens.
Samples were identified by the examination of museum vouchers from which they were obtained. Additionally, samples that were taken from live specimens (e.g., ecdyses) were also checked for identification. For analytical purposes, the samples were considered at the subspecific level, whether they were previously identified or after our double-checking for the identification accuracy.
Regarding the GenBank sequences, the originally given number and identification was maintained in order to make repeatability easier, except in the situations detailed below. Thus, samples present in this study comprised nine of the currently recognized taxa [34]: Boa constrictor amarali, B. c. constrictor, B. i. imperator, B. i. longicauda, B. i. ortonii, B. i. sabogae, B. nebulosa, B. occidentalis and B. orophias (Tables 1 and 2).
GenBank sequences from Boa occidentalis were not checked for identification accuracy, since their morphological and molecular features are unambiguous (see results). The sequences EU273629 (Guyana) and EU273630 (Suriname) downloaded from GenBank were identified as Boa constrictor constrictor by Hynkovà et al. [30], however they are catalogued as Boa constrictor imperator in the GenBank. Since there is no record of B. c. imperator in the cis-Andean portion of South America, we use the identification Boa constrictor constrictor for these two samples, assuming a possible mistake in labelling while uploading the sequences. The sequence EU273612 from B. constrictor longicauda (here considered as B. i. longicauda) [30] has no exact locality associated with it. Sequence KF576731 from B. nebulosa; KF576734 from B. orophias; KF576739 from B. i. ortonii; and EU273665 from B. imperator sabogae are available on GenBank, and they were checked for identification as they are. Nevertheless, these sequences were used here because they represent taxa for which we have only a few or no additional samples at all. The low number of samples, in some cases, may be due to a supposed restricted endemism and CITES category [51] of these taxa. In the case of B. c. nebulosa, B. c. orophias and B. c. sabogae (here considered as B. nebulosa, B. orophias, and B. i. sabogae, respectively), this is more notorious because they are endemic to islands. Finally, for B. c. ortonii and B. c. longicauda (here considered as B. i. ortonii and B. i. longicauda, respectively) we had access to new samples from recently collected vouchers and compared with those from GenBank.
Phylogenetic analyses and genetic distances
Sequences were edited through CodonCode Aligner 6.0.2 (LI-COR Inc) and MEGA11: Molecular Evolutionary Genetics Analysis version 11 [52]. Multiple alignment of the sequences was performed online in the MAFFT 7 [53]. The alignments were edited to eliminate or minimize gaps. We performed phylogenetic analyses using Maximum Likelihood (ML) and Bayesian inference with two matrices composed of the following datasets: (i) 73 cyt-b sequences (43 produced in this study) from samples of Mexico, Central America and South America; and (ii) the second matrix composed of 39 samples from South America, including 35 individuals with the four concatenated markers (cyt-b, ND4, NTF3, and ODC produced in this study), plus the outgroup Charina bottae, Corallus hortulana, Epicrates cenchria, and Eunectes murinus (with cytb only). The ML analyses were performed using both RaxML [54] on CIPRES, using the GTRCAT evolution model, with 1000 replicates of bootstrap, and also using MEGA11 [52], in which initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (2 categories (+G, parameter = 1.6998)). Bayesian analyses using the same two matrices on CIPRES recovered similar topologies to ML analyses. Boa atlantica sp. nov. was recovered with posterior probability = 1 for both analyses (S2A and S2B Fig).
Genetic distance analysis was conducted in MEGA11 [52], using the Kimura 2-parameter model [55]. The analysis involved 73 cyt-b nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions with less than 95% site coverage were eliminated, i.e., fewer than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position (partial deletion option). There were 652 positions in the final dataset.
Morphological analyses and species boundaries
Morphological samples and variables.
A total of 1088 specimens of all cis-Andean Boa spp. were examined for this study (406 Boa c. amarali, 404 B. c. constrictor, 9 B. c. melanogaster, 31 B. c. nebulosa, 78 B. c. occidentalis, 13 B. c. orophias, and 147 Boa sp.). We selected wild-caught specimens for examination, avoiding as much as possible the use of artificial breeds and captive ones. A list of all specimens studied herein and its identification is available in S2 File. The following measurements were taken on the side of each specimen, using a digital calliper, to the nearest 0.01: head length, head height, head width, distance between the eyes, distance between the nostrils, eye-mouth distance, eye-rostral distance, eye diameter, and cloacal spur length. Body length measures were taken with a flexible ruler: snout-vent length (SVL) and tail length (TL). Additionally, we also took the following meristic and categorical characters: Meristic: number of circumorbital scales; dorsal scale rows (anterior, midbody and posterior); gular scales, infralabial scales, intrasupraocular scales, preventral scales, scale rows between the nostrils, scale rows over the preocular stripe, subcaudal scales, subocular scales, supralabial scales, tail dorsal scales rows at the level of first subcaudal, ventral scales; number of dorsal spots; dorsal spot width: number of dorsal scales between the lateral margins of the dorsal spot; dorsal spot length: number of dorsal scales from the anterior margin of the dorsal spot up to its posterior margin; saddle length (number of dorsal scales between two consecutive dorsal spots); number of tail spots. And categorical: longitudinal head stripe shape (continuous or fragmented, with or without lateral projections); posterior limit of longitudinal head stripe (contacts first dorsal saddle or not); postocular stripe limits (contacts first dorsal saddle or not); dorsal colour and pattern; dorsal spot shape; progressive change in dorsal spots towards the tail; ventral colour and pattern; progressive ventral darkening towards the tail; colour of lateral ocelli; colour of tail spots; presence of tail interspots (fuzzy spots between two tail spots); cloacal blotch.
We prepared hemipenes according to protocols described by Pesantes [56], with modifications proposed by Zaher & Prudente [57]. In order to highlight hemipenial ornamentations, the organs were immersed in a solution of alizarin red and 70% ethanol during five minutes [58]. Subsequently, hemipenes were filled with a homogeneous mixture of coloured petroleum jelly to increase the contrast against the dyed calcified structures [59]; and the hemipenes were then finally stored in 70% ethanol. Hemipenial caracters follow [60–62]: hemipenial shape, sulcus spermaticus split site, sulcus spermaticus orientation, lateral projections of the margins of sulcus spermaticus, ornamentation on the base, body, lobes and apex of the hemipenis, and number of flounces.
We adopted here the General Lineage Concept of Species [75], considering species as unique evolving metapopulations lineages. We search for concordance between the topology of preferred molecular hypothesis retrieved and phenotype evidences from discrete and continuous characters, since some features such as colour patterns, morphometrics and hemipenial morphology are likely uncorrelated with each other. The correspondence among these data sources might represent independent evidence for robust species boundaries. Therefore, we consider presence of one or more exclusive diagnostic character, which distinguishes a putative taxon from the others in the Boa constrictor Clade, as species delimitation criteria.
Nomenclatural acts.
The electronic edition of this article conforms to the requirements of the amended International Code of Zoological Nomenclature, and hence the new names contained herein are available under that Code from the electronic edition of this article. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix “http://zoobank.org/”. The LSID for this publication is: urn:lsid:zoobank.org:pub:4FEE3F5C-9213-470D-9877-79AB8FF8D4D0. The electronic edition of this work was published in a journal with an ISSN, and has been archived and is available from the following digital repositories: LOCKSS.
Results
Molecular analyses
As the main aim of this study was to investigate the boas distributed along to the Atlantic Forest, the cyt-b matrix constructed herein has a reduced number of representatives from Mexico and Central America, although we included B. imperator imperator, B. i. longicauda, B. i. saboggae, and B. i. ortonii in our analyses (Tables 1 and 2). The topologies of cyt-b and the four-genes matrices were not completely concordant, although the same groups were recovered, and therefore the relationships between groupings will not be approached here.
Boa was recovered as a monophyletic group with high support values in both analyses with cyt-b sequences only (bootstrap = 100%) (S1 Fig) and the concatenated matrix with the four genes (bootstrap = 100%) (Fig 2). The evolutionary history in the latter analysis was inferred by using only individuals from South America, in which B. occidentalis, in blue, (bootstrap = 100%) was recovered as the sister group to the other individuals, although the support is < 70% (52%). Boa atlantica sp. nov. (Fig 2 - in green) was recovered with a high support (95%) with two subclades: one composed of representatives from Northeastern Brazilian States (Alagoas—AL, Bahia—BA, and Rio Grande do Norte—RN) (70%), and the other one composed of individuals from Southeastern States (Rio de Janeiro—RJ, and Espírito Santo—ES) (99%). B. c. constrictor was not recovered as a monophyletic group (orange): individuals from the same Brazilian States (Pará and Rondônia) were recovered in two different groups—one recovered with 88%, and the other one was recovered as the sister to B. c. amarali with a very low support (<70%). A group encompassing B. c. amarali was recovered with a moderate support (74%) (in red).
