S. ratti activates and expands polyclonal Th2s and Tregs, eliciting associated cytokine production

While others have demonstrated increased type 2 cytokine production and Treg expansion in gut-draining mesenteric lymph nodes (mLN) during S. ratti infection [35], we first sought to confirm that polyclonal CD4+ T cells in S. ratti-infected tissue exhibit the expected Th2 and Treg phenotypes. S. ratti is a skin-penetrating soil-transmitted helminth, and once it enters the skin it travels to the lungs and naso-frontal region of the head for 1–2 days before migrating to the proximal small intestine [7]. Upon analysis of the lung at 14 days post-infection, activation markers CD11a and CD44 were both upregulated on polyclonal CD4+ T cells (Fig 1B and 1C). As expected, the frequency of GATA3+ CD4+ T cells also increased with infection (Fig 1B and 1C). Though Foxp3+ Treg expansion has been observed in the mLN of S. ratti-infected mice [22], we did not observe increased frequencies of polyclonal Foxp3+ and Foxp3+GATA3+ CD4+ T cells in the lungs of mice 14 days post S. ratti-infection relative to naïve mice (Fig 1B and 1C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Activated CD4+ T cells expand and exhibit Th2 and Treg function in during S. ratti infection.

(A) Gating strategy for CD4+ T cells in the lungs. Dump gate includes B220/CD45R, CD11b, and CD11c. (B) Activation status and transcription factor expression in CD4+ T cells from lungs of S. ratti infected mice 14 days post-initial infection (3 total infections, 1,000 iL3 per infection). (C) Frequency of activated, GATA3+, Foxp3+, and Foxp3+GATA3+ cells in the lungs of S. ratti-infected and naïve mice. (D) Type 2 and regulatory cytokine production by MACS-sorted CD4+ T cells from pooled lymph nodes at 0, 7, and 14 days post-infection following 72 hours of culture in the presence or absence of anti-CD3/CD28 antibody. (E) Total serum IgE and IgG1 levels at 0, 7 and 14 days post-infection. (F) Fecal egg deposition and adult worm counts from wild-type and RAG1-/- mice infected with S. ratti. Significance determined by Mann-Whitney test; *p <0.05, **p < 0.01.

https://doi.org/10.1371/journal.ppat.1009709.g001

Type 2 and immunomodulatory cytokine production is enhanced in mLN and spleen during S. ratti infection [35], but the extent to which CD4+ T cells contribute to this cytokine production is presently unknown. To assess cytokine production by CD4+ T cells from site-draining lymph nodes, we sorted CD4+ T cells from pooled draining lymph nodes of infected mice and stimulated cells with anti-CD3/CD28 for 3 days and assessed cytokine release. As expected, CD4+ T cells robustly upregulated type 2 cytokines IL-4, IL-5 and IL-13 by day 7 post-infection (Fig 1D). This response was significantly diminished by day 14, at which point the mice cleared a majority of worms from the small intestine. In addition, we observed enhanced secretion of IL-10, as well as the EGFR ligand amphiregulin, a molecule expressed by both Tregs and Th2 cells (Fig 1D). Similar to the kinetics of type 2 cytokine production, both IL-10 and amphiregulin peaked at 7 days post-infection and had returned completely to baseline by day 14. Interestingly, there was also an increase in IFN-γ production by CD4+ T cells 7 days post-infection (S1A Fig), but this increase in type 1 cytokine production was not associated with an increase in canonical Th1 or Th17 transcription factor expression. Indeed, transcript levels of both Tbx21 (Tbet) and Rorc (RORγt) were diminished in infected mice on day 7 relative to naïve mice (S1B Fig).

Since CD4+ T cells also provide help to B cells in lymph node germinal centers, we also assessed levels of polyclonal type 2-associated antibody isotypes in the serum over the course of infection. As expected, we observed an increase in total serum IgE by day 7 post-infection that was maintained at day 14 (Fig 1E). Surprisingly, we did not observe an increase in serum levels of IgG1, which is an isotype that is largely dependent on T cell help and IL-4 signaling [36]. This finding correlated with data showing an unexpected increase in IFN-γ secretion, which antagonizes IL-4 signaling and inhibits Th2-mediated inflammation (S1A Fig) [37,38]. However, IFN-γ-regulated isotypes IgG2b and IgG2c levels were not upregulated (S1C Fig), suggesting that IgE is the dominant isotype induced by S. ratti infection. S. ratti clearance was significantly impaired in RAG1-deficient mice that lack both T and B cells, as evidenced by continued fecal egg deposition and presence of intestinal worms up to 25 days post-infection (Fig 1F). Altogether, these data indicate that S. ratti elicits CD4+ T cells producing diverse inflammatory and immunomodulatory cytokines.

Hulk is a novel strain of S. ratti that expresses a 2W1S-GFP-FLAG fusion protein

To create a system for in vivo tracking of helminth-specific CD4+ T cells, we designed a plasmid vector to encode 2W1S peptide (EAWGALANWAVDSA) as a fusion protein with GFP followed by the FLAG peptide epitope (schematic in Fig 2A). The S. sterocoralis actin-2 promoter was used to drive high-level expression in the body wall muscle, which underlies the cuticle in Strongyloides spp. This construct was co-injected with a vector encoding the piggyBac retrotransposase into the gonads of free-living females to yield transformed, GFP-expressing progeny. After six passages through Wistar rats, GFP expression was consistently observed in 90–95% of Hulk third-stage infective larvae (iL3) (Fig 2F), and could be observed in every other free-living life stage examined (Fig 2B). To ensure that the length of the fusion protein (36 kD) was transcribed and translated in parasitic life stages, Western blotting was used to detect FLAG and/or GFP in skin-penetrating iL3, lung-residing fourth-stage larvae (L4), and gut-dwelling parasitic adult female stages of Hulk (Fig 2B). Consistent with microscopic analysis of the iL3 stage, Hulk L4 and parasitic adults both maintained GFP expression at the protein level (Fig 2D and 2E). Interestingly, microscopic analysis revealed that the frequency of GFP+ parasitic adults in the small intestine (85.8% ± 2.94%) did decline relative to the frequency of GFP+ iL3 used for infection (94.3%) (Fig 2F). Further, expression of the C terminal FLAG tag was diminished in Hulk L4 relative to the iL3 stage (Fig 2C and 2D), and FLAG could not be detected in Hulk parasitic adults (Fig 2E). Importantly, neither FLAG nor GFP was detected in the parental strain in any of the life stages examined (Fig 2C–2E).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Hulk expresses 2W1S peptide as a fusion protein with green fluorescent protein (GFP) and FLAG.

