A Major Role for the Plasmodium falciparum ApiAP2 Protein PfSIP2 in Chromosome End Biology
Figure 3
Binding of PfSIP2-N to SPE2 is highly sequence-specific and requires a bipartite motif and both adjacent AP2 domains.
(A) SIP2-N in 3D7 nuclear extracts binds only to the bipartite SPE2 motif but not to a probe of identical length containing the SPE2 half site GTGCA only (GATACATGTGCAAACATGAA). C: SPE2/PfSIP2-N complex. (B) Both AP2 domains are required for binding of PfSIP2-N to SPE2. Left panel: Coomassie-stained SDS-PAGE gel showing recombinantly expressed PfSIP2-GST fusions in E. coli lysates. Lane 1: non-induced control lysate; lane 2: SIP2-AP2_1 consisting of the first AP2 domain only (aa 174–252); lane 3: SIP2-AP2_2 carries the second AP2 domain only (aa 231–311); lane 4: SIP2-AP2_12 contains both adjacent AP2 domains (aa 174–311). Right panel: EMSA showing that single isolated AP2 domains are unable to bind to SPE2 and that both AP2 domains are required for binding. C: SPE2/PfSIP2-GST complex. (C) Competition EMSA using recombinant SIP2-N-HIS_B to determine the minimal sequence requirements for binding of PfSIP2-N to a SPE2 consensus site. The gel was rotated by 90° clockwise for simpler display (the arrow on top indicates the direction of electrophoretic separation). Lane 1: radiolabeled 28bp SPE2 probe only; lane 2: SPE2/PfSIP2-N-HIS_B interaction in absence of competitor; lanes 3–19: SPE2/PfSIP2-N-HIS_B interaction in presence of a 50-fold molar excess of specific competitors. The names and sequences of all competitors (all 28bp) are indicated to the left. The dashed lines group competitors into artificially mutated SPE2 motifs or into naturally occurring SPE2-like elements upstream of P. falciparum invasion genes [55] or upsB promoters (M1.C1, M1.A1C2). Altered nucleotides in the left or right half site of the original SPE2 sequence are highlighted in red. Additional nucleotides in the 4bp spacer are indicated in green. Red squares identify competitors unable to interact with PfSIP2-N-HIS_B, green squares highlight competitors that were able to compete with the SPE2/PfSIP2-N-HIS_B interaction. The experimentally determined SPE2 consensus site is shown at the bottom. (D) SPE2 consensus motifs define subtelomeric landmarks at P. falciparum chromosome ends. The position of all SPE2 motifs (arrowheads) at the right end of chromosome 3 is shown. Blue and purple arrowheads represent SPE2 motifs with four and five bp spacing between the half sites, respectively. Arrowhead orientation indicates the presence of SPE2 motifs on the sense or antisense strand. T1-T6: TARE 1 to 6. The telomere is depicted as a black box. The upsB var gene PFC1120c represents the first coding sequence downstream of TARE6. See also Tables S3 and S4 for more information. Chromosomal coordinates are according to PlasmoDB version5.5 annotation (www.plasmodb.org).