The matrix is composed of 39 samples from South America, being 35 samples with the four concatenated markers (cyt-b, ND4, NTF3, and ODC resulting in 2305 positions in the final dataset) and the outgroup (Charina bottae, Corallus hortulana, Epicrates cenchria, and Eunectes murinus) with cytb only). The percentage of trees in which the associated taxa clustered together is shown above the branches (bootstrap). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Group colours: Black: Outgroup; blue: B. occidentalis; green: B. atlantica sp. nov.; orange: B. constrictor and red: B. amarali. Photographs: A) B. c. amarali, no locality; B. c. constrictor, no locality, Brazil; C) B. c. constrictor, from Cuiabá, Mato Grosso, Brazil; B. atlantica sp. nov., from Rio de Janeiro, Brazil; B. occidentalis from Tucumán, Argentina.
The analysis using cyt-b recovered six main lineages based on the dataset used, and weak support values defined the relationships among them (bootstrap < 50%): B. imperator (S1 Fig—in grey) with support of 74%; B. occidentalis (blue) with 96%; one group (52%) composed of B. c. constrictor (orange) from Peru, Equador, Guyana, Suriname, Venezuela, and Brazil (Pará –PA, and Rondônia—RO states– 70%), which is the sister group (54%) to B. c. constrictor + B. c. amarali (in orange) from different Brazilian States and biomes; B. atlantica sp. nov. (green) was recovered with bootstrap of 94%; and B. orophias and B. nebulosa (pink) were recovered as closely related in a clade with support of 77%. It is worth highlighting that due to the availability of sequences in each matrix, the groups composition was not the same in the analyses with the four concatenated markers.
Genetic distances showed the main supported lineages with distances of 3 and 4% (see S3 Fig): B. atlantica sp. nov. diverged in 3 or 4% of B. c. amarali, B. c. constrictor (from different localities and phytophysiognomies), B. occidentalis, and B. nebulosa; 4 or 5% of B. orophias; and 6 to 9% of B. imperator (including the subspecies B. i. imperator, B. i. ortonii, B. i. sabogae, and B. i. longicauda). The same occurred with the other lineages, except B. c. amarali and B. c. constrictor in which the distances ranged from 0 to 3%.
Taxonomy
Boa atlantica sp. nov.
Gonzalez, Lima, Passos & Silva urn:lsid:zoobank.org:act:242E539F-CF4C-4C0B-A5E1-D4E143BE82A5.
Constrictor constrictor constrictor–Ihering, 1911 [63] (part.); Amaral, 1930 [64] (part.); Stull, 1932 [65] (part.); Stull, 1935 [66] (part.);
Boa constrictor constrictor–Forcart, 1951 [27] (part.); Stimson, 1969 [67] (part.); Peters & Orejas-Miranda, 1970 [68] (part.);
Constrictor constrictor constrictor–Amaral, 1977 [69] (part.);
Boa constrictor–Henderson et al., 1995 [6] (part.);
Boa constrictor constrictor–McDiarmid et al., 1999 [25] (part.);
Boa constrictor–Marques et al., 2001 [70]; Argôlo, 2004 [71]; Tipton, 2005 (part.) [72];
Boa constrictor constrictor–Bonny, 2007 (part.) [3];
Boa constrictor–Pontes & Rocha, 2008 (part.) [73]; Hynkovà et al. 2009 [30] (part.); Reynolds et al., 2014 [35] (part.); Wallach et al., 2014 [74] (part.); Card et al., 2016 [11] (part.);
Boa constrictor constrictor–Reynolds & Henderson, 2018 [34] (part.);
Boa constrictor–Nogueira et al., 2019 [9] (part.).
Holotype.
Brazil: Rio de Janeiro, Fundação Osório, Rio Comprido, Rua Paula Ramos, 52 (22°56’03.0"S 43°12’36.9"W, datum WGS84; 93 m above sea level, hereafter asl), MNRJ 27242, adult male, collected by Sergeant Marco Aurélio da Silva on 13 September 2019. The holotype was collected on a tree, while copulating with the paratype MNRJ 27243.
Paratypes (n = 47).
All from Brazil: Alagoas State: Passo do Camaragibe (9°16’28.5"S, 35°28’04.8"W), 44 m asl, MNRJ 3940, female, collected by H. Silva at Passo on 18 January 1988; Bahia State: Ilhéus, CEPEC-CEPLAC (14°45’21.6"S, 39°13’53.4"W), 58 m asl, CZGB 4862, female, collected by G.A. Costa on 10 July 1996; Salobrinho, Ilhéus (14°47’S, 39°10’W), 29 m asl, MNRJ 6362, male, collected by S. Rangel in September 1987; Ituaçú (13°48’S, 41°18’W), 539.95 m asl, MNRJ 6361, female, collected by U. Caramaschi & H. Niemeyer on 07 August 1997; Espírito Santo state: Cachoeiro do Itapemerim (20°51’00.4"S, 41°06’42.9"W), 35 m asl, IBSP 79063, female, collector unknown, collected on 10 January 2011; Setiba, Guarapari (20°37’S, 40°26’W), 20 m asl, MNRJ 23361, female, collected by T.S. Soares, date of collection unknown and MNRJ 24903, male, collected by C.F.D. Rocha on 15 November 1999; Reserva Biológica de Comboios, Linhares (19°33’S, 40°03’W), 13 m asl, MNRJ 23879, male, collected by A.P. Almeida on 31 August 2007; São Mateus, Campus CEUNES/UFES (18°40’S, 39°51’W), 8 m asl, MNRJ 23882, male, collected by R.S. Bérnils on 15 March 2011; Vitória, Morro da Gamela (20°17’50.1"S, 40°18’05.5"W), 17 m asl, MNRJ 9565, male, collected by J.L. Gasparini, & F. Campagnolli on 14 January 2002; Rio de Janeiro state: Cabo Frio (22°50’S, 41°59’W), 6 m asl, MNRJ 22936, female, collected by R.R. Pinto et al on 03 May 2012; Carapebus, Parque Nacional da Restinga de Jurubatiba (22°15’S, 41°39’W), 8 m asl, MNRJ 26802, male, collected by D.S. Fernandes et al. on the 8 March 2018; Guapimirim (22°34’S, 43°0’W) 23 m asl, MNRJ 14238, female, collector unknown, collected in May 2001; Guapimirim (22°34’S, 43°0’W) 23 m asl, MNRJ 14250, female, collector unknown, collected in May 2001; Iguaba Grande (22°50’S, 42°10’W), 37 m asl, MNRJ 17353, female, date of collection and collector unknown; Itaboraí, Complexo Petroquímico do Rio de Janeiro (COMPERJ) (22°39’S, 42°51’W), 21 m asl, MNRJ 25057, female, collected by J. Creusen on 03 June 2013 and MNRJ 26324, male, collected on 28 July 2016; Itaboraí (22°39’S, 42°51’W), 134 m asl, MNRJ 25413, female, date of collection and collector unknown; Maricá (22°55’S, 42°51’W), 12 m asl, MNRJ 13111, female, collected by C.L. Prata on 12 May 2005; Itaipu, Niterói (22°57’S, 43°02’W), 7 m asl, MNRJ 11205, female, collected by F. Vieira, J.V. Camargo, & M.A. Gonçalves in May 2004; Pendotiba, Niterói (22°54’S, 43°04’W), 111 m asl, MNRJ 23573, female, collected by M.S.C. Mesquita on 19 January 2013; Niterói (22°57’S, 43°02’W), 2 m asl, MNRJ 16922, female, collected on 17 July 2008, by R.W. Kisling; Nova Iguaçu (22°42’S, 43°28’W), 34 m asl, MNRJ 24860, male, collected by A. Antunes on 13 June 2013; and MNRJ 26213, female, collector unknown, collected in 2014; Porciúncula, Fazenda Vargem Alegre (20°58’S, 42°02’W), 231 m asl, MNRJ 14172, female, collected by B. Pimenta on 08 March 2006; Rio das Ostras (22°30’S, 41°56’W), 31 m asl, MNRJ 10117, female, collected by D.S. Fernandes et al. on 17 November 2003; Rio de Janeiro, Aeroporto Internacional Tom Jobim (22°48’S, 43°15’W), 7 m asl, MNRJ 25952, female, collected by J.T. Baldine in November 2015 and MNRJ 26350, female, collector unknown, collected on 9 May 2016; Água Santa (22°54’19.0"S, 43°18’26.1"W), 221 m asl, MNRJ 25950, female, collected by D.S. Fernandes, B. Miranda, & P. Pinna 09 December 2015; Bairro Jardim Botânico, Horto Grotão (22°57’S, 43°14’W), 650 m asl, MNRJ 19740, male, collected by L. Caetano on 13 July 2010; Cosme velho (22°56’S, 43°11’W), 18 m asl, MNRJ 19412, male, collected by J.P. Pombal on 05 April 2010 and MNRJ 19564, male, collected on 18 May 2010; Del Castilho (22°52’S 43°16’W), 22 m asl, MNRJ 25953, female, collected by R. Baptista on 30 January 2016; Estrada do Rio Morto (23°00’S, 43°29’W), 3 m asl, MNRJ 23144, female, by R.L. Santos, date of collection unknown; Estrada dos Mananciais (22°55’S, 43°22’W), 21 m asl, MNRJ 26589, female, collected by D. B. Santos on 21 April 2017; Ilha do Governador (14°47’52.6"S, 39°10’35.3"W), 15 m asl, MNRJ 9449, female, collector unknown, collected on 21 March 2001 and MNRJ 26585, female, collected by A. Carneiro on 6 