(A) Schematic depicting Hulk plasmid encoding green fluorescent protein (GFP), 2W1S peptide, and FLAG peptide under control of the Strongyloides stercoralis actin (Ss-act-2) promoter. (B) Brightfield DIC (top) and green fluorescent (bottom) images of the first and third larval stages, adult free-living female stage, and egg stage of Hulk (L1, L3, eggs: 40x magnification; Free-living adult: 20x magnification). (C-E) Western blot analysis of FLAG and/or GFP protein expression in Hulk and parental S. ratti at the indicated protein amounts in iL3 (C), L4 (D) and parasitic adult females (E). β-actin and/or GAPDH were detected as loading controls. (F) Frequency of GFP+ and GFP- parasites at the iL3 and parasitic adult female stages (7 days post-infection). (G) Fecal egg enumeration per gram of feces for C57BL/6 mice infected with1000 infective L3 (iL3) Hulk or the parental S. ratti strain (n = 4). (H-I) Enumeration of L4 (H) or parasitic adult females (I) at the indicated days post-infection. Mice were infected with 3,000 iL3 in H and with 1,000 iL3 in I. Significance tested using Mann-Whitney test.

https://doi.org/10.1371/journal.ppat.1009709.g002

Finally, we sought to ascertain whether transgene insertion impaired the virulence of Hulk relative to the parental strain. We did not observe differences in worm burdens in the lung and gut on days 2 and 7 post-infection, respectively between Hulk and parental-infected mice (Fig 2G–2I). Lung hemorrhage, which is apparent 2 days post-infection with parental S. ratti and largely resolved by day 14, was comparable following infection with Hulk (S2 Fig). These data demonstrate that there is no appreciable difference in the infectivity of Hulk in comparison to parental S. ratti.

Hulk induces 2W1S-specific CD4+ T cell expansion in the lung proportional to antigen load and GFP-specific antibody responses in serum

We next asked whether Hulk infection could drive adaptive immune responses against transgenically expressed antigens, specifically T cell responses against 2W1S peptide and antibodies against GFP. 2W1S-specific CD4+ T cells were found to expand in the lung parenchyma of infected mice 14 days post-infection, whereas this did not occur in mice infected with the parental strain or in naïve controls (Fig 3B). Additionally, anti-GFP IgG and IgM antibodies could be detected at higher titers in Hulk-infected mice than in parental-infected or naïve control mice (Fig 3C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Hulk infection induces transgene-specific adaptive immune responses.

All mice were analyzed 14 days post-initial infection, and 2W1S-specific cells were enriched using a fluorophore-specific MACS bead sorting pulldown technique prior to flow cytometry. (A) Representative gating strategy, shown in lung. Dump gate includes B220/CD45R, CD11b, and CD11c. (B) 2W1S:I-Ab+CD44+ CD4+ T cell frequency in the lungs of naive mice and mice infected once with Hulk, parental S. ratti (n = 3–4, pooled). (C) Anti-GFP IgM+IgG serum titers from naïve, parental S. ratti-infected and Hulk-infected mice, *p < 0.05. (D) 2W1S:I-Ab+CD11a+ CD4+ T cell frequency in the lungs of naive mice and mice infected once or three times (days 0, 5, 10) with Hulk (n = 1–3, pooled). (E) 2W1S:I-Ab+CD11a+ CD4+ T cell frequency in the lung-draining mediastinal lymph nodes (mdLN) of naive mice or mice infected once or three times with Hulk (n = 1–3, pooled). (F) Schematic of experimental design used in (G-I). (G) Representative flow plots showing CD11a+Ki67+ CD4+ T cells in lungs of mice infected and peptide challenged as in (F). (H-I) Frequency and number of CD11a+Ki67+ CD4+ T cells in the lungs of mice infected and peptide challenged as in (F). Significance tested using Mann-Whitney test; *p < 0.05, ****p < 0.0001.

https://doi.org/10.1371/journal.ppat.1009709.g003

To determine whether the clonal burst size of Hulk-elicited 2W1S-specific CD4+ T cells could be increased following multiple infections, we also quantified 2W1S+CD4+ T cell expansion following three successive inoculations with 1,000 iL3 (schematic in S3A Fig). Notably, egg production kinetics over three infections was similar to that observed following a single infection, with a peak between days 6–7 post-initial infection and no subsequent peaks correspondent to subsequent infections (S3B Fig), and no adult worms were found 14 days post-infection. However, multiple live infections resulted in a 30-fold increase in the frequency and a 6.5-fold increase in the number of CD11a+2W1S+CD4+ T cells in the lung over mice given a single dose of 1,000 iL3 Hulk iL3 (Fig 3D). Expansion of CD11a+2W1S+CD4+ T cells also occurred to a lesser extent in the lung-draining mediastinal lymph nodes (mdLN) following one infection, and was similarly proportional to antigen load following three Hulk inoculations (Fig 3E). In order to corroborate this finding, we also quantified the frequency and number of activated and proliferating CD4+ T cells by CD11a and Ki67 expression following in vivo 2W1S peptide restimulation of Hulk-infected, parental-infected or naive mice (schematic shown in Fig 3F). Since a predominance of 2W1S-specific CD4+ T cells were found in the lung, we used irradiated larvae which arrest in the lung and delivered peptide to the lung by intratracheal injection. As expected, we observed an increase in the frequency of CD11a+Ki67+ CD4+ T cells following 2W1S peptide restimulation in Hulk-infected mice relative to control mice (Fig 3G–3I).