June 2017; Parque Nacional da Tijuca (22°56’S, 43°17’W), 360 m asl, MNRJ 26886, female, collected by C. Bueno on 13 March 2018 and MNRJ 27262, female, same collector, collected on 29 February 2019; Recreio dos Bandeirantes (23°01’S, 43°28’W), 14 m asl, MNRJ 14200, female, collected on by J.R. Gomes 27 May 2006 and MNRJ 14201, female, same collector, collected on 13 May 2006; Serra do Mendanha (22°50’S, 43°29’W), 190 m asl, MNRJ 17547, female, collected by J.A.L. Pontes, date of collection unknown; Rio de Janeiro (22°57’S, 43°18’W), 10 m asl, MNRJ 10092, male, collected by M. Mocelin, date of collection unknown and MNRJ 26796, male, collector unknown, collected on 22 August 2017; São Francisco de Itabapoana (21°14’03.0"S, 41°07’19.0"W), 4 m asl, MBML 2097, male, collected by G.L. Forreque on 10 October 2006; Teresópolis, road BR-116 km 86.5 (22°24’S, 42°58’W), 972 m asl, MNRJ 20700, female, collector unknown, collected on 25 July 2011; Fundação Osório, Rio Comprido, Rua Paula Ramos, 52 (22°56’03.0"S 43°12’36.9"W, WGS84), 93 m asl, MNRJ 27243, adult female, collected by Sgt. Marco Aurélio da Silva on 13 September 2019 [copulating with the holotype MNRJ 27242].
Diagnosis. Boa atlantica sp. nov.
can be distinguished from the other congeners by the following unique combination of characters: (i) ventrals 228–243; (ii) subcaudals 47–58 in males, and 31–56 in females; (iii) anterior dorsal scale rows 51–66; (iv) midbody dorsal scale rows 69–90; (v) posterior dorsal scale rows 42–54; (vi) dorsal body spots 17–23; (vii) tail spots 4–6 in males, 2–6 in females; (viii) longitudinal head stripe usually continuous; (ix) head stripe without lateral projections; (x) elliptical, circular or double-oval dorsal interspots; (xi) posterior dorsal interspots not blotched; (xii) no change in dorsal spots towards the tail; (xiii) lateral ocelli dark brown, black or faint reddish, white bordered; (xiv) belly cream with tones of orange, brown and black, scattered of black dots and large groups of black spots; (xv) belly with progressive darkening towards the tail; (xvi) black spots on ventral surface of tail.
Etymology.
The species epithet atlantica is a Latin adjective that refers to the Atlantic coast but mainly the Atlantic Forest ecoregion, the homeland of several endemic species, including this new Boa. The preservation of this biome is crucial for conservation, nonetheless, it has been suffering deforestation since the colonial times and only 12% of it remains standing. This situation is under serious threat since the past Brazilian policies lack empathy for conservation issues and seem to foster deforestation even further.
Description of the holotype.
MNRJ 27242 (Figs 3 and 4), adult male, SVL 2016 mm, TL 294 mm, head width 27.5 mm, head length 77.9 mm, head height 27.5 mm, distance between eyes 22.9 mm, eye-rostral distance 26.3 mm, eye-mouth distance 8.2 mm, distance between nostrils 12.3 mm, cloacal spur length 7.3/6.8 mm, eye height 6.2 mm, eye length 6.5 mm, scales over the preocular stripe 9/7, circumorbitals 17/15, suboculars 1/2, supralabials 22/21, infralabials 26/26, scales between nostrils 6, intrasupraoculars 17, gulars 18/17, dorsal scale rows 64/90/50, tail dorsal scale rows 24, preventrals 2, ventrals 245, subcaudals 57. Dorsum of head light brown light brown with discrete dark grey speckles; longitudinal head stripe brown, bordered by dark brown and black, extending from internasal region, breaking in occipital region, and continued up to cervical region; lateral head surface light brown; preocular stripe faded brown; and subocular stripe brown marginally reaching supralabials; postocular stripe dark brown, connecting with first dorsal saddle; some supralabials with dark brown dots; head ventral surface cream, with grey and salmon speckles and black dots; black dots unite forming two larger pairs of infralabial spots, and another three pairs of gular spots; dorsal background light brown progressively darkens towards tail; saddle-shaped dorsal spots, 22, laterally connected to each other, delimiting oval spots, dark brown in 2/3 of body, closer to each other and brownish-red before tail; body, lateral surface 2/3 of body greyish cream with salmon speckles and dark brown ocelli, encircling creamish white spots; last body third cream, with black speckles and irregular black ocelli encircling brick-red spots; ventral body surface cream, with black speckles and larger black blotches united on the sides, almost in alternate way; salmon tones in the midline of belly; dorsal background of tail yellow with five brick-red spots, bordered by black; first three spots with a pair of yellowish ocelli; ventral surface of tail cream, with alternate black spots among lateral sides of subcaudals not contacting each other.
Dorsal (A), ventral (B), and lateral (C) views of the head of the holotype of Boa atlantica sp. nov. (MNRJ 27242) from Rio de Janeiro, Atlantic coast of Brazil.
Dorsal (A) and ventral (B) views of the holotype of Boa atlantica sp. nov. (MNRJ 27242) from Rio de Janeiro, Atlantic coast of Brazil.
Hemipenis of the holotype: fully everted and maximally expanded hemipenis renders a bilobed, non-capitate, and non-calyculated organ; lobes relatively short and sub-cylindrical with rounded apices, similar size and oriented centrifugally; lobes covered by 6 transversal flounces on its basal portion; lobes naked from median to apical region; sulcus spermaticus divides on distal portion of organ; sulcus spermaticus branches centrifugally oriented running to tip of lobes; margins of sulcus spermaticus bordered by flounces on basal to most of distal portion of lobes; sulcus spermaticus expanded at apices of lobes; hemipenial body subcylindrical; distal region of hemipenial body defined by transversal series of 4 transversal flounces connected to the sulcus spermaticus; proximal region of hemipenis naked (Fig 5).
Sulcate (A) and asulcate (B) sides of hemipenis of the holotype of Boa atlantica sp. nov. (MNRJ 27242) from Rio de Janeiro, Atlantic coast of Brazil.
Variation.
We refer to Tables 3 and S1 for the synthesis of quantitative variation of Boa atlantica. Dorsal ground colour from light to pinkish brown; flanks on the first two thirds of body lighter than dorsum, usually with grey tones; flanks darker on last third of body, usually with tones of blackish brown; longitudinal head stripe darker than background colouration, usually with brown; head stripe usually continuous, with a brown blotch of the same colour as the body; longitudinal head stripe without lateral projections, from internasal region, usually extending to occipital region; preocular and subocular pigmented with tiny brown dots; last two stripes lighter than postocular or with same colour; postocular stripe extends to quadrate-mandibular articulation or connects to first dorsal saddle; usually no gular blotch; dorsal spots 17–23, elliptical, circular or double-oval, not blotched; dorsal spots (13–28 scales long, 8–17 scales wide) light brown to pinkish brown, bordered by brown; posterior dorsal spots do not change in colour or form; saddles dark brown or black (4–13 scales long), bordered by light brown to pinkish brown, usually connected to each other; dorsal saddles usually with brown on last body third; lateral ocelli from dark red, brownish orange to blackish brown, bordered by cream; belly cream with pinkish tones and black blotches; ventral black blotches progressively increase in number and size towards last body third (= posterior ventral darkening); dorsal tail colour light brown, with 3–6 dorsal brown or black spots, without tail interspots; ventral surface of tail cream with spots generally uniformly black or light brown, bordered by black; cloacal blotch, if present, brown or black.
Sexual secondary dimorphism.
Despite the size of the lateral cloacal spurs, which is larger in males than in females, we found evidence of sexual dimorphism in Boa atlantica sp. nov., as confirmed by the MANOVA (F = 1038; p<0.03). The variables in which we found sexual differences were: number of subcaudal rows (F1,28 = 6.49; p<0.02), number of tail spots (F1,28 = 6.19; p<0.02), eye-mouth distance (F1,28 = 4.88; p<0.04), head width (F1,2 = 4.24; p<0.05). Comparing the central tendency measures and 95% confidence intervals (Table 4), females have broader heads and have larger eye-mouth distance than males, and males have more subcaudals and more tail spots than females. The largest male is from São Fidelis, state of Rio de Janeiro (IBSP 4620) 2114 mm SVL, 290 mm TL; largest female from Floresta da Tijuca, Rio de Janeiro, state of Rio de Janeiro (MNRJ 26886) 1.808 mm SVL, 245 mm TL.
Comparison with South American mainland congeners.
Boa atlantica sp. nov. differs from B. constrictor amarali (in parenthesis) by having belly cream with tones of orange, brown and black, scattered of black dots and large groups of black spots (vs. heavily pigmented with black and brown); posterior dorsal spots not blotched (vs. blotched); and tail interspots absent (vs. fuzzy) (Fig 6). Boa atlantica sp. nov. differs from B. c. constrictor (in parenthesis) by having posterior dorsal saddle spots shape similar to the anterior spots (vs. last dorsal saddles comprising large red polygons different from the anterior in B. c. constrictor); last lateral ocelli dark brown, black or dark red (vs. blood-red in B. c. constrictor) (Fig 6); tail spots black (vs. blood-red in B. c. constrictor) (Fig 6). Boa atlantica sp. nov. differs from B. nebulosa (in parenthesis) by having 228–243 ventrals (vs. 256–269 in B. nebulosa), 69–90 midbody dorsal scale rows (vs. 59–69 in B. nebulosa), subocular stripe present (vs. absent in B. nebulosa), posterior dorsal spots and saddles do not change shape (vs. posterior saddles fuse with lateral ocelli forming brown bands in B. nebulosa), and belly with shades of brown and black with and randomly distributed black dots, and larger spots concentrated on the paraventral region (vs. belly heavily pigmented with black, brown dots and shades in B. nebulosa). Boa atlantica sp. nov. differs from B. orophias (in parenthesis) by having 228–243 ventrals (vs. 262–280 in B. orophias), 44–59 subcaudals (vs. 63–69 in B. orophias), 17–23 dorsal spots (vs. 25–30 in B. orophias), 3–6 tail spots (vs. 6–9 in B. orophias), longitudinal head stripe usually continuous with regular borders and no lateral projections (vs. longitudinal head stripe usually fragmented, with carved borders and none, two or multiple lateral projections in Boa orophias). Boa atlantica sp. nov. differs from B. c. occidentalis (in parenthesis) by having 17–23 dorsal spots (vs. 23–29 in B. c. occidentalis); general colour light to dark brown (vs. dark brown in B. c. occidentalis); longitudinal head stripe with no lateral projections (vs. two or more projections in B. c. occidentalis); lateral ocelli dark brown, black or faint reddish (vs. cream in B. c. occidentalis); belly cream with tones of orange, brown and black, scattered of black dots and large groups of black spots (vs. heavily variegated with brown, yellow, black and white blotches in B. c. occidentalis); belly progressively darker towards tail (vs. no changes in belly pattern in B. c. occidentalis); Tail spots black (vs. cream in B. c. occidentalis) (Fig 6). Additionally, B. occidentalis was always recovered as monophyletic on the molecular analyses, although grouped either as the sister group to the South American representatives or as the sister group to the Mexico + Central America Clade, depending on the markers and the dataset used. We refer to S1–S4 Tables for the meristic and morphometric data on B. atlantica, B. occidentalis, B. orophias and B. nebulosa (respectively).
Pre-cloacal region and tails of mainland South-American boas. B. atlantica sp. nov. (MNRJ 27243): a) superior view, b) lateral view; B. constrictor (USNM 566533): c) superior view, d) lateral view; B. amarali (UFG 134): e) superior view, f) lateral view; B. occidentalis (FML28405): g) superior view, h) lateral view.
Hemipenial morphology of the sympatric congeners.
The hemipenes of the sympatric Boas are similar in several aspects: organ bilobed, non-capitate, and non-calyculate; lobes relatively short and sub-cylindrical with rounded apices, similar in size and oriented centrifugally; sulcus spermaticus divides on distal portion of hemipenial body below sulk bifurcation; sulcus spermaticus branches centrifugally oriented running to tip of lobes; margins of sulcus spermaticus bordered by flounces on basal to most of distal portion of lobes; sulcus spermaticus expanded at apices of lobes; hemipenial body subcylindrical; proximal region of hemipenis naked.
Nevertheless, the hemipenes of Boa atlantica sp. nov. (Fig 5) differ from those of B. c. constrictor and B. c. amarali (in parentheses) by having lobes bifurcated at about 70–74% of the total length (vs. at 54–79% in B. c. constrictor and 65–76% in B. c. amarali), lobes covered by 4–6 transversal flounces on its basal portion (vs. 6–8 flounces in B. c. amarali), lobes naked from median to apical region (vs. with shallow flounces in B. c. constrictor and B. c. amarali); distal region of hemipenial body with 5–7 transversal flounces connected to the sulcus spermaticus (vs. 4–6 in B. c. constrictor and B. c. amarali).
Distribution.
Boa atlantica sp. nov. is found along the coastal Atlantic Forest along eastern Brazil from Caicó (6°27’23.2"S 37°06’05.8"W; Fig 7 and S5 Table, point 1) in Rio Grande do Norte State to Ilha Grande (23°08’48.4"S, 44°13’40.3"W; Fig 7 and S5 Table, point 156) in Rio de Janeiro State, which is also de westernmost point in the southern distribution. The westernmost point in the northern distribution is Ituaçú (13°48’26.7"S 41°18’39.5"W; Fig 7 and S5 Table point 26) in Bahia State.
Distribution of Boa atlantica sp. nov. based on the examined vouchers and tissue samples. A) Detailment in Rio de Janeiro City, including type locality. B) records in northern Rio de Janeiro and Espírito Santo States, C) records in Rio de Janeiro State. See also S4 Table.
In this heterogeneous environment, B. atlantica sp. nov. is found from the sea level up to 906 m a.s.l. (Fig 7).
Discussion
Phylogeny and systematics of the genus Boa
The genus Boa has been rather taxonomically stable since its original description in 1758 [3,28,29]. Otherwise, because there was no study focused on the taxonomy for the entire genus, at least through the application of rigorous (statistical or phylogenetic) methodology, several lineages have been traditionally recognized as subspecies [5,25,29,74]. Bonny [3] presented a review of the names in the genus, even though his study does not present a replicable methodology, examination of available type material, nor is based on large number of specimens to allow statistical confidence. The renewed systematic interest in the genus launched with the study of Hynkovà et al. [30]. Since then, several studies have been performed with molecular data, in order to understand the phylogenetic relationships within the genus Boa [11,12,31,32].
Despite the rearrangements proposed in previous studies, Reynolds & Henderson [32] published a checklist of the Family Boidae, in which they recognized five species for the genus, as such: (i) Boa constrictor (with four subspecies; B. c. constrictor, B. c. longicauda, B. c. occidentalis and B. c. ortonii), (ii) Boa imperator (with two subspecies; B. i. imperator and B. i. sabogae), (iii) B. nebulosa, (iv) B. orophias and (v) B. sigma. In this framework, only one species corresponds to the South American cis-Andean taxa: Boa constrictor, even though two of its subspecies do not belong to the “B. constrictor Clade” (sensu Hynkovà et al. [30]) nor they are cis-Andean (e.g., the trans-Andean B. c. longicauda and B. c. ortonii—here considered as B. i. longicauda and B. i. ortonii).