Following a molt in the lung, S. ratti migrates to the small intestine where it burrows into the epithelium to form sexually mature adults. Accordingly, we sought to determine whether 2W1S-specific CD4+ T cells expanded in the gut in addition to lung tissue. Interestingly, we found that irrespective of whether mice received one or three inoculations, only a negligible number of 2W1S-specific CD4+ T cells could be detected in gut-draining mLN or the Peyer’s patches compared to parental-infected or naïve mice (S4 Fig). These data revealed that among the tissues evaluated, the lung parenchyma holds the predominance of the 2W1S-specific CD4+T cell response. This response pattern is also consistent with our observation that the C-terminal region of the GFP-2W1S-FLAG fusion protein is expressed in the lung-dwelling L4 but not the gut-dwelling adult stage of Hulk.

2W1S-specific CD4+ T cells exhibit distinct transcriptional profiles during Hulk vs. 2W1S- Salmonella infection

Having determined that Hulk infection successfully expanded 2W1S-specific CD4+ T lymphocytes, we next asked whether altering the infectious context in which the 2W1S epitope was presented would skew the phenotype and/or effector function of the CD4+ T cells. Transcriptional profiling was performed on activated 2W1S-specific CD4+ T cells isolated from mice inoculated with Hulk- or infected with the 2W1S-expressing vaccine strain of Salmonella typhimurium, LVS strain BRD509-2W1S (ΔaroA) (2W-Salmonella) (Fig 4A). Hulk and 2W-Salmonella infections drove expansion of 2W1S-specific CD4+ T cells that were transcriptionally distinct by principle component analysis, with 22.3% of variation driven by infectious context (Fig 4B). Predictably, 2W-Salmonella infection induced T cell-intrinsic expression of genes involved in type 1 and type 17 immune responses, including Tbx21 (Tbet), Rorc (RORγt), Il17d/f and Il22 (Fig 4C). However, Hulk infection was associated with upregulation of both canonical type 2 genes, including Gata3, Il4, Il5, and Il13, as well as immunosuppressive genes like Il10 (Fig 4C). Though we expected these canonical type 2 and immunomodulatory genes to be highly expressed in Hulk-expanded 2W1S-specific CD4+ T cells, to our surprise the most significantly upregulated gene in this population was amphiregulin, an EGFR ligand known to be expressed by both Th2 cells as well as Tregs [25,39].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Hulk, but not 2W-Salmonella, infection enriches type 2 and immunosuppressive programs in 2W1S:I-Ab+CD4+ T cells.

A) Schematic of experimental design for mRNA sequencing. 2W1S+CD4+ T cells were isolated from pooled lungs and mdLN of Hulk-infected mice and pooled mLN and Peyer’s patches of 2W-Salmonella-infected mice. Schematic created with images from BioRender.com. (B) Principal component analysis comparing 2W1S-specific CD4+ T cells from Hulk (Hulk_2W) and 2W-Salmonella (Salm_2W)-infected mice. (C) Volcano plot depicting genes of interest enriched in Hulk or Salm-elicited 2W1S-specific CD4+ T cells. (D) Heatmap depicting enrichment of curated Th2 Signature gene set in Hulk-expanded 2W1S-specific CD4+ T cells. (E) Heatmaps depicting enrichment of Negative Regulation of IκB and NFκB Signaling and SMAD Binding gene sets (Gene Ontology) in Hulk-expanded 2W1S-specific CD4+ T cells.

https://doi.org/10.1371/journal.ppat.1009709.g004

To further understand how two different CD4+ T cell populations with shared antigen receptor specificity were altered by infectious context, gene set enrichment analysis (GSEA) was performed using an in-house curated Th2 gene set (S1 Table) and gene ontology (GO) terms. Notably, and consistent with the differentially expressed gene list, Hulk-expanded 2W1S-specific CD4+ T cells were enriched for signature Th2 genes, including transcription factors Gata3, Bhlhe4 (Dec2), JunB, Gfi1 and Maf (c-Maf), cytokines IL-4 and IL-13, and receptors for IL-33 (Il1rl1) and IL-4 (Il4ra) (Fig 4D). Hulk-expanded 2W1S-specific CD4+ T cells also showed multiple significantly enriched GO pathways (FDR < 0.01) (S5 Fig). Interestingly, two of these pathways were 1) Negative Regulation of IκB and NFκB signaling and 2) SMAD binding, which include genes often associated with Tregs, including Il10, Tgfbr2 (TGβRII), and Il1rl1 (IL-1Rap, a component of the IL-33 receptor) (Fig 4E). These pathways also include genes such as Tnfaip3 (A20), which is implicated in T cell activation and activation induced cell death, and Tob1, a negative regulator of T cell activation, suggesting that Hulk-expanded 2W1S-specific CD4+ T cells may be intrinsically negatively regulated to a greater extent than those expanded during 2W-Salmonella infection [40,41].

GSEA revealed a number of basic cellular pathways that were upregulated in 2W1S-specific CD4+ T cells expanded by 2W-Salmonella, including DNA Repair and Replication (S6 Fig). Altogether, these results indicated that both Hulk and 2W-Salmonella infections drove expansion of 2W1S-specific CD4+ T cells that adopted prototypic type 2 or type 1/17 effector functions, respectively, but that Hulk infection specifically expanded 2W1S-specific cells with putative suppressor function. These data reveal that, whereas 2W-Salmonella elicited 2W1S-specific CD4+ T cells resembled type 1 and type 17 effector cells, Hulk elicited cells resembled type 2 effectors and immunosuppressive Tregs.