Actually, the species delimitation into the entire genus, mainly along the cis-Andean populations (= Boa constrictor Clade sensu Hynkovà et al. [30]), has never flourished due for a series of reasons taken alone or in combination, as such: (i) large animals with many samples available in disparate and distant scientific collections allied to taxa with wide geographic distribution, implying a great logistic investment and personal commitment for the examination of representative samples; (ii) recently diverged taxa, usually presenting similar external morphology, at least under first inspection, without a more detailed approach establishing geographical boundaries for each taxa; (iii) very scarce or limited samples (morphological or molecular) for several taxa with very restricted distribution like islands (e.g., B. nebulosa, B. orophias, B. i. sabogae, and B. sigma) or remote trans-Andean regions (e.g., B. i. longicaudata and B. i. ortonii); (iv) most species and subspecies are listed as CITES [51], consequently there are difficulties for new collections and loaning the available material; (v) superficial analyses and/or disregarding colour pattern, meristic and morphometric characters as a valid source of taxonomic evidence; (vi) reduced genetic divergence among some taxa and several short branches along the phylogenetic structure along the genus; and (vii) difficulty in amplifying some genes for new samples using primers available in the literature.
Molecular phylogenies obtained herein always recovered Boa c. occidentalis and Boa atlantica sp. nov. with high supports, independently on the markers and the dataset used. B. nebulosa and B. orophias also were recovered in a clade with relatively high support. Our decision in describe Boa atlantica sp. nov. in the specific category is broadly founded in conceptual framework (e.g., [75]). For instance, the use of subspecific rank within a historical context of phylogenetic inference is severely restricted, demanding the same kind of evidence (i.e., unambiguous diagnostic features) needed to recognize a species [76]. In addition, as recently pointed out by Burbrink and colleagues, ontologically, the rank of subspecies is either identical to that of species or undefined terminal in the context of evolutionary lineages representing spa-tiotemporally defined individuals [77]. In following such ideas, we realized that Boa c. occidentalis also displaying robust morphological diagnosability in combination with solid molecular support and divergence (sensu Vences et al., [78]. Genetic distances of 3%, 4% and more are robust supports for diagnosis of species in snakes (Figs 2 and S3). For instance, Boa c. occidentalis has always been retrived with high support values in a basal position within the Boa constrictor Clade [30,35,79], and presents several diagnostic features regarding its congeners [3,80]. Therefore, in order to maintain the reciprocal monophyly between the previously recognized taxa (Fig 2), we propose here the elevation of Boa occidentalis to full specific rank. On the other hand, a comprehensive phylogeography study is required in order to make a robust taxonomic decision about the validity (or not) of remained subspecies of the Boa constrictor Clade (i.e., B. c. amarali and B. c. melanogaster) and we refrain here to take any hasty decision in this respect.
The new boa from the Atlantic Forest
Boa atlantica sp. nov. occurs in the most populous area in Brazil, where the Portuguese colonization began in the XVI Century through an occupancy plan called ‘Capitanias Hereditárias’, which gave rise—with many boundary shifts across time—to the current political division of the country. The herpetofauna is well-known along the Brazilian coast, at least if compared to most inland areas, partially because this region concentrates the largest capitals of the country, including most of the research centres, scientists and natural history collections. On other hand, it is remarkable that early naturalist travelling to Brazil (e.g., [81]) or even nowadays (e.g., [73]), reported on such coastal population of boas, without noting its morphological distinction with respect to Amazon (i.e., B. c. constrictor) or Cerrado (i.e., B. c. amarali) populations.
Nevertheless, as stated before, there has never been a comprehensive taxonomic review of the genus to establish specific boundaries accurately, mainly considering cis-Andean taxa. In addition, several studies did not mention explicitly the presence of the genus Boa in the Atlantic Forest [68,69,72,82]. By contrast, the few mentions of boas in the Atlantic Forest regard it as Boa constrictor without consistent application of trinomial nomenclature comprising subspecific ranks [3,6,9,70,71,73,74,83–85].
Boa atlantica sp. nov. is very common in its distribution range, being found in lowland primary and secondary rainforests [71,73], and even in large and populous cities with very anthropized environment, such as Rio de Janeiro (see Figs 7 and S2 File). Boa atlantica sp. nov. may occur in sympatry with nominal species B. c. constrictor in its northernmost area of distribution in Passo do Camaragibe, state of Alagoas, Brazil, since the area is too close to the Caatinga. This can be explained considering the Brazilian Atlantic Forest has once been enormous, occupying a vast territory especially in the Atlantic coast [86–89]. Since the discovery and colonization of Brazil, this biome has been widely destroyed (due to farming, large cities, wood-market, and so on), with less than 12% of the forest currently remaining [87–90].
This situation is more overwhelming in the northeastern region of Brazil, where the remaining forest is patched or transformed into monocultures or pastures [86–89]. The destruction of the forest has had a rough and direct impact on the fauna distribution, since it is dependent on the local resources [91]. Likewise, the forest fragmentation and advancement of the Caatinga and Cerrado, respectively, into Northeast and Southeast Brazilian regions might explain the areas where B. atlantica sp. nov. has contact with B. c. amarali (Espírito Santo and possibly western Bahia States), and B. c. constrictor (Alagoas and western Bahia State, Brazil). The southernmost record is for Ilha Grande (Rio de Janeiro State, Brazil). In this case, there is a large gap between the records of B. c. amarali from São Paulo City and Boa atlantica sp. nov. in southern Rio de Janeiro State, since B. c. amarali does not occur in the coast of the state of São Paulo, Brazil.
The present study formally describes a new species from a population that has been known by scientists in the past 200 years. In a certain way, we can assume that Boa atlantica sp. nov. has been widely ignored by majority of taxonomist, since it has always been regarded as distinct from subspecies Boa c. constrictor or B. c. amarali, being usually referred only to as Boa constrictor without a consistent trinomial usage. Here we reinforce the importance of paying attention to the most common species, which, if not studied, may hide cryptic diversity. Just like our example here, Feinberg et al. [92] described a new species of Rana (R. kauffeldi) inside New York City. Although such discoveries may be unexpected in densely populated urban parts of the world, detailed comparative studies demonstrated that new species can still be found periodically even in well-studied places rarely associated with undocumented biodiversity [92]. We also stress the importance of protecting such species, since it is endemic to the Brazilian Coastal Atlantic Forest, a largely impacted and threatened ecoregion. Therefore, this new species was already threatened by habitat loss even and other threats even before it was formally described by science.
Is there cryptic diversity in the genus Boa?
Currently, cryptic species could represent a substantial fraction of biodiversity and, consequently, such phenomena are calling attention and being discovered at a speeding pace [92,93]. Nevertheless, it is known that the diversity of cryptic species is still underestimated [94] or even misunderstood [95]. For instance, at first the case of Boa spp. seems to fit well to general processes associated with concentration of cryptic diversity, such as: recent divergence in combination with a certain level of morphological stasis. Notwithstanding, many of currently recognized species present apparently fixed diagnostic features mostly based on external morphology (e.g., colour tones and patterns). As a rule, such character systems have been disregarded if compared to other sources of phenotypic characters (e.g., male geniatlia and osteological features) in several groups of snakes (see [96]). However, for all other extant boid the colour patterns have proven to hold interesting phylogenetic signals [97–100]. By following definitions of cryptic species [95], we believe that most taxa currently recognized as full species along the Boa constrictor Clade (i.e., Boa atlantica sp. nov., Boa nebulosa, and Boa orophias) are not cryptic at all, since, even if tenuous, they present unambiguous morphological diagnosis from each other congener, including the nominal form. In fact, our results suggest that a plethora of phenotypic data examined here are broadly congruent with the molecular evidence, not the contrary, in an integrative taxonomy approach, despite recent diversification revealed by short branches recovered within the group. Therefore, we highlight the importance of studying several sources of phenotypic evidence, even if there is a suggestion of high levels of polymorphism. However, as pointed out by Lee & Palci [101] if morphology is to be employed to its full potential, biologists need to start scrutinising phenotypes in a more objective fashion, models of phenotypic evolution need to be improved, and approaches for analysing phenotypic traits together with genomic data need to be refined.
Supporting information
S1 Fig. Phylogenetic tree inferred by using Maximum Likelihood on CIPRES (GTR+IO+G model), based on 744 partial sequences of cyt-b.
The matrix is composed of 73 samples from Mexico, Central and South America (including the outgroup—Charina bottae, Corallus hortulana, Epicrates cenchria, and Eunectes murinus). The bootstrap value is shown above the branches. Group colours: black: outgroup; blue: B. occidentalis; green: B. atlantica sp. nov.; grey: B. imperator; orange: B. constrictor + B. amarali; pink = B. orophias + B. nebulosa.
https://doi.org/10.1371/journal.pone.0298159.s001
(TIF)
S2 Fig. Phylogenetic trees.