Hulk-elicited 2W1S-specific CD4+ T cells produce amphiregulin in response to peptide restimulation and express both GATA3 and Foxp3

We next sought to determine the phenotype and function of 2W1S-specific CD4+ T cells during Hulk infection. Based on RNA sequencing, Hulk-elicited 2W1S-specific CD4+ T cells upregulate type 2 cytokines IL-4, IL-5, IL-13, and amphiregulin. In order to validate that this was also true at the protein level, we first performed in vitro 2W1S peptide restimulation of cells from lung tissue of naïve mice or mice infected 3 times with live Hulk or parental S. ratti. After 72 hours in culture, amphiregulin was significantly upregulated in cells from Hulk-infected mice upon peptide restimulation relative to controls (Fig 5A). Notably, the level of amphiregulin production from 2W1S stimulated cells was roughly one-third of the concentration measured in supernatants from cells polyclonally stimulated with anti-CD3, suggesting that 2W1S-specific CD4+ T cells contribute robustly to overall CD4+ T cell-derived amphiregulin levels in the lung.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. CD4+ T cells that recognize 2W1S in the lung produce amphiregulin and are heterogeneously Th2 and Treg cells.

(A) Amphiregulin production by lung cells from naïve mice or mice infected 3 times with live Hulk or parental S. ratti following 72 hours restimulation with 2W1S or anti-CD3. (B) Spontaneous amphiregulin production by lung cells from naïve mice or mice infected 3 times with irradiated Hulk or parental S. ratti and challenged intratracheally with 2W1S peptide after 48 hours in culture. (C) Amphiregulin levels in broncheoalveolar lavage fluid (BALF) from mice infected and challenged as is (B). (D) Representative flow plots showing GATA3+Ki67+ CD4+ T cells in BALF of mice infected and peptide challenged as in (B). Parent gates were set according to the gating strategy shown in Fig 3A. (E-F) Frequency and number of GATA3+Ki67+ CD4+ T cells in BALF of mice infected and peptide challenged as in (B). (G) Representative flow plots showing GATA3+Ki67+ CD4+ T cells in lungs of mice infected and peptide challenged as in (B). Parent gates were set according to the gating strategy shown in Fig 3A. (H-I) Frequency and number of GATA3+Ki67+ CD4+ T cells in lungs of mice infected and peptide challenged as in (B). (J) GATA3 and Foxp3 expression in CD11a+2W1S:I-Ab+ CD4+ T cells from lymph nodes and lungs of naïve mice or mice infected 3 times with live Hulk following 72 hours of anti-CD3/CD28 stimulation. (K) Relative frequencies of GATA3+, GATA3+Foxp3+, Foxp3+ or GATA3-Foxp3- cells within 2W1S:I-Ab+ CD4+ T cells shown in (J). (L) Foxp3-expressing 2W1S:I-Ab+ CD4+ T cells following 2W1S-immunization or 3 live Hulk infections. (M) Frequency of Foxp3+ cells within 2W1S:I-Ab+ CD4+ T cells. Significance determined using Student’s T-test with Welch’s correction (A) or Mann-Whitney test (B-C, E-F, H-I); *p < 0.05.

https://doi.org/10.1371/journal.ppat.1009709.g005

To further confirm this finding, we also performed in vivo peptide restimulation of Hulk-infected, parental-infected or naïve mice. In this experiment, we infected mice 3 times with irradiated larvae, which arrest in the lung, to further enhance the amount of antigen present in this tissue (schematic shown in Fig 3F). One week after the last infection, mice were administered 2W1S peptide intratracheally, and 2 days later we isolated whole lung cells and assayed their cytokine production over 48 hours in vitro. As observed with in vitro peptide restimulation, in vivo peptide restimulation of lung cells from Hulk-infected mice resulted in slightly enhanced amphiregulin relative to parental-infected mice and significantly enhanced production relative to naïve mice (Fig 5B). Amphiregulin levels in the bronchoalveolar lavage fluid (BALF) were also significantly elevated in Hulk-infected mice relative to parental controls (Fig 5C). Flow cytometric characterization of cells from BAL and lungs of these mice further suggested that the cells responding to 2W1S peptide were Th2 cells, since proliferating (Ki67+) GATA3+ CD4+ T cells were significantly enriched by frequency in Hulk-infected mice relative to parental-infected and naïve controls (Fig 5D–5I). Interestingly, however, type 2 cytokines IL-4, IL-5 and IL-13 were not significantly upregulated in Hulk-infected mice relative to controls whether stimulated ex vivo or in vivo (S7 Fig). Though surprising given the increased frequency of GATA3+ CD4+ T cells in Hulk-infected mice, this result is consistent with the fact that amphiregulin was more highly enriched in Hulk 2W1S-specific CD4+ T cells than any other type 2 cytokine by RNA sequencing.

Our RNA sequencing analysis revealed that Hulk-elicited 2W1S-specific CD4+ T cells upregulate GATA3 and type 2 cytokines, but also some genes associated with Tregs. Further, amphiregulin is known to be produced by both Th2 and Tregs. Accordingly, we next asked whether Hulk-expanded 2W1S-specific CD4+ T cells heterogeneously expressed Th2 and Treg lineage-defining transcription factors. To this end, 2W1S-specific CD4+ T cells from mice inoculated 3 times with Hulk were evaluated for expression of the Th2 lineage-defining transcription factor GATA3 and the Treg lineage-defining transcription factor Foxp3. Total CD4+ T cells were isolated from the lungs and lymphoid tissues of infected and naïve mice and stimulated for three days on anti-CD3/CD28-coated plates to enrich the 2W1S-specific CD4+ T cell population. We observed that a majority (60%) of 2W1S-specific CD4+ T cells from Hulk-infected mice were GATA3 single positive, 1.0% were Foxp3 single positive, and 1.7% were double positive for GATA3 and Foxp3 (Fig 5J and 5K). Furthermore, when 2W1S-specific CD4+ T cells were analyzed for Foxp3 expression directly ex vivo, up to 30% of all 2W1S-specific CD4+ T cells expressed Foxp3 (Fig 5L and 5M). In contrast, immunization with 2W1S peptide with alum as adjuvant did not expand Foxp3+ 2W1S-specific CD4+ T cells to the same extent (Fig 5L and 5M). Taken together with our transcriptional analysis, we interpret these data to indicate that Hulk selectively expands a heterogenous population of 2W1S-specific CD4+ T cells with the potential to function as Th2s or Tregs.

Immunization with 2W1S peptide enhances amphiregulin-expressing CD3+ cells in the lung parenchyma following Hulk infection

Given that a proportion of 2W1S-specific CD4+ T cells express GATA3 and amphiregulin, a molecule necessary for clearance of the GI nematode Trichuris muris [39], we questioned whether these cells could promote Hulk clearance. However, mice immunized with 2W1S peptide and alum adjuvant had comparable worm burdens as non-immunized mice 3 and 6 days following primary Hulk infection (Fig 6A and 6B). This result was in spite of the increased number and frequency of activated 2W1S-specific CD4+ T cells in the lungs of immunized mice relative to non-immunized mice (S8 Fig). As expected, however, mice given a secondary infection with Hulk had significantly reduced worm burdens compared to mice given a primary infection (Fig 6A and 6B), but these mice still had significantly fewer activated 2W1S-specific CD4+ T cells than peptide-immunized mice (S8 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. 2W1S peptide immunization prior to Hulk infection does not confer protection, but ameliorates lung tissue damage.

Mice immunized with 2W1S peptide and alum were subsequently infected with Hulk and compared to mice given a primary or secondary Hulk infection. (A-B) Adult worm burdens in the small intestine of mice on day 3 (A) or day 6 (B) post-primary (1°) or secondary (2°) Hulk infection. (C) Spontaneous amphiregulin production in supernatants from lung cells from indicated groups isolated 3 days post-infection and cultured for 72 hours. (D) Representative images of lung tissue from 1°, 2W1S-immunized + 1° or 2° infected mice 3 days post-infection (63x). DAPI is shown in blue, CD3 is shown in red and Areg is shown in green. Yellow arrows indicate cells that were counted at DAPI+CD3+Areg+. Scale bars represent 100 um. (D) Number of CD3+DAPI+ or (E) Areg+CD3+DAPI+ cells counted per high-powered field (63x). Significance determined using (A-B) Mann-Whitney test or (C, E-F) Student’s T-test with Welch’s correction; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

https://doi.org/10.1371/journal.ppat.1009709.g006

While amphiregulin has been implicated in GI nematode clearance, it has also been shown to be integral for wound repair at mucosal sites [24,42]. Accordingly, we sought to determine whether 2W1S immunization led to increased amphiregulin in Hulk-infected lungs at a timepoint when larvae usually cause injury as they migrate out of the lungs and into the gut (S2 Fig) [43]. Interestingly, prior immunization with 2W1S peptide was associated with elevated spontaneous release of amphiregulin by lung cells isolated 3 days post-infection following a 72 hour culture period (Fig 6C). Additionally, we observed an increased number of both CD3+ and Areg+CD3+ cells in the lung parenchyma of 2W1S-immunized mice relative to non-immunized primary and secondary Hulk-infected lungs (Fig 6D–6F). Though these amphiregulin-producing T cells do not correlate with enhanced Hulk clearance, these data may indicate that 2W1S immunization can improve lung tissue repair later following infection.

Ethics statement

All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Pennsylvania (Protocol No. 805911). Crl:WI (Wistar) rats were used for generation of the transgenic Hulk line. Crl:NIH-Foxn1^rnu rats and Crl:MON(Tum) gerbils were used for maintenance of both parental and transgenic S. ratti strains, as these hosts maintain infections for up to 6 months. All rats and gerbils were purchased from Charles River. For experimental purposes, wild-type C57BL6 mice were bred in-house or purchased from Taconic. Prior to subcutaneous infections, mice were anesthetized using isoflurane in an induction chamber. Euthanasia was performed by exposing mice to carbon dioxide (CO₂) for 10 minutes, after which time euthanasia was confirmed by cervical dislocation. Animals were housed under specific-pathogen free barriers in an AAALAC-accredited vivarium at the University of Pennsylvania. All IACUC protocols and routine husbandry and medical care of animals at the University of Pennsylvania were conducted in strict accordance with the Guide for the Care and Use of Laboratory Animals of the US National Institutes of Health [58].

S. ratti strain generation, maintenance, and animal infection

The Hulk strain of S. ratti was derived using published methods [32]. Briefly, the GFP-2W1S-FLAG transgene contained in plasmid vector pPV691 was integrated into the parental S. ratti genome using the piggyBac transposon system, where the transposase was provided in trans by non-integrated vector pPV402. pPV691 encodes the GFP-2W1S-FLAG fusion protein under the promoter for Ss-act-2 and utilizes the Ss-era-1 3’ UTR, a multi-purpose terminator for transgenes in S. stercoralis and S. ratti [59,60]. Plasmid constructs are depicted in S9 Fig. Transgenic progeny were selected based on GFP-expression and passaged serially through Wistar rats until the GFP+ frequency was roughly 90–95%, which was achieved after 6 passages. Parental (ED321) and Hulk strains of S. ratti were maintained in Crl:NIH-Foxn1^rnu rats and gerbils and cultured as previously described [61]. For infections, infective third-stage larvae (iL3) were isolated via the Baermann funnel technique from charcoal coprocultures grown at 22°C for 5 or more days. In cases where secondary infections were administered, mice were infected once with 1,000 live iL3 and allowed to rest for 3–6 weeks prior to challenge with 1,000 iL3 live iL3. Larvae were washed three times in phosphate-buffered saline (PBS) with 1% Penicillin-Streptomycin (P/S) to minimize carryover of fecal bacteria and enumerated under a light microscope. When indicated, iL3 were irradiated at a concentration of 16,500 iL3 per mL in PBS with 90 Gy using a Cs-137 irradiator [4]. Infective larvae were confirmed to be alive post-irradiation by motility under a microscope, and developmental arrest in-host was confirmed by absence of fecal eggs on days 6–9 post-infection. Mice were infected with indicated numbers of iL3 by subcutaneous injection of the flank skin.