Phylogenetic tree inferred by using Bayesian Inference on CIPRES, based on (A) 73 samples from Mexico, Central and South 744 partial sequences of cyt-b, and (B) the four concatenated markers (cyt-b, ND4, NTF3, and ODC) resulting in 2305 positions in the final dataset. Outgroup is composed of Charina bottae, Corallus hortulana, Epicrates cenchria, and Eunectes murinus with cytb only. Posterior Probabilities are indicated on the branches.
https://doi.org/10.1371/journal.pone.0298159.s002
(ZIP)
S3 Fig. Estimates of evolutionary divergence between sequences based on cyt-b partial mitochondrial gene.
https://doi.org/10.1371/journal.pone.0298159.s003
(TIF)
S1 Table. Meristic and morphometric data of the examined specimens of Boa atlantica sp nov.
https://doi.org/10.1371/journal.pone.0298159.s004
(PDF)
S2 Table. Meristic and morphometric data of the examined specimens of Boa occidentalis.
https://doi.org/10.1371/journal.pone.0298159.s005
(PDF)
S3 Table. Meristic and morphometric data of the examined specimens of Boa orophias.
https://doi.org/10.1371/journal.pone.0298159.s006
(PDF)
S4 Table. Meristic and morphometric data of the examined specimens of Boa nebulosa.
https://doi.org/10.1371/journal.pone.0298159.s007
(PDF)
S5 Table. Pinpoint of vouchers and samples used to compose the distribution map of Boa atlantica sp nov (Fig 6). Holotype is marked in bold.
https://doi.org/10.1371/journal.pone.0298159.s008
(PDF)
S1 File. Polymerase chain reaction (PCR) protocol for four genes amplification.
https://doi.org/10.1371/journal.pone.0298159.s009
(PDF)
Acknowledgments
We thank the following colleagues who allowed access to the specimens under their care, provided lab assistance or sample tissues: D Dickey, D Kizirian, F Burbrink, (AMNH); N Gilmore, T Daeschler, (ANSP); J Sites, (BYU);EJ Ely, L Scheinberg, (CAS); BB Bittar, HLR Silva, (CEPB); E Freire (CHEBZ); A Brandão, (CHIFCE); L Arruda, R Feio, (CHUFV); S Rogers, (CM); C Dardia, (CUMV); A Guzzi, RRS Leite, (CZDP); G Scrocchi, J Carlos, S Kretzschmar, (FML); A Resetar, (FMNH); FC Resende, G Cotta, (FUNED); FG Grazziotin, V Germano, (IBSP); A Silva, F Werneck, V Carvalho, (INPA); B Hamdan, N Citeli, (IVB); L Welton, R Glor, RM Brown, (KU); J Faivovich, S Nenda, (MACN); G Rivas (MBLUZ); HQB Fernandes, (MBML); RB Oliveira, (MCN); LB Nascimento, (MCNR); GF Pontes, (MCP); J Martinez, J Rosado, JB Losos, T Takahashi, (MCZ); J Moura-Leite, (MHNCI); J Cordova, (MHNSM); F Bauer, H Vera, IG Fox, N Martinez, P Cacciali, (MNHNP); MW Cardoso, P Pinna, (MNRJ); ALC Prudente, F Sarmento, (MPEG); CL Spencer, S Horrack, (MVZ); A Braga, H Zaher, (MZUSP); S Kullander, (NMR); O Torres-Carvajal (QCAZ); T Hibbitts, (TCWC); E Braker, (UCM); AJS Argôlo, T Medeiros, VD Orrico, (UESC); E Oliveira, L Frazão, M Menin, (UFAM); DP Coelho, R Lira-da-Silva, (UFBA); N Maciel, R Bastos, (UFG); HC Costa, (UFJF); P Garcia, (UFMG); G Gracioli, (UFMS); FF Curcio, (UFMT); MB Martins, (UFRGS); D Fernandes, (UFRJ); M Messias, (UFRO); HR Silva, (UFRRJ); ARD Rabosky, G Schneider, (UMMZ); A Wynn, CK Sami, EM Langan, G Zug, K de Queiroz, KA Tighe, R McDiarmid, R Wilson, SW Gotte, (USNM); M Rodrigues (USP); E Mejlon, H Mejlon, (UUMZ); Y Sjöholm, (UUMZ); and PR Manzani, (ZUEC). We are also thankful to G Puorto, K Banci, L Kobashi, R Spirandelli da Silva (Instituto Butantan) and VX Silva (UNIFAL) who provided tissues and lab support. To ROL Salles (MNRJ) for helping with the figures and photographs; To T Guedes (ZUEC) for collecting data on the type specimens in deposited in Europe.
References
- 1.
Henderson RW, Powell R. Natural history of West Indian Reptiles and Amphibians. Gainesville: University Press of Florida; 2009.
- 2. Reed RN. An ecological risk assessment of non-native Boas and Pythons as potentially invasive species in the United States. Risk Anal. 2005; 25(3):753–766. pmid:16022706
- 3.
Bonny K. Die Gattung Boa, Taxonomie und Fortpflanzung. Rheinstetten: KUS-Verlag, Germany; 2007.
- 4. Langhammer JK. A new subspecies of Boa constrictor, Boa constrictor melanogaster, from Ecuador (Serpentes: Boidae). Tropical Fish Hobby. 1983; 32(4):70–79.
- 5. Price RM, Russo P. Revisionary comments on the genus Boa with the description of a new subspecies of Boa constrictor from Peru. The Snake. 1991; 23:29–33.
- 6. Henderson RW, Waller T, Micucci P, Puorto G. Ecological correlates and patterns in the distribution of neotropical Boines (Serpentes: Boidae): a preliminary assessment. Herpetol Nat Hist. 1995; 3(1):15–27.
- 7. Burbrink FT. Inferring the phylogenetic position of Boa constrictor among the Boinae. Mol Phylogenet Evol. 2005; 34:167–180. pmid:15579390
- 8. Noonan BP, Chippindale PT. Dispersal and vicariance: the complex evolutionary history of boid snakes. Mol Phylogenet Evol. 2006; 40(2):347–358. pmid:16624591
- 9. Nogueira CC, Argôlo AJS, Arzamendia V, Azevedo JA, Barbo FE, Bérnils RS, et al. Atlas of Brazilian snakes: verified point-locality maps to mitigate the wallacean shortfall in a megadiverse snake fauna. South Am J Herpetol. 2019; 14(sp1):1–274.
- 10. Boback SM. Natural history and conservation of island Boas (Boa constrictor) in Belize. Copeia. 2005; (4):880–885. https://doi.org/10.1643/0045-8511(2005)005[0879:NHACOI]2.0.CO;2.
- 11. Card DC, Schield DR, Adams RH, Corbin AB, Perry BW, Andrew AL, et al. Phylogeographic and population genetic analyses reveal multiple species of Boa and independent origins of insular dwarfism. Mol Phylogenet Evol. 2016; 102:104–116. pmid:27241629
- 12. Card DC, Adams RH, Schield DR, Perry BW, Corbin AB, Pasquesi GIM., et al. Genomic basis of convergent island phenotypes in Boa constrictors. Genome Biol Evol. 2019; 11(11): 3123–3143. pmid:31642474
- 13. Pizzatto L, Marques OAV. Reproductive ecology of Boine snakes with emphasis on Brazilian species and a comparison to Pythons. South Am J Herpetol. 2007; 2(2):107–122.
- 14. Reed RN, Rodda GH. Giant constrictors: biological and management profiles and an establishment risk assessment for nine large species of pythons, anacondas, and the boa constrictor. U.S. Geological Survey Open-File Report. 2009; 2009–1202.
- 15.
Green SEW. Evolutionary Biology and Conservation of the Hog Island Boa constrictor. Ph.D. Thesis, The University of Kent. 2011.
- 16.
Wright MJ. Morphological clinal variation and assessment of subspecific taxonomy in Boa. M.Sc. Thesis, Truman State University. 2012. Available from https://search.proquest.com/docview/220297257?accountid=12834.
- 17. Begotti RA, Filho AM. Fatal attack on an adult Chestnut-fronted Macaw Ara severus by a Boa constrictor in the Brazilian Amazon. Cotinga. 2012; 34(1):172–173.
- 18. Rocha-Santos G, Barbier E, Bordignon MO. Sweet trap: Boa constrictor (Serpentes: Boidae) preying on passerines on Cecropia pachystachya (Urticales: Cecropiaceae) in fruiting period Gilson. Biol Conserv. 2014; 14(2):e20140003.