2W-Salmonella culture and infection

Prior to infections, the 2W1S-expressing vaccine strain of Salmonella Typhimurium, LVS strain BRD509-2W1S (ΔaroA), was streaked onto LB agar plates supplemented with streptomycin and incubated at 37°C overnight. LB broth supplemented with streptomycin and kanamycin was then inoculated with a single colony and incubated at 37°C in a bacterial shaker for 16–18 hours. Mice were fasted overnight prior to infection, and dosed twice orally (5 x 10⁹ CFU in 5% NaCHO₃) on days 0 and 2 and once intraperitoneally (1 x 10⁵ CFU in PBS) on day 2 with 2W-Salmonella. All mice were euthanized 7 days post-initial oral infection. Dose estimates were confirmed by serially diluting the inoculum onto LB agar supplemented with streptomycin and quantifying 24 hours later. Infection was confirmed by plating spleen homogenates from infected mice on LB agar plates supplemented with streptomycin and counting colonies 24 hours later.

2W1S peptide administration

For in vivo peptide restimulations, 100 μg 2W1S peptide (EAWGALANWAVDSA, GenScript) was administered intratracheally using a nebulizing syringe 7 days following the third of 3 infections with irradiated Hulk or parental S. ratti iL3. Mice were euthanized 2 days post-peptide challenge. For 2W1S+ CD4+ T cell identification by flow cytometry and immunization, mice were immunized with 5 or 100 μg 2W1S peptide (respectively) and 1 mg alum (Invivogen) intraperitoneally. CD4+ T cell responses were measured 5 days post-immunization, and immunized mice were challenged with Hulk 3–6 weeks following immunization.

Tissue dissection and digestion

Bronchoalveolar lavage (BAL) was performed by flushing lungs with 0.5 mL PBS with 2 mM EDTA and 0.5% bovine serum albumin (BSA). Cells were isolated by centrifugation at 1,700 RPM for 5 minutes, and red blood cells were lysed in 1 mL ACK lysis buffer for 5 minutes at room temperature. BAL fluid (BALF) was removed after the first centrifugation for analysis by ELISA. Lungs were perfused with 10 mL cold PBS. For prefixation and cryosectioning, lungs were inflated with 0.75 mL 4% paraformaldehyde (PFA) and removed. For tissue digestion, lungs were removed and minced using dissection scissors prior to a 40 minute digest at 37°C in digestion buffer (0.4 g/L Dispase II, 0.15 g/L Liberase TM, and 0.014 g/L DNase I in serum-free DMEM). After 40 minutes, digests were extruded through a 16G needle 10 times and returned to incubate for an additional 15 minutes before being extruded again through an 18G needle 10 times. Cell suspensions were then strained over a 70 μm strainer, centrifuged at 1,700 RPM for 5 minutes at 4°C, and red blood cells were lysed in 2 mL ACK lysis buffer for 5 minutes at room temperature. Cells were centrifuged again at 1,700 RPM for 5 minutes at 4°C and resuspended in complete RPMI (cRPMI) (10% fetal bovine serum (FBS), 1% Penicillin/Streptomycin (P/S)). Lymph nodes and Peyer’s patches were dissected, homogenized over a 70 μm cell strainer (Fisher Scientific), centrifuged at 1,500 RPM for 5 minutes at 4°C and resuspended in cRPMI. Cells were enumerated using a Muse Cell Analyzer (EMDMillipore).

Flow cytometry and Fluorescence-Associated Cell Sorting (FACS)

APC-conjugated MHCII:I-Ab EAWGALANWAVDSA (2W1S) tetramer was obtained from the NIH Tetramer Core. Tetramer-labeled 2W1S-specific CD4+ T cells were enriched and analyzed using the protocol previously described [62]. Briefly, single cell suspensions were stained for 1 hour at room temperature at a final tetramer concentration of 16.7 nM in Fc block (0.2 mg/mL goat γ globulin, 5 μg/mL 2.4G2 in PBS) and enriched over a MACS LS column using magnetic-conjugated anti-APC beads (MACS Miltenyi). Following tetramer enrichment, cells were stained with LIVE/DEAD Aqua (Invitrogen) and the following surface markers: CD3 BV650, BV711 or Pe-Cy5 (17A2 or 145-2C11, BioLegend), CD4 APC-Cy7 (GK1.5, BioLegend), CD8 PE-TexasRed (5H10, Thermo Fisher), CD44 AF700 (IM7, BioLegend), CD11a Pe-Cy7 (2D7, BD Biosciences) CD62L BV421 (MEL-14, BioLegend), B220 PerCP-Cy5.5, BV711, or FITC (RA3-6B2, BioLegend, ThermoFisher), CD11b PerCP-Cy5.5, BV711, or FITC (M1/70, BioLegend), and CD11c PerCP-Cy5.5, BV711 or FITC (N418, BioLegend, Thermo Fisher) diluted in FACS buffer (2% BSA, 0.1% NaNA₃) for 20–30 minutes. After surface stain, cells were washed with permeabilization buffer and fixed for 30 minutes using the Foxp3/Transcription Factor Staining Buffer set (ThermoFisher). After fixation, cells were washed with permeabilization buffer and stained overnight in permeabilization buffer with the following markers: Ki67 eF450 (SolA15), Foxp3 PE or Pe-Cy5.5 (FJK-16s, ThermoFisher), and GATA3 AF488 (TWAJ, ThermoFisher). All staining steps after tetramer enrichment were done at 4°C. All flow cytometry data were acquired on an LSR Fortessa (BD) and analyzed in FlowJo 10.6.1 (TreeStar).

For sorting, tetramer-labeled cells were enriched as for flow cytometry and stained as described above in azide-free sorting buffer (2% BSA in PBS). Roughly 1,000 live, singlet CD3+CD4+CD8-CD62L-2W1S+ events from each biological replicate were collected into lysis buffer (SMART-seq v4 Ultra Low-Input RNA Kit, Takara Bio) in 1.5 mL Eppendorf tubes. 2W1S+CD4+ T cells were sorted from pooled lungs and mdLN of Hulk-infected mice, and from pooled mLN and Peyer’s patches of 2W-Salmonella-infected mice. Cells were frozen until ready to proceed with cDNA synthesis. Sorting was performed on an Aria II (BD).

Tissue pre-fixation and cryosectioning

Following perfusion and inflation with 4% PFA, lungs were removed with the trachea attached and incubated in 4% PFA for 1 hour at room temperature. Lungs were then washed once with PBS and incubated in PBS for up to 4 hours at room temperature prior to being incubated overnight at 4°C in 30% sucrose with 0.02% sodium azide. The next day, lungs were placed in 50% optimal cutting temperature (OCT; Scigen) medium with 15% sucrose for 2 hours at room temperature and then embedded in 100% OCT on dry ice.

OCT cryoblocks were sectioned at a thickness of 7μm on a Leica cryostat. Sections were placed onto poly-L-lysine-coated, positively-charged slides (Fisher Scientific) and kept frozen until immunostaining.

Immunofluorescence

Slides were thawed at room temperature for 20 minutes and then washed 3 times in 1X tris-buffered saline (TBS) for 5 minutes each wash. Slides were then blocked and permeabilized for 1 hour at room temperature in block/perm buffer (3% BSA, 3% normal horse serum (Jackson Immunoresearch), 0.3% mouse-on-mouse blocking reagent (R&D Systems), and 0.3% TritonX-100 (Millipore-Sigma) in 1X TBS). Primary antibodies were incubated overnight at 4°C in block/perm buffer, and include: anti-CD3 (Clone 145-2C11, eBioscience, 1:250) and anti-Amphiregulin (polyclonal, Bioss Antibodies, 1:200). The next day, slides were washed 3 times in 1X TBS for 5 minutes per wash and then incubated with the appropriate secondary antibodies for 2 hours in block/perm buffer. These antibodies include Cy-3 anti-Armenian hamster, Cy-3 anti-rat, and AF488 anti-rabbit (Jackson Immunoresearch, 1:1000). Slides were then washed as before and stained for 30 minutes with DAPI (1 μg/mL, ThermoFisher). After DAPI staining, slides were washed again as before and mounted with ProLong Gold antifade reagent (Invitrogen) and a covered with coverslips (Fisher Scientific). All slides were imaged on a DMi8 microscope (Leica), and analyzed using LAS X software (Leica) and ImageJ (NIH).

RNA sequencing

cDNA was synthesized directly from cell lysates using the SMART-seq v4 Ultra Low-Input RNA Kit (Takara Bio). Libraries were prepared using NexteraXT library prep (Illumina) kits. The samples were loaded onto a platform for single read 75 cycles at the depth of 33 million reads per sample. Sequencing reads were trimmed for quality (phred score < 33) and to remove adapter sequences using the Trimmomatic software [63]. High quality reads were aligned to the GRCm38.p6/mm10 reference genome using the STAR aligner [64], and quantified to genes with HTSeq-count [65]. Differentially expressed genes were obtained using the DESeq2 tool in the R statistical software [66] and gene set enrichment analysis was assessed using the GSEA R tool [67,68].

RNA isolation, cDNA synthesis and quantitative real-time (qRT)-PCR

RNA was isolated from pelleted MACS-sorted CD4+ T cells using the NucleoSpin RNA Plus kit according to the manufacturer’s instructions (Macherey-Nagel). cDNA was prepared by combining RNA, random primers, and dNTPs and heating for 5 minutes at 65°C for 5 minutes, Samples were then chilled briefly, mixed with 5x RT buffer (Invitrogen) and incubated at 25°C for 2 minutes. Maxima H Minus reverse transcriptase (Invitrogen) was then added at a 1:1 ratio with molecular-biology grade water, and cDNA was synthesized by incubating at 25°C for 10 minutes, 50°C for 50 minutes, and terminating at 85°C for 15 minutes. qRT-PCR was run and analyzed on a CFX96 platform (BioRad). Primers: Gapdh FWD 5’–TGTGTCCGTCGTGGATCTGA– 3’, REV 5’–CCTGCTTCACCACCTTCTTGA– 3’, Rorc (RORγt) FWD 5’–AGGAGCAATGGA AGTCGTCC– 3’, REV 5’–CCGTGTAGAGGGCAATCTCA– 3’, Tbx21 (Tbet) FWD 5’–CCAAGTTCAACC AGCACCAG– 3’, REV 5’—GCCTTCTGCCTTTCCACACT– 3’.

CD4+ T cell culture

For polyclonal CD4+ T cell stimulation, single cell suspensions from pooled infection site-draining secondary lymphoid organs (mediastinal, cervical, inguinal, and mesenteric) or lungs were sorted using the L3T4 Positive CD4+ T Cell Selection kit and LS Columns from MACS Miltenyi according to the manufacturer’s instructions. After sorting, cells were washed once in MACS buffer, counted using a Muse Cell Analyzer (Millipore Sigma), and plated at a density of 1 x 10⁶ cells per well of a 96-well round-bottom plate. Plates were either uncoated or coated with 1 μg/mL each of anti-CD3 (145-2C11, BioLegend) and anti-CD28 (37.51, BioLegend). Cells were cultured in cRPMI for 72 hours at 37°C at 5% CO₂.