- 19. Pizzatto L, Marques OAV, Facure K. Food habits of Brazilian boid snakes: overview and new data, with special reference to Corallus hortulanus. Amphibia-Reptilia. 2009; 30(4):533–544.
- 20. Cisneros-Heredia DF, León-Reyes A, Seger S. Boa constrictor Predation on a Titi monkey, Callicebus discolor. Neotrop Primates. 2005; 13(3):11–12.
- 21. Ferrari SF, Pereira WLA, Santos RR, Veiga LM. Fatal attack of a Boa constrictor on a Bearded Saki (Chiropotes satanas utahicki). Folia Primatol. 2004; 75(2):111–113. pmid:15010586
- 22. Sorrell G, Boback S, Reed RN, Green S, Montgomery CE, de Souza LS, et al. Boa Constrictor (Boa constrictor). Foraging. Herpetol Rev. 2011; 42(2):281.
- 23. Teixeira DS, dos Santos E, Leal SG, de Jesus AK, Vargas WP, Dutra I, et al. Fatal attack on black-tufted-ear marmosets (Callithrix penicillata) by a Boa constrictor: a simultaneous assault on two juvenile monkeys. Primates. 2016; 57(1):123–127. pmid:26467338
- 24. Quick JS, Reinert HK, de Cuba ER, Odum RA. Recent occurrence and dietary habits of Boa constrictor on Aruba, Dutch West Indies. J. Herpetol. 2005; 39(2): 304–307.
- 25.
McDiarmid RW, Campbell JA, Touré T. Snakes species of the world: a taxonomic and geographical reference 1. Washington, DC: The Herpetologist’s League; 1999.
- 26. Stejneger L. An annotated list of batrachians and reptiles collected in the vicinity of La Guaira, Venezuela, with descriptions of two new species of snakes. Proc US Natl Mus. 1901; 24:179–192.
- 27. Forcart L. Nomenclature remarks on some generic names of the snake family Boidae. Herpetologica. 1951; 7(4): 197–199.
- 28.
Boos HEA. The snakes of Trindade & Tobago. Texas: Texas A&M University Press; 2001.
- 29.
Savage JM. The Amphibians and Reptiles of Costa Rica. Chicago: University of Chicago Press; 2002.
- 30. Hynkovà I, Starostová Z, Frynta D. Mitochondrial DNA variation reveals recent evolutionary history of main Boa constrictor clades. Zoolog Sci. 2009; 26(9): 623–631. pmid:19799513
- 31. Reynolds RG, Puente-Rolón AR, Reed RN, Revell LJ. Genetic analysis of a novel invasion of Puerto Rico by an exotic constricting snake. Biol Invasions. 2013; 15(5):953–959.
- 32. Suárez-Atilano M, Burbrink F, Vázquez-Domínguez E. Phylogeographical structure within Boa constrictor imperator across the lowlands and mountains of Central America and Mexico. J Biogeogr. 2014; 41(12):2371–2384.
- 33. Moritz C. Defining ‘evolutionarily significant units’ for conservation. Trends Ecol Evol. 1994; 9(10):373–375. pmid:21236896
- 34. Reynolds RG, Henderson RW. Boas of the world (Superfamily Booidae): a checklist with systematic, taxonomic, and conservation assessments. Bull Mus Comp Zool. 2018; 162(1):1–58. https://doi.org/10.3099/MCZ48.1.
- 35. Reynolds RG, Niemiller ML, Revell LJ. Toward a tree-of-life for the boas and pythons: multilocus species-level phylogeny with unprecedented taxon sampling. Mol Phylogenet Evol. 2014; 71(1):201–213. pmid:24315866
- 36.
Roze JA. La Taxonomia y zoogeografia de los ofidios de Venezuela. Caracas: Universidade Central de Venezuela, Ediciones de La Biblioteca; 1966.
- 37. Wolf B, Ronne J. Boas: an essay on current taxonomy. Reptil and Amphib Mag. 1997:24–31.
- 38.
Pinto LP, Bedê L, Paese A, Fonseca M, Paglia A, Lamas I. Mata Atlântica Brasileira: os desafios para a conservação da biodiversidade de um hotspot mundial. In: Rocha CFD, Bergallo HG, Van Sluys M, Alves MAS, editors. Biologia da Conservação: Essências. São Carlos: Rima Editora; 2006. pp. 69–96.
- 39. Rocha CFD, Bergallo HG, Van Sluys M, Alves MAS, Jamel CE. The remnants of restinga habitats in the brazilian Atlantic Forest of Rio de Janeiro state, Brazil: Habitat loss and risk of disappearance. Braz J Biol. 2007; 67(2): 263–273. pmid:17876436
- 40.
Bergallo HG, Fidalgo EC, Rocha CFD, Uzêda MC, Costa MB, Alves MAS, et al. Estratégias e ações para a conservação da biodiversidade no Estado do Rio de Janeiro. 1st ed. Rio de Janeiro: Instituto Biomas; 2009.
- 41. Colombo A, Joly C. Brazilian Atlantic Forest lato sensu: the most ancient Brazilian forest, and a biodiversity hotspot, is highly threatened by climate change. Braz J Biol. 2010; 70(3 suppl): 697–708. pmid:21085776
- 42. Rezende C L., Scarano F R, Assad ED, Joly CA, Metzger JP, Strassburg BBN, et al. From hotspot to hopespot: an opportunity for the Brazilian Atlantic Forest. Perspect Ecol Conserv. 2018; 16(4): 208–214.
- 43. SOS Mata Atlântica; 2021. [cited 2023 Mar 31]. https://www.sosma.org.br/.
- 44. Projeto MapBiomas. Coleção [v 7.0] da série anual de mapas de uso e cobertura da terra do Brasil. 2019 [cited 2023 Mar 31] https://mapbiomas.org/.
- 45. Lewinsohn TM, Prado PI. How many species are there in Brazil? Conserv Biol. 2005; 19(3): 619–624.
- 46.
Mittermeier RA, Turner WR, Larsen FW, Brooks TM, Gascon C. Global biodiversity conservation: the critical role of hotspots. In: Zachos F, Habel J, editors. Biodiversity Hotspots. Berlin, Heidelberg: Springer; 2011. pp. 3–22. https://doi.org/10.1007/978-3-642-20992-5_1
- 47. Myers N, Mittermeier RA, Mittermeier CG, Fonseca GAB, Kent J. Biodiversity hotspots for conservation priorities. Nature. 2000; 403:853–858. pmid:10706275
- 48. Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques. 1991; 10(4): 506–513. pmid:1867860
- 49. Burbrink FT, Lawson R, Slowinski JB. Mitochondrial DNA phylogeography of the polytypic North American rat snake (Elaphe obsoleta): a critique of the subspecies concept. Evolution. 2000; 54(6): 2107–2118.
- 50. Arèvalo E, Davis SK, Sites JW Jr. Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Syst Biol. 1994; 43(3):387–418.
- 51. UNEP-WCMC (Comps.). The Checklist of CITES Species Website; 2023 [cited 2023 Mar 31]. https://checklist.cites.org/.
- 52. Tamura K, Stecher G, Kumar S (2021). MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol Phylogenet Evol. pmid:33892491
- 53. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Phylogenet Evol. 2013; 30(4): 772–780. pmid:23329690
- 54. Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014; 30(9): 1312–1313. pmid:24451623
- 55. Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980; 16:111–120.
- 56. Pesantes OS. A Method for preparing the hemipenis of preserved snakes. J Herpetol. 1994; 28(1):93–95.
- 57. Zaher H, Prudente ALC. Hemipenes of Siphlophis (Serpentes, Xenodontinae) and techniques of hemipenial preparation in snakes: a response to dowling. Herpetol Rev. 2003; 34(4):302–307.
- 58. Uzzell T. A revision of lizards of the genus Prionodactylus, with a new genus for P. leucostictus and notes on the genus Euspondylus (Sauria, Teiidae). Postilla. 1973; 159:1–67.
- 59. Nunes PMS, Fouquet A, Curcio FF, Kok PJR, Rodrigues MT. Cryptic species in Iphisa elegans Gray, 1851 (Squamata: Gymnophthalmidae) revealed by hemipenial morphology and molecular data. Zool J Linn Soc. 2012; 166(2):361–376.
- 60. Dowling HG, Savage JM. A guide to the snake hemipenis: a survey of basic structure and systematic characteristics. Zoologica. 1960; 45:17–28.
- 61.
Underwood G. A systematic analysis of boid snakes. Morphology and Biology of reptiles. In: Bellairs Ad’A, Cox CB. editors. Morphology and Biology of Reptiles. London: Academic Press; 1976. pp. 151–175.
- 62. Branch WR. Hemipenes of the madagascan boas Acrantophis and Sanzinia, with a review of hemipenial morphology in the Boinae. J. Herpetol. 1981; 15:91–99.
- 63. Ihering R. As cobras do Brasil. Primeira parte. Rev Mus Paul. 1911; 8:273–379.
- 64. Amaral A. Estudos sobre ophidios Neotrópicos. Lista remissiva dos Ophidios da região Neotropical. Mem Inst Butantan. 1930; 4:129–271.
- 65. Stull OA. Five new species of the Family Boidae. Occas. pap. Boston Soc. Nat. Hist. 1932; 8: 25–30.
- 66. Stull OG. A checklist of the family Boidae. Proc. Boston Soc. Nat. Hist. 1935; 40: 387–408.
- 67. Stimson AF. Liste der renzenten Amphibien und Reptilien. Boidae (Boinae + Bolyeridae + Loxoceminae + Pythoninae). Das Tierreich. 1969; 89:1–49.
- 68. Peters JA, Orejas-Miranda B. Catalogue of the Neotropical Squamata: Part I. Snakes. Bull Am Mus Nat Hist 1970; 297:1–347.
- 69.
Amaral A. Serpentes do Brasil: iconografia colorida. São Paulo: Editora da Universidade de São Paulo; 1977.
- 70.
Marques OAV, Eterovic A, Sazima I. Serpentes da Mata Atlântica: guia ilustrado para a Serra do Mar. Ribeirão Preto: Holos; 2001.
- 71.
Argôlo AJS. As Serpentes dos Cacauais do Sudeste da Bahia. Ilhéus: Editus; 2004.
- 72.
Tipton BL. Snakes of the Americas: Checklist and Lexicon. Malabar: Krieger; 2005.
- 73.
Pontes JAL, Rocha CFD. Serpentes da Serra do Mendanha, Rio de Janeiro, RJ: ecologia e conservação. Rio de Janeiro: Technical Books Editora; 2008.
- 74.
Wallach V, Williams KL, Boundy J. Snakes of the World: a catalogue of living and extinct species. Boca Raton: CRC Press, Taylor & Francis Gro; 2014. https://doi.org/10.1201/b16901
- 75. De Queiroz K. Species concepts and species delimitation. Syst Biol. 2007; 56(6): 879–886. pmid:18027281
- 76. Frost DR, Kluge AG, Hillis DM. Species in contemporary herpetology: comments on phylogenetic inference and taxonomy. Herpetol Rev. 1992; 23(2): 46–54.
- 77. Burbrink FT, Crother BI, Murray CM, Smith BT, Ruane S, Myers EA, et al. Empirical and philosophical problems with the subspecies rank. Ecol Evol. 2022; 12: e9069. pmid:35845367
- 78. Vences M, Guayasamin JM, Miralles A, De La Riva I. To name or not to name: criteria to promote economy of change in supraspecific Linnean classification schemes. Zootaxa. 2013; 3636(2): 201–244. pmid:26042291
- 79.
Lima LCB. Filogenia e delimitação de espécies no complexo Boa constrictor (Serpentes: Boidae) utilizando marcadores moleculares. Ph.D. thesis. Universidade de São Paulo. 2017.
- 80.
Gonzalez RC. Taxonomic Review of the genus Boa Linnaeus, 1758 (Serpentes:Boidae). Ph.D. thesis. Museu Nacional, Universidade Federal do Rio de Janeiro. 2019.
- 81.
Wied-Neuwied MAP. Reise nach Brasilien in den Jahren 1815 bis 1817. Frankfurt: Heinrich Ludwig Brönner; 1821.
- 82. Cunha OD, Nascimento FP. Ofídios da Amazônia. As cobras da região leste do Pará. Bol Mus Para Emilio Goeldi Cienc Nat, Série Zoologia. 1993; 9(1): 1–191.
- 83. Salles RDOL, Weber LN, Silva-Soares T. Reptiles, Squamata, Parque Natural Municipal da Taquara, municipality of Duque de Caxias, state of Rio de Janeiro, Southeastern Brazil. Check List. 2010; 6(2):280.
- 84. Marques R, Tinôco MS, Couto-Ferreira D, Fazolato CP, Browne-Ribeiro HC, Travassos MLO, et al. Reserva Imbassaí Restinga: inventory of snakes on the northern coast of Bahia, Brazil. J Threat Taxa. 2011; 3(11):2184–2191.
- 85. Garda AA, Costa TB, Santos-Silva CR, Mesquita DO, Faria RG, Conceição BM, et al. Herpetofauna of protected areas in the Caatinga I: Raso da Catarina Ecological Station (Bahia, Brazil). Check List. 2013; 9(2): 405–414.
- 86. Silva JMC, Tabarelli M. Tree species impoverishment and the future flora of the Atlantic forest of northeast Brazil. Nature. 2000; 404(6773):72–74. pmid:10716443
- 87.
Galindo-Leal C, Câmara IG. The Atlantic Forest of South America: biodiversity status, threats, and outlook. Washington: Conservation International, Island Press; 2003.
- 88. Ribeiro MC, Metzger JP, Martensen AC, Ponzoni FJ, Hirota MM. The Brazilian Atlantic Forest: how much is left, and how is the remaining forest distributed? Implications for conservation. Biol Conserv. 2009; 142(6):1141–1153.
- 89.
Ribeiro MC, Martensen AC, Metzger JP, Tabarelli M, Scarano F, Fortin MJ. The Brazilian Atlantic Forest: a shrinking biodiversity hotspot. In: Zachos FE, Habel JC, editors. Biodiversity Hotspots. New York: Springer; 2011. pp. 405–434. https://doi.org/10.1007/978-3-642-20992-5_21
- 90. Tabarelli M, Pinto LP, Silva JMC, Hirota MM, Bedê LC. Desafios e oportunidades para a conservação da biodiversidade na Mata Atlântica brasileira. Megadiversidade. 2005; 1: 132–138.
- 91.
Diniz-Filho JAF, Araújo MB. Macroecologia e mudanças climáticas. In: Carvalho CJB, Almeida EAB, editors. Biogeografia da America do Sul: padrões e processos. São Paulo: Roca; 2013. pp. 151–161.
- 92. Feinberg JA, Newman CE, Watkins-Colwell GJ, Schlesinger MD, Zarate B, Curry BR, et al. Cryptic diversity in metropolis: confirmation of a new Leopard Frog species (Anura: Ranidae) from New York City and surrounding Atlantic coast regions. PLoS One. 2014;9(10): e108213. pmid:25354068
- 93. Funk WC, Caminer M, Ron SR. High levels of cryptic species diversity uncovered in Amazonian frogs. Proc Biol Sci B: Biological Sciences. 2012; 279(1734): 1806–1814. pmid:22130600
- 94. Bickford D, Lohman DJ, Sodhi NS, Ng PKL, Meier R, Winker K, et al. Cryptic species as a window on diversity and conservation. Trends Ecol Evol. 2007; 22(3): 148–155. pmid:17129636
- 95. Struck TH, Feder JL, Bendiksby M, Birkeland S, Cerca J, Gusarov VI., et al. (2018). Finding evolutionary processes hidden in cryptic species. Trends Ecol Evol. 2018; 33(3): 153–163. pmid:29241941
- 96.
Gower DJ, Zaher H. The origin and early evolutionary history of snakes. London: Cambridge University Press, 2022. https://doi.org/10.1017/9781108938891
- 97. Dirksen L, Böhme W. Studies on Anacondas. III. A Reappraisal of Eunectes beniensis Dirksen, 2002, from Bolivia, and a key to the species of the genus Eunectes Wagler, 1830 (Serpentes: Boidae). Russ J Herpetol. 2005; 12(3): 223–229.
- 98. Passos P, Fernandes R. Revision of the Epicrates cenchria complex (Serpentes: Boidae). Herpetological Monographs. 2008; 22(1):1–30.
- 99. Henderson RW, Passos P, Feitosa D. (Geographic variation in the emerald treeboa, Corallus caninus (Squamata: Boidae). Copeia. 2009; 2009(3): 572–582.
- 100. Rivera PC, Di Cola V, Martínez JJ, Gardenal CN, Chiaraviglio M. Species delimitation in the continental forms of the genus Epicrates (Serpentes, Boidae) integrating phylogenetics and environmental niche models. PLoS One. 2011; 6(9): e22199. pmid:21912634
- 101. Lee MS, Palci A. Morphological phylogenetics in the genomic age. Curr Biol. 2015; 25(19): R922–R929. pmid:26439355