For whole lung cell stimulation with 2W1S peptide or anti-CD3, single cell suspensions from lungs were prepared and plated at a density of 2 x 10⁵ cells per well in a 96 well round-bottom plate. For anti-CD3 stimulation, plates were pre-coated with 1 μg/mL anti-CD3 (145-2C11, BioLegend) and cells were resuspended in CD4+ T cell media (cRPMI + 1 mM Sodium Pyruvate, 1 mM L-Glutamine, 50 μM MEM non-essential amino acids (NEAA), 5 mM HEPES, and 50 μM β-mercaptoethanol, 10 ng/mL mouse recombinant IL-2). For peptide stimulation, cells were resuspended in CD4+ T cell media containing 100 μg/mL 2W1S peptide and 1 μg/mL anti-CD28 (37.51, BioLegend).

Enzyme-Linked Immunosorbance Assay (ELISA)

Supernatants from cultured CD4+ T cells were harvested after 48–72 hours of culture, as described above. Analytes were probed for using the following kits: IL-4 (R&D, Invitrogen), IL-5 (Invitrogen), IL-10 (Invitrogen), IL-13 (Invitrogen), IFN-γ (Invitrogen), and amphiregulin (R&D). For serum immunoglobulin ELISAs, serum was isolated from naive mice or infected mice at the indicated timepoints and diluted 1:1000 in PBS. Plates were coated with 1 ug/mL of the appropriate anti-Ig antibody (Bethyl Laboratories, Inc.), and immunoglobulins were detected using 1 ug/mL of horseradish peroxidase (HRP)-conjugated anti-Ig antibody (Bethyl Laboratories, Inc.). For anti-GFP ELISAs, serum was isolated from naive mice or infected mice 14 days post-infection and diluted as indicated in PBS. Plates were coated with 10 ug/mL recombinant GFP (Abcam), and GFP-specific IgM and IgG were detected using 1 ug/mL of HRP-conjugated anti-IgM/IgG antibody (Jackson Immunoresearch).

Western blotting

Hulk or parental S. ratti iL3, L4 or adult parasites were homogenized using a Dounce shaved glass homogenizer on ice in 2x RIPA buffer (Millipore-Sigma) with 1x cOmplete Mini Protease Inhibitor Cocktail (Roche). Debris was removed via centrifugation, and supernatants containing protein were quantified using a BCA assay (Invitrogen). Protein was diluted with PBS to obtain the amount indicated in Fig 2, and mixed with 4x Laemmli sample buffer (Bio-Rad) with 10% β-mercaptoethanol before being boiled for 5 minutes. Samples were then loaded onto NuPAGE 4–12% bis-tris gels (Thermo Fisher) and run in 1x NuPAGE MOPS SDS running buffer (Invitrogen) at 110V for 2 hours until the dye front reached the bottom of the gel. Protein was then transferred to a nitrocellulose membrane at 211 mAmps for 5 hours at 4°C using NuPAGE transfer buffer (Invitrogen). Membranes were incubated in: 5% BSA in PBS + 0.1% Tween20 (Fisher Scientific) (PBS-T) for 1 hour at room temperature (RT) to block; 5% BSA in PBS-T with primary antibody for 2 hours (RT) or overnight (4°C); and in 5% BSA in PBS-T with secondary antibody for 1–2 hours at RT. Membranes were washed 3x with PBS-T following primary and secondary antibody incubations. The following antibodies were used: mouse anti-FLAG (Clone M2, Millipore Sigma, 1:500), rabbit anti-GFP (Torrey Pines Biolabs, 1:1000), mouse anti-β-actin (Clone C4, Santa Cruz Biotechnology, 1:2000), rabbit anti-GAPDH (Bethyl Laboraties, Inc., 1:1000), HRP-linked horse anti-mouse IgG (Cell Signaling Technology, 1:2000), and HRP-linked goat anti-rabbit IgG (Cell Signaling Technology, 1:2000). Membranes were developed using the SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher) and exposed on a Bio-Rad ChemiDoc XRS System.

S. ratti fecal egg enumeration

Fecal pellets (3–7) were collected from infected mice on the days indicated over a 10–20 minute period. Feces were weighed and then incubated for 40–60 minutes in 750 μL warm PBS at 37°C before being homogenized using a wooden stick and added to 10 mL saturated NaCl solution. Once fecal slurries were added, salt solutions were capped, shaken, and incubated at room temperature for 20 minutes. Eggs were counted by pipetting 650 μL from the meniscus of the salt float onto a McMaster slide and counting using a light microscope. Eggs per gram of feces were calculated using the following equation:

Fourth-stage larval (L4) enumeration

Infected mice were euthanized 2 days post-infection with parental or Hulk S. ratti, and lungs were removed without perfusion. Lungs were minced in 7 mL PBS in 60 x 15 mm petri dishes, and incubated at 37°C for 2 hours. Following incubation, L4 were counted using a stereoscope.

Adult S. ratti enumeration

At the indicated days post-infection, the entire length of the small intestine was removed from infected mice, cut longitudinally, and placed over a wire-mesh Baerman apparatus in a 250 mL beaker with enough PBS to cover the tissue. After a brief (5–10 second) agitation, tissues were incubated at 37°C for several hours to allow adult worms to migrate out of the epithelium. Adult worms that had settled to the bottom following this incubation were then counted using a stereoscope.

Statistics

Statistical analyses were performed using Mann-Whitney tests or Student’s T-test with Welch’s correction in Prism7 (GraphPad). Statistical probabilities where p < 0.05 were considered significant: *p < 0.05; **p <0.01; ***p < 0.001; ****p < 0.0